ID: 1083321079

View in Genome Browser
Species Human (GRCh38)
Location 11:61847240-61847262
Sequence TTGATTTGTCTACTTTAAAT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1742
Summary {0: 1, 1: 7, 2: 66, 3: 356, 4: 1312}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083321079 Original CRISPR TTGATTTGTCTACTTTAAAT GGG (reversed) Intronic
900672514 1:3864266-3864288 CTGAATTGTACACTTTAAATGGG + Intronic
900760327 1:4466222-4466244 TTGACTTGTGCACTTTAAATGGG + Intergenic
900912660 1:5612637-5612659 TTGAATTGTACAATTTAAATGGG - Intergenic
901095980 1:6680244-6680266 TTGAATTGTATACTTTAAAATGG - Intronic
901160217 1:7171637-7171659 CTGAATTGTATACTTTAAAATGG - Intronic
901419367 1:9140091-9140113 CTGAATTGTATACTTTAAAATGG - Intergenic
901579898 1:10233651-10233673 TTGAATTGAATACTTTAAATCGG + Intronic
902054798 1:13591379-13591401 CTGAATTGTTTGCTTTAAATGGG - Intronic
902100619 1:13984832-13984854 TTGAATTGTATACTTTAAGTGGG - Intergenic
902179460 1:14676915-14676937 CTGAATTGTATACTTTAAAAGGG + Intronic
902352410 1:15867015-15867037 CTGAATTGTATACTTTAAATGGG - Intronic
902441639 1:16433880-16433902 TTGAATTGTACACTTTAAATGGG - Intronic
902822652 1:18952810-18952832 TTGACTTGTACACTTAAAATGGG + Intronic
902826367 1:18977160-18977182 TTGAATTGTCCACTTAAAATGGG - Intergenic
903311814 1:22464909-22464931 TTGAATTGTACACTTTAAAATGG - Intronic
903590288 1:24450484-24450506 TTGATTTATAGACTTAAAATGGG - Intronic
903590823 1:24454592-24454614 CTGAATTGTATACTTTAAACAGG - Intronic
903689918 1:25166318-25166340 CTGAATTGTCCACTTTAAATTGG + Intergenic
904134706 1:28302728-28302750 CTGAATTGTTTACTTTAAAATGG - Intergenic
904220280 1:28961993-28962015 TTGATTTCTCTAGTTGATATTGG + Intronic
904671025 1:32165694-32165716 TTCATTTTTTTTCTTTAAATAGG - Intronic
905050639 1:35047942-35047964 TTGAATTGTACCCTTTAAATGGG - Intergenic
905326716 1:37158052-37158074 TTCATTTTTCTACTTCATATCGG + Intergenic
905642293 1:39598898-39598920 CTGAGTTGTGTACTTTAAAATGG + Intergenic
905837864 1:41144127-41144149 TTGAATTGTATACCTTAAAAGGG - Intronic
905859213 1:41336599-41336621 TTGACTTATACACTTTAAATGGG + Intergenic
906091974 1:43187510-43187532 CTGAATTGTATACTTTGAATAGG - Intronic
906111778 1:43328718-43328740 CTGATTTGTACACTTTACATGGG + Intergenic
906468049 1:46102284-46102306 CTGAATTGTATACTTAAAATTGG + Intronic
907041396 1:51263848-51263870 TTGAAGTGTGTATTTTAAATAGG + Intronic
907175576 1:52518915-52518937 CTGAATTGTATACTTTAAAATGG + Intronic
907252526 1:53150484-53150506 TTCATTTGCCTATTTTTAATTGG + Intergenic
907588920 1:55647121-55647143 TTCATTTTTCTACTTTACAGAGG + Intergenic
907791086 1:57664252-57664274 TTGCTTTGTCTACATCAAGTTGG - Intronic
908026928 1:59962081-59962103 TTTAATTGTATATTTTAAATGGG + Intergenic
908178981 1:61585483-61585505 TTGATTTGTTTACTTCAACAAGG + Intergenic
908180276 1:61597071-61597093 TTGATTTTTTTTCTTTAAATGGG - Intergenic
908337215 1:63139046-63139068 CTGAATTGTATACTTAAAATGGG + Intergenic
908722784 1:67144318-67144340 CTGATTTGTCTCTTTTATATTGG + Intronic
908737337 1:67290477-67290499 TCTGTTTGTGTACTTTAAATAGG - Intergenic
908888884 1:68820047-68820069 TTGAATTGTATACTTAAAACAGG + Intergenic
909108029 1:71437380-71437402 TTGACTTGTATATTTTCAATGGG + Intronic
909461119 1:75915439-75915461 TTCATTTATCTAGATTAAATAGG + Intergenic
