ID: 1083320840

View in Genome Browser
Species Human (GRCh38)
Location 11:61845458-61845480
Sequence GGGGCTCTTGAAGGACAAGC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 17, 4: 209}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083320826_1083320840 20 Left 1083320826 11:61845415-61845437 CCATTGTTCCTGGGCAAGGCGGG 0: 1
1: 0
2: 1
3: 8
4: 147
Right 1083320840 11:61845458-61845480 GGGGCTCTTGAAGGACAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 209
1083320828_1083320840 12 Left 1083320828 11:61845423-61845445 CCTGGGCAAGGCGGGCTTCCCGG 0: 1
1: 0
2: 1
3: 12
4: 163
Right 1083320840 11:61845458-61845480 GGGGCTCTTGAAGGACAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 209
1083320836_1083320840 -7 Left 1083320836 11:61845442-61845464 CCGGTGCCCGGAAGGAGGGGCTC 0: 1
1: 0
2: 1
3: 4
4: 173
Right 1083320840 11:61845458-61845480 GGGGCTCTTGAAGGACAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 209
1083320835_1083320840 -6 Left 1083320835 11:61845441-61845463 CCCGGTGCCCGGAAGGAGGGGCT 0: 1
1: 0
2: 3
3: 20
4: 229
Right 1083320840 11:61845458-61845480 GGGGCTCTTGAAGGACAAGCAGG 0: 1
1: 0
2: 1
3: 17
4: 209

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083320840 Original CRISPR GGGGCTCTTGAAGGACAAGC AGG Intronic
900148535 1:1168449-1168471 GGGGCGCAGGAAGGACAAGGTGG + Intergenic
900572901 1:3368162-3368184 GTGGCTCTGGAAGGACCAGCAGG - Intronic
901127289 1:6938497-6938519 GGGGCTCTTGAAGGCTTGGCTGG + Intronic
903044679 1:20555762-20555784 GGGGCTTTGGAGGGAAAAGCTGG + Intergenic
903269728 1:22179919-22179941 GGGTCTCTGGAAGGAGAAACAGG - Intergenic
904696020 1:32331992-32332014 GTGTCTCTTGGAGGACACGCAGG + Intronic
907404667 1:54246613-54246635 GAGGCTCCTGAAGGCCAGGCAGG - Intronic
907475550 1:54703016-54703038 GGGGCTCTAGAGGGAAAAGGAGG - Intronic
908700733 1:66897593-66897615 TGGGCTCTTGAAGGGCACCCAGG - Intronic
911041338 1:93593289-93593311 TGGGGGTTTGAAGGACAAGCTGG - Intronic
911391231 1:97246468-97246490 TGGGCTCTTGAAAGATAAGTGGG + Intronic
912737793 1:112165565-112165587 GGGGCTCTTGCAGGGCCAGGTGG - Intergenic
916194429 1:162210275-162210297 CGTGCTCTTGAAGGTCGAGCTGG - Intronic
917971547 1:180211280-180211302 GGGGCTCATGCAGGAAGAGCAGG + Intergenic
923235079 1:232025196-232025218 GGGGCCTTTGAAGGAAAGGCTGG + Intronic
924173043 1:241360835-241360857 CGGGCTCTTCAAGGACTAGCAGG + Intergenic
924598912 1:245470756-245470778 GTGTCTCCTGAAGGACAAGAAGG + Intronic
1064287349 10:14003320-14003342 GGGGGTGTTGGAGGAGAAGCAGG + Intronic
1069795498 10:71049365-71049387 GAGGCCCTTGAATGACATGCCGG + Intergenic
1070977618 10:80617867-80617889 GGGGCTGTTGAGAGACAAGCAGG - Intronic
1072163706 10:92791357-92791379 AGGGCCATTGAAGGACAAGGAGG + Intergenic
1072239250 10:93480240-93480262 TGGGCTCTTAAAGGACAATGAGG - Intronic
1072403273 10:95126932-95126954 AGGGATCTTCAAAGACAAGCAGG + Intergenic