909515928 1:76507312-76507334 TTGAATTATACACTTTAAATGGG - Intronic
909912567 1:81278756-81278778 ATGATTTGTTTACTTTACTTTGG + Intergenic
910069714 1:83197380-83197402 CTCATTTATCTAATTTAAATTGG + Intergenic
910187888 1:84564736-84564758 GTTATTTTTCAACTTTAAATAGG + Intronic
910243752 1:85116620-85116642 TTTAATTGTATACATTAAATGGG + Intronic
910296976 1:85657622-85657644 TTGATTTATTCACTTAAAATTGG + Intronic
910356946 1:86368923-86368945 TTGCTTTGTTCACTTTAAAATGG - Intronic
910690470 1:89960345-89960367 TTGATTTGTACATTGTAAATGGG + Intergenic
910977895 1:92927155-92927177 TTGAATTCTATACTTTAAATGGG - Intronic
911337682 1:96600783-96600805 TTGAATTGTATACTTTAAAGTGG - Intergenic
911608147 1:99931939-99931961 TTCATGTATATACTTTAAATGGG + Intergenic
911695251 1:100883247-100883269 CTGAACTGTATACTTTAAATGGG - Intronic
911879773 1:103221651-103221673 TTTATTTGCCTAATTTTAATTGG + Intergenic
912462003 1:109840956-109840978 TTGAATTGTACACTTTAAATGGG + Intergenic
912547656 1:110462572-110462594 TTGAAATGTATATTTTAAATGGG + Intergenic
912750575 1:112283840-112283862 TTGTTCTGACAACTTTAAATAGG - Intergenic
912795502 1:112690717-112690739 CTGAATTGTGTAATTTAAATGGG - Intronic
913160474 1:116140649-116140671 TTTATTATTCTTCTTTAAATAGG - Intergenic
913267305 1:117057638-117057660 TTGAATTGTACACTTTAAATAGG - Intergenic
913302858 1:117390942-117390964 CTGAATTGTATACTTTAAATGGG - Intronic
913647935 1:120878908-120878930 AGCATTTGTCTACTTTTAATAGG + Intergenic
913720747 1:121591329-121591351 GTGATTTATCTCCTTTATATTGG - Intergenic
914078693 1:144383931-144383953 AGCATTTGTCTACTTTTAATAGG - Intergenic
914100486 1:144582571-144582593 AGCATTTGTCTACTTTTAATAGG + Intergenic
914173600 1:145252479-145252501 AGCATTTGTCTACTTTTAATAGG - Intergenic
914215387 1:145622500-145622522 TTGAATTGTACACTTTAAATGGG + Intronic
914298498 1:146355082-146355104 AGCATTTGTCTACTTTTAATAGG - Intergenic
914467337 1:147942885-147942907 TTGAATTGTACACTTTAAATGGG + Intronic
914528254 1:148493620-148493642 AGCATTTGTCTACTTTTAATAGG - Intergenic
914638132 1:149573447-149573469 AGCATTTGTCTACTTTTAATAGG + Intergenic
914866665 1:151435864-151435886 CTGAATTGTGTATTTTAAATGGG - Intronic
914956121 1:152164241-152164263 TTGAATCGTACACTTTAAATGGG - Intergenic
915023030 1:152798923-152798945 TTGAATTGTTTATTTTAAAAAGG - Intronic
915151035 1:153831559-153831581 TTGAATTGTACACTTTACATAGG - Intronic
915183953 1:154088028-154088050 TTGATTTGAACACTTTAAAAGGG + Intronic
915226542 1:154415988-154416010 CTGATCTGTATACTTTAAAATGG - Intronic
915250807 1:154587010-154587032 CTGAATTGTATGCTTTAAATGGG - Intronic
915657576 1:157374436-157374458 TTGAAATGTACACTTTAAATGGG + Intergenic
915671503 1:157492550-157492572 TTGAAATGTACACTTTAAATGGG - Intergenic
915899242 1:159834529-159834551 TCGAATTGTATACTTTAAATAGG - Exonic
916547725 1:165822373-165822395 TTGAATTGTACAATTTAAATTGG - Intronic
916879521 1:169006278-169006300 TTGAATTGTACACTTTAAATGGG - Intergenic
917594250 1:176512718-176512740 TTGAATTATGTACTTCAAATGGG + Intronic
917606109 1:176631501-176631523 TTGAATTGTACACTTTAAATAGG + Intronic
917818382 1:178734511-178734533 TTGACTTGTACATTTTAAATGGG + Intronic
917896868 1:179499601-179499623 TTGAATTATACACTTTAAATGGG + Intronic
917943897 1:179950178-179950200 TTCAATTGTATGCTTTAAATAGG - Intergenic
917961236 1:180146718-180146740 CTGAATTGTATACTTTAAAGGGG + Intergenic
918014204 1:180617279-180617301 TTTATTTGTCGACTTGAATTTGG - Intergenic
918255634 1:182744134-182744156 TTGGATTTTATACTTTAAATAGG - Intergenic
918389740 1:184046474-184046496 TTGCATTGTGTACTTTAAATAGG - Intergenic
918742803 1:188157043-188157065 TTGATTTACTTACTTAAAATGGG + Intergenic
918746774 1:188211321-188211343 TTAATTTGTGTACATTTAATGGG - Intergenic
918797388 1:188918955-188918977 TTGAATTGTCTAATTTGCATTGG + Intergenic
918977290 1:191506497-191506519 TGGATTTATTTACTTTAAAATGG + Intergenic
919345542 1:196371462-196371484 TTGAATTGTACACTTTAAATGGG + Intronic
919520664 1:198583362-198583384 TTGAATTGTTTACTTTAAAATGG - Intergenic
919707039 1:200687194-200687216 TTGAGTTGTGCACTTTCAATGGG + Intergenic
920335492 1:205242300-205242322 TTGACTTGTTTTCCTTAAATGGG + Intronic
920422572 1:205845143-205845165 TTGATTTCTCAGCTGTAAATGGG - Intronic
920520662 1:206622555-206622577 CTGAATTGTCCACTTTAAATGGG - Intergenic
920958209 1:210638984-210639006 CTGAATTGTGTTCTTTAAATTGG + Intronic
921140620 1:212302622-212302644 TGGAATTGTATACTTTAAATGGG - Intronic
921239468 1:213163673-213163695 TTGATTTTTTTTTTTTAAATGGG + Intronic
921370817 1:214421480-214421502 CTGAATTGTATACTTTAAAGTGG + Intronic
921476235 1:215613963-215613985 TTGCTTTGTCTATTTTATTTGGG + Intronic
921895245 1:220393007-220393029 CTAAATTGTATACTTTAAATAGG - Intergenic
922528200 1:226322598-226322620 TAGAATTGTGTATTTTAAATAGG + Intergenic
922593117 1:226793723-226793745 GTGTTATGTCTACTTTAAAGAGG + Intergenic
922655149 1:227375694-227375716 ATGACTTGTATACTTTAAATGGG - Intergenic
922816696 1:228454166-228454188 CTGAATTGTGTACTTTAAAATGG - Intergenic
922990445 1:229905214-229905236 CTGGTTTGTCTACTATAAAAAGG - Intergenic
923090598 1:230737762-230737784 TTGAATTGTACACTTTAAATAGG - Intergenic
923732940 1:236570613-236570635 CTTAATTGTATACTTTAAATGGG + Intronic
923866299 1:237943327-237943349 TTGATGTGGCTAATATAAATAGG + Intergenic
923887122 1:238170145-238170167 TTGAATTGTACAATTTAAATGGG - Intergenic
923926877 1:238639165-238639187 TTATTTTGTCTATTTTTAATTGG - Intergenic
924047907 1:240051491-240051513 TTGAATTGTACACTTTAAATGGG - Intronic
924184983 1:241478740-241478762 TTCAATTGTACACTTTAAATAGG + Intergenic
924249797 1:242120452-242120474 CTGAATTGTATACTTTAAAAGGG + Intronic
924433441 1:244017454-244017476 CTGAATTGTACACTTTAAATGGG + Intergenic
924641777 1:245839657-245839679 GTGATTTGTGTACTTTCAGTGGG + Intronic
924879808 1:248148142-248148164 CTGATTTGTGTACATTAATTTGG + Intergenic
1062868995 10:882196-882218 TTCAATTGCATACTTTAAATGGG + Intronic
1062891974 10:1069161-1069183 TTGAATTGTGCACTTTAAATAGG + Intronic
1063483364 10:6396310-6396332 TTGAATTGTATACTTTAAAAGGG - Intergenic
1063582979 10:7325862-7325884 TTGAATTGTACACTTTAAGTGGG + Intronic
1064023226 10:11825905-11825927 CTGATTTGTGCACTTTAAAGCGG - Intronic
1064181388 10:13119120-13119142 CTGAAATGTATACTTTAAATGGG - Intronic
1064264454 10:13813852-13813874 ATGATTTTTCTACTTTACACTGG - Intronic
1064385081 10:14883392-14883414 CTGAATTGTACACTTTAAATAGG - Intronic
1064488877 10:15828518-15828540 CTGAATTGTCCATTTTAAATGGG + Intronic
1064528960 10:16287362-16287384 TTGTATTTTATACTTTAAATGGG + Intergenic