1073520905 10:104128253-104128275 GGGGCTTTGGAAGGACATGTGGG - Intergenic
1074194915 10:111175159-111175181 GGGGCTCTATAAGGACAAAGGGG + Intergenic
1077143035 11:1033247-1033269 GGGGCTCGTGAAGGACAGCATGG - Intronic
1077521062 11:3034984-3035006 GGGGCTCATGAGGGCCAAACTGG + Intronic
1078143081 11:8705651-8705673 GGAGCTCGTGAAGGAGAAGCAGG - Intronic
1079140469 11:17805960-17805982 GGGTTTCTTGAAGGACAAATGGG - Intronic
1080702480 11:34655872-34655894 GGGGCCCTTGAAGGCCACACTGG + Intronic
1081595756 11:44458232-44458254 AGGGCTCTTCTTGGACAAGCTGG + Intergenic
1081862663 11:46342382-46342404 GGGGCTCCTGGAGGGGAAGCAGG - Intronic
1082689233 11:56279531-56279553 GGGACTCAGGAAGGACAAGGTGG - Intergenic
1082698449 11:56399642-56399664 AGGGCTCAGGAAGGACAAGTAGG + Intergenic
1083320840 11:61845458-61845480 GGGGCTCTTGAAGGACAAGCAGG + Intronic
1083658461 11:64241435-64241457 CTGGCTCTTGAAGGAGGAGCTGG + Intronic
1087314173 11:96586868-96586890 GGGGATCTGGAAGGACAATAGGG - Intergenic
1088644973 11:111910856-111910878 AGGGCTTTGGAAGGACAAGCAGG - Intronic
1091048606 11:132348084-132348106 GGGGCTCTTGAAGGAAGACGAGG - Intergenic
1091797095 12:3303720-3303742 GGGGCTCCTGGAGGCCAGGCTGG + Intergenic
1091798001 12:3308268-3308290 GGGCATCTCTAAGGACAAGCAGG + Intergenic
1091888867 12:4036893-4036915 GGGGGTGTTCAAGGAGAAGCTGG - Intergenic
1095631858 12:44386011-44386033 GTGGTCCTTGAAGAACAAGCAGG - Intronic
1096160810 12:49375639-49375661 AGGGCTCCTGCAGGACATGCAGG - Intronic
1096518641 12:52171865-52171887 GAGGCCCAGGAAGGACAAGCTGG - Intronic
1099962995 12:89414507-89414529 GGGGCTTATGGAGGACAACCTGG + Intergenic
1102147631 12:110666840-110666862 AGGGCTCTCGAAGGAAAAGTGGG - Intronic
1102418638 12:112786527-112786549 GAGGCTCTTAAAGGAGAAGGAGG + Intronic
1105407687 13:20145510-20145532 GGGACACTTGGAGGAGAAGCAGG - Intronic
1105422007 13:20261327-20261349 GGGGTTGTTGAAGGACCAGCAGG + Intergenic
1107129459 13:36879642-36879664 GGGGCTGGTGAAGGAGAAGAGGG + Exonic
1108607657 13:52055766-52055788 GGAGCTCTTGTAGGGCAGGCCGG - Intronic
1113405250 13:110032900-110032922 TGGCCTCTTTAAGGAGAAGCGGG - Intergenic
1113485036 13:110647017-110647039 TGGGCTCTTGAAGGGGAAGAGGG - Intronic
1113618968 13:111700422-111700444 GGGGCTGTTGAACGGCAGGCTGG + Intergenic
1113624497 13:111785683-111785705 GGGGCTGTTGAACGGCAGGCTGG + Intergenic
1119484295 14:74978027-74978049 GGGGCTCCTGGAGGAGAAGGAGG - Intergenic
1122013481 14:98773226-98773248 GTAGGTATTGAAGGACAAGCAGG + Intergenic
1122086868 14:99313739-99313761 GAAGCTCTTCAAGGACAAGAAGG - Intergenic
1122692284 14:103537058-103537080 AGGGGTCTTGAAGGACATACAGG - Exonic
1128184501 15:65633069-65633091 CTGAATCTTGAAGGACAAGCAGG + Intronic
1128536009 15:68491177-68491199 CTGGTTCTTGAAGGACAAGAAGG + Intergenic
1129797736 15:78390939-78390961 CTGGCTCTTGAAAGAGAAGCTGG + Intergenic
1131216451 15:90540210-90540232 TGAGATCTTGAAGGATAAGCTGG + Intronic
1132682884 16:1150859-1150881 GGGCCTCTGTGAGGACAAGCCGG - Intergenic
1132727057 16:1343453-1343475 GGGGCTGCTGGAGGACATGCAGG + Exonic
1133240288 16:4410034-4410056 AGGGCTCTTCAAGTAGAAGCTGG - Intronic
1134365228 16:13570944-13570966 GGGGATCATGAAGGGCAAGGAGG + Intergenic
1136088642 16:27903102-27903124 GGAGGTCTTGAAGGACAAGGGGG + Intronic
1136551935 16:30986544-30986566 TGGGCTCTTAGAGGACAAGAGGG - Intronic
1138432038 16:56975199-56975221 GGGGCTCTTGAAGCCAGAGCAGG - Intronic
1139587149 16:67911369-67911391 GTGACTCTTGAAGGAAATGCTGG - Intronic
1139956747 16:70696913-70696935 GGGGCTCTTGGAGGGGGAGCTGG - Intronic
1143098793 17:4493355-4493377 TGGGTTCCTGAAGGACAAGTGGG + Intergenic
1143149961 17:4801607-4801629 GGGGCTGTTGCAGAGCAAGCAGG + Intergenic
1145725304 17:27115469-27115491 AGGGCTCTTCAAGGAAGAGCAGG - Intergenic
1147438147 17:40430697-40430719 GGGTCTCCTCAAGGACAACCAGG - Intergenic
1150739007 17:67764650-67764672 TGGGCTTTGGAAGGACAAGTGGG + Intergenic
1152490539 17:80630076-80630098 GAGGCTCTAGAAGGAAAGGCAGG - Intronic
1154143878 18:11850030-11850052 GTGGCTTTTGAAGGACTGGCAGG + Intronic
1159949096 18:74466789-74466811 GGTGGTCTTGAAGGATGAGCAGG - Intergenic
1160254084 18:77232546-77232568 GGGGCCCTGGAAGGGCATGCAGG + Intergenic
1161060945 19:2214524-2214546 GAAGCTGTTGAAGGAGAAGCAGG + Exonic
1162461119 19:10814924-10814946 GGGACTCTTGAAAGCCAACCTGG - Intronic
1163645993 19:18489451-18489473 GGGGCTCTTGACGTCCCAGCAGG - Intronic
1164462817 19:28463484-28463506 GGGGCTCTGGAAGACCAAGGAGG + Intergenic
1164785384 19:30926421-30926443 GAGGCTCTGGCAGGACATGCTGG - Intergenic
1165006840 19:32814309-32814331 GGAGCTCTTGGGGAACAAGCAGG - Intronic
1166324013 19:42038134-42038156 GGTTCTATTGGAGGACAAGCTGG + Intronic
1166378938 19:42344493-42344515 GGGGCTGCTGAAGGCCAGGCAGG - Exonic
1166740561 19:45112467-45112489 GAGACTCTTGGAGAACAAGCAGG - Intronic
1166745653 19:45140734-45140756 GGGCCTCTTGCAGGGCAAGAGGG + Intronic
1167373903 19:49101260-49101282 AGGGCTCTTGAAGGACAGAGAGG + Intronic
1167681083 19:50921751-50921773 AGGGCTCTTGAACAACATGCAGG + Intergenic
924968573 2:101264-101286 GGGGCTGGAGAAGGCCAAGCCGG + Intergenic
927179076 2:20431248-20431270 GGGGCTCCTGAAGTGGAAGCTGG + Intergenic
927441268 2:23119677-23119699 GGGACTTGTGAAGGAGAAGCTGG - Intergenic
928830748 2:35479576-35479598 GGAGCTCTTGTAAGACAGGCCGG - Intergenic
929934695 2:46286240-46286262 GGGGGTCTGGCAGGACAGGCAGG + Intergenic
930173912 2:48281818-48281840 GTGGATCTTGAAGGACAGGAAGG - Intergenic
931439919 2:62281786-62281808 GGGGCTCTTGAAGATAAAGTGGG + Intergenic
932319809 2:70813434-70813456 GGGGCTCAGGAAGGACACCCTGG + Intronic
932766808 2:74475576-74475598 GGAACTCTGGAAGGAGAAGCTGG + Intronic
934768478 2:96893815-96893837 GGGGTTCTGGAAGGACCCGCAGG + Intronic
934976954 2:98809381-98809403 GGGGCTCTGGGAGCACAAGTGGG + Intronic
937972953 2:127564481-127564503 GGGGCTCTGGAAGGGCCAGAGGG + Intronic
941013187 2:160324630-160324652 GCTGCTCCTGAAGGACAAACAGG + Intronic
943064419 2:183071345-183071367 GGAGCTGATGAACGACAAGCTGG - Intergenic
945948182 2:216013968-216013990 GGGGCTATTTAAGGACTAGGAGG - Intronic
1169149308 20:3276749-3276771 GGGGCTCTGAAAGGAAAAGAAGG + Intronic
1171006663 20:21472760-21472782 GCAGCTTTTGAAGGAAAAGCTGG - Intergenic
1171199779 20:23231760-23231782 GGAGCTTTTGAAGGAAATGCTGG - Intergenic
1171768383 20:29302143-29302165 CGGGCACTTGAGGGATAAGCTGG + Intergenic
1172321716 20:34000130-34000152 GGGGAAGTTGTAGGACAAGCAGG - Intronic
1174493319 20:50919877-50919899 GGGGATCTTGAATGTGAAGCTGG + Intronic
1175291214 20:57876764-57876786 AGGGGTCTTAAAAGACAAGCAGG + Intergenic
1175923632 20:62461645-62461667 GGGGGTCGTGCAGGACAGGCAGG - Intergenic
1178920301 21:36734321-36734343 GGGACTCTGAAAGGGCAAGCAGG + Intronic
1180702805 22:17790911-17790933 GGTGATCTTGAAGGAGAAGAAGG + Exonic
1182767017 22:32764987-32765009 GGGGCCCTGGAAGGACAAGAGGG - Intronic
1183538211 22:38415360-38415382 GGGGCTGTGGAAGGACAGACTGG + Intergenic
1184152130 22:42645416-42645438 TGTGCTCTTGGAGGACAAGCGGG - Intronic
1185279634 22:49964532-49964554 GGGGGTTTTGAAGGACAGGGAGG + Intergenic
1185420633 22:50732443-50732465 GAGGCTCTGGAAGGACAGGCTGG - Intergenic
950176181 3:10876501-10876523 GTGGCTCTTGAATGACTACCAGG - Intronic
950377393 3:12582914-12582936 GAGGCTCTTGAAGGAGCAGGAGG + Exonic
951218271 3:20043940-20043962 GGGGCTTTTGAAAGAAAAACAGG + Intronic
952929151 3:38346480-38346502 GGGCCTCCAGAAGGACAGGCAGG + Intergenic
954068736 3:48127568-48127590 GGGACTCCAGAAAGACAAGCTGG - Intergenic
954530122 3:51311173-51311195 GCTGCTCTTGCAGGACAAGCTGG - Intronic
954652817 3:52175699-52175721 GGGGGTATTGAAAGACAAGCAGG + Intergenic
954858365 3:53666190-53666212 GGGAACCTTGAAGGACAAGCAGG + Intronic
955533287 3:59897331-59897353 TTGGGTCTTGAAGGACGAGCAGG - Intronic
955786163 3:62541236-62541258 GGAGCCCTTGAAGACCAAGCAGG - Intronic
956021022 3:64933426-64933448 GGGTCTCTAGGAGGACAGGCTGG + Intergenic
956084714 3:65597413-65597435 GGGGCTTTTGAAGGGGATGCTGG - Intronic
956501981 3:69896803-69896825 TGGAGTCTTGAAGGACAAGTAGG + Intronic
959304169 3:104639038-104639060 TATGCTCTTGAAGGACAAGTGGG + Intergenic
960440981 3:117688731-117688753 AGTGCTCTTGAAGAACAAACAGG + Intergenic
962810880 3:138958785-138958807 CGGGCCCATGAAGGACAGGCAGG + Intergenic
963713467 3:148775296-148775318 AAGGCTCTTTAAGGAGAAGCAGG - Intergenic
964634389 3:158843999-158844021 GGGGCTGTTGAAGTGCACGCAGG + Intergenic
965367000 3:167813436-167813458 GGATCTCTTGAAGGTCCAGCTGG - Intronic
966861169 3:184231462-184231484 GTGGATCTTAAAGGACAAGTAGG - Intronic
968508709 4:985320-985342 GGGGCTCTGCAGGGACAAGCCGG - Intronic
969105763 4:4806076-4806098 GGAGCCCTGGAAGAACAAGCAGG + Intergenic
969110205 4:4839705-4839727 GGGGCTCCAGAAGGACAAGGTGG - Intergenic
969344015 4:6560097-6560119 GGGGCCCTTGAAGGCTATGCAGG + Intronic
971918965 4:32911491-32911513 GGAGCTCTTGCAAGACAGGCAGG - Intergenic
973056299 4:45663743-45663765 TGGGCTATTGAAGTTCAAGCTGG - Intergenic
974052306 4:56952422-56952444 TGTGCTCTGGCAGGACAAGCGGG + Intergenic
976272979 4:83248838-83248860 AGGGCTGTTGTAGGACAGGCTGG + Intergenic
976955144 4:90887323-90887345 GGGTCTGTTGAAAGTCAAGCAGG - Intronic
978806389 4:112805234-112805256 GAGGATGTTGAAAGACAAGCAGG + Intergenic
979277123 4:118827034-118827056 CTGAATCTTGAAGGACAAGCAGG + Intronic
979900548 4:126211181-126211203 GGGGCTGTAGAAGTACAAGGAGG + Intergenic
980706210 4:136499124-136499146 TGGGCTCTTGAAGGATTGGCTGG - Intergenic
982604755 4:157500214-157500236 GGGGCTGTGGAAGGAAAAGAAGG + Intergenic
982774700 4:159429729-159429751 GGGGTGCTGGAAGGATAAGCAGG - Intergenic
986981309 5:13450701-13450723 GTGGCACTTTAAGGACATGCTGG - Intergenic
991643100 5:68774039-68774061 AGGGCCCTTGAAGGACAATATGG - Intergenic
992926209 5:81590438-81590460 AGAGCTCATCAAGGACAAGCAGG + Intronic
999824651 5:155262480-155262502 GGGGTTCTTGAAGGAGCACCAGG + Intergenic
1000409896 5:160927343-160927365 TGGCATCTAGAAGGACAAGCTGG + Intergenic
1001120107 5:168973065-168973087 TGGGCTCTTCAAGGACAAGCTGG - Intronic
1001256185 5:170185133-170185155 GGGGCTCTTGGAGCACCACCTGG + Intergenic
1001309442 5:170600413-170600435 CTGGATCTTAAAGGACAAGCTGG - Intronic
1002427596 5:179185384-179185406 GGGGCTCTGGAAGGGCATTCCGG + Intronic
1002661087 5:180791609-180791631 GGGGCCCAGGAAGGACAGGCAGG + Exonic
1003872404 6:10413139-10413161 GGGGCTCTGTAGGGACACGCAGG - Intronic
1004492581 6:16129836-16129858 GGGGTTCTTGGCAGACAAGCCGG + Intronic
1005463948 6:26093651-26093673 CTGGATCTTGAAGGAGAAGCTGG + Intronic
1007299901 6:40859657-40859679 GGAGCTATAGAAGGAAAAGCTGG - Intergenic
1007742850 6:44023283-44023305 AGGGTTCCAGAAGGACAAGCAGG + Intergenic
1008326686 6:50190570-50190592 AAGGCTATTGAAGTACAAGCAGG - Intergenic
1011891148 6:92161695-92161717 ATGGCTCTTGAAGGAGAAGATGG - Intergenic
1014350909 6:120344297-120344319 GGAGATCTCGAAGGAAAAGCAGG + Intergenic
1016547293 6:145238755-145238777 GGGGCCCTTGAAGGAGAATCTGG - Intergenic
1019155821 6:170038229-170038251 TGGTCTCTAGAAGGACATGCAGG - Intergenic
1019383674 7:741404-741426 GGAGGACCTGAAGGACAAGCTGG + Exonic
1019432806 7:1007283-1007305 GGGACTCAGGAAGGACATGCTGG - Intronic
1019801265 7:3089984-3090006 AAGGCTCTTGAAGGACAACTGGG + Intergenic
1019924854 7:4185446-4185468 GGGGCTCTGGAAATACAGGCAGG - Intronic
1020647139 7:10828564-10828586 AGGACTCTGGAAGGACAAGGTGG - Intergenic
1021562872 7:21986406-21986428 GGGGCTGCTGCAGGACAAGAAGG - Intergenic
1021914258 7:25415542-25415564 TGGGGTCTTGAAGAAGAAGCTGG + Intergenic
1023879469 7:44309957-44309979 GCGGCTCGCGAAGGACACGCGGG + Intronic
1024148910 7:46547528-46547550 GGGGCTTTGGAAGGGCAAGATGG + Intergenic
1024530074 7:50384110-50384132 GGGGCTTCTGAAGTACATGCTGG + Intronic
1025998788 7:66545188-66545210 GGGGCTCCTGAAGGCTAGGCTGG - Intergenic
1026991747 7:74590000-74590022 GGGGCTCCTGAAAGCCAGGCTGG - Intronic
1027961013 7:84945245-84945267 AGGACTCCTGAAGGACAAGGTGG - Intergenic
1029068256 7:97873812-97873834 AGAGCTCTGGACGGACAAGCAGG - Intergenic
1029478257 7:100798022-100798044 AGGGCTCTGGAAGGCCAAGGCGG - Intergenic
1030687118 7:112498223-112498245 GGGGGTCTTGCAGGAAAAGGAGG + Intergenic
1032691816 7:134294956-134294978 GGGGTTCTGGAAGTACAAGATGG + Exonic
1033121175 7:138668073-138668095 GGTGCTCTTGATGGATCAGCTGG + Intronic
1033300055 7:140177215-140177237 GGAGCTGTTGAAGGGCACGCAGG + Intergenic
1033556165 7:142490047-142490069 GGAGCTCTGGCAGGACAGGCTGG + Intergenic
1034283674 7:149870621-149870643 AGGGCCCTTGAAGGAGAAACAGG + Intergenic
1034927620 7:155135127-155135149 GCAGCTCTTGGAGGACGAGCCGG - Intergenic
1035759308 8:2057616-2057638 GGGGCAGATGGAGGACAAGCTGG + Exonic
1037201224 8:16255173-16255195 GGGGCTTTTGAAGGGAAAGAGGG - Intronic
1037711105 8:21356093-21356115 TTGGGTCTTTAAGGACAAGCAGG - Intergenic
1038979800 8:32747334-32747356 GGGGCTCTAGAAAGAAAATCTGG + Intronic
1039466447 8:37788396-37788418 GGGTCACTTGATGGAGAAGCTGG - Intronic
1040072018 8:43196151-43196173 GGTGCTGTTGAAGCACAAGAGGG - Intronic
1040356004 8:46619020-46619042 AGAGCTCTGGAGGGACAAGCAGG - Intergenic
1040880671 8:52201210-52201232 TGCGTTCTTGAAGGAAAAGCTGG - Intronic
1043200668 8:77365514-77365536 GGAGCTCTTGTAGGGCAAGCTGG - Intergenic
1044575936 8:93769092-93769114 GGGGCACCTGAGGGACAACCTGG + Intronic
1047759332 8:127942493-127942515 GGGGCTCTTCCAGGTCAAGGGGG - Intergenic
1049069719 8:140347116-140347138 GGGGCTCCTGGAGGAGAGGCTGG - Intronic
1049733826 8:144192782-144192804 GGGGGTCTTGAAGGCCCTGCTGG + Intronic
1051941132 9:22507036-22507058 GGAGCTCTTGTAGGGCAGGCAGG + Intergenic
1057423761 9:94932177-94932199 TGGGCTCTGGAAGGACATACAGG + Intronic
1057837154 9:98454667-98454689 AGGGATCTGGAAGGCCAAGCTGG + Intronic
1058004343 9:99899651-99899673 TAGGCTCTTGAATGACCAGCAGG + Intergenic
1058702798 9:107614700-107614722 AGGGCTCTTGAAGGACAGTGTGG - Intergenic
1060935425 9:127512232-127512254 GGAGAACTTGAAGGAAAAGCAGG - Intronic
1061625486 9:131838598-131838620 GGGGCTCTGGAAGGCTGAGCAGG - Intergenic
1062637838 9:137500801-137500823 GGGGCGCGTGAGGAACAAGCAGG + Exonic
1186630142 X:11339924-11339946 GGGGCTGGTGAAGGAAAAGGGGG - Intronic
1189669462 X:43392583-43392605 GGAGCACGTTAAGGACAAGCTGG - Intergenic
1194350463 X:92820158-92820180 AGGGCTCAGGAAGGACAAGAAGG + Intergenic
1195612061 X:106878696-106878718 GAGGCTCCTGAAGGAAAACCAGG - Intronic
1198745131 X:139882299-139882321 CTGGCCCTTTAAGGACAAGCAGG + Intronic
1200658779 Y:5936799-5936821 AGGGCTCAGGAAGGACAAGAAGG + Intergenic