1064717565 10:18192511-18192533 CTGAATTGTCCACTTTAAAATGG - Intronic
1064850099 10:19700383-19700405 TTTATTTGACAACTTTAAAGGGG + Intronic
1064947958 10:20813499-20813521 TTGAATTGAACACTTTAAATGGG + Intronic
1065053564 10:21819977-21819999 TTGAATTATACACTTTAAATAGG - Intronic
1065065712 10:21961695-21961717 CTGAATTGTATACTTAAAATGGG + Intronic
1065071480 10:22028997-22029019 TTGAATTGTACACTTTAAATGGG + Intergenic
1065086017 10:22177535-22177557 TTTAATTTTATACTTTAAATGGG + Intergenic
1065128697 10:22599187-22599209 TTGAGTTGTATACTTTAAATAGG - Intronic
1065302521 10:24335910-24335932 TTGAATTGTGCACTTGAAATGGG + Intronic
1065508713 10:26456199-26456221 TTGAATTATACACTTTAAATAGG + Intronic
1065970368 10:30801180-30801202 TTGAATTGTGTACTTTAACCAGG + Intergenic
1065983591 10:30928005-30928027 CTGATTTGTCTATTTTATTTGGG + Intronic
1066073881 10:31852181-31852203 TTGATTTTTCTACATAAAGTTGG - Intronic
1066246621 10:33589634-33589656 TTGAATTTTATACTTCAAATTGG + Intergenic
1066251103 10:33633558-33633580 TTAATTTGGCTACCTTTAATAGG + Intergenic
1066397678 10:35041943-35041965 TTGAATTGCACACTTTAAATGGG - Intronic
1066698267 10:38097823-38097845 TTGAATTCTATACTTTAAAATGG - Intronic
1066713598 10:38262890-38262912 TTGTTTTTTGTACATTAAATAGG + Intergenic
1067566099 10:47339021-47339043 TTGAATTATATACTTTAAATGGG + Intergenic
1067736857 10:48862316-48862338 TTTAATTGTTTACTTTAAATAGG - Intronic
1067775961 10:49165085-49165107 TTGATTTGTCTATTTTGCATGGG - Intronic
1067905916 10:50290890-50290912 TTGAAATTTCTAATTTAAATAGG + Intergenic
1068014467 10:51498473-51498495 TTGAATTTAGTACTTTAAATTGG + Intronic
1068181797 10:53529384-53529406 TTGAATTGTATACTTAAAATTGG + Intergenic
1068224341 10:54087188-54087210 TTGAATTGTACCCTTTAAATTGG - Intronic
1068225861 10:54106234-54106256 TTAAATTGTGTACTTTAAATTGG + Intronic
1068242381 10:54319629-54319651 TTGAATTGTTCACTTTAAAATGG + Intronic
1068437088 10:57006294-57006316 TTGACTGGTATATTTTAAATGGG + Intergenic
1068488184 10:57686429-57686451 CTGAATTGTACACTTTAAATAGG + Intergenic
1068624812 10:59231276-59231298 ATGATTTTTCTACTTATAATAGG - Intronic
1068694963 10:59957943-59957965 CTGAATTGTATACTTTAAATAGG - Exonic
1068711264 10:60136751-60136773 TCCATATGTCTAATTTAAATTGG - Intronic
1069097973 10:64283171-64283193 TTAAATTGTATACTTTAAAGGGG + Intergenic
1069173146 10:65257739-65257761 GTAATTTGCCTACTTTTAATGGG - Intergenic
1069204941 10:65669691-65669713 TTAATCTGTATACCTTAAATAGG + Intergenic
1069327699 10:67251441-67251463 TTGAATTGTATAATTTAAATAGG + Intronic
1069550076 10:69357958-69357980 TTGAATTGTATACTTTAAATGGG + Intronic
1069655220 10:70082928-70082950 TTGAATTGTATCCTTTAAAATGG + Intronic
1069668791 10:70184055-70184077 CTGAATTGTATACCTTAAATGGG - Intergenic
1069853699 10:71426758-71426780 TTGAATTGTACACTTTAAATGGG - Intronic
1069976925 10:72221278-72221300 TTGAATTGTATACTTTAAAATGG - Intronic
1070036630 10:72731480-72731502 CTGAATTGTATACTTTAAAAGGG - Intronic
1070113989 10:73511279-73511301 TTGTATTGTACACTTTAAATAGG + Intronic
1070195464 10:74152109-74152131 TTGATATGTCTATTTTAAGATGG - Intronic
1070281873 10:75055704-75055726 CTGAATTGTATACTTTAAAAGGG + Intronic
1070310156 10:75267136-75267158 TTGAATTGTATACTTTAAATGGG + Intergenic
1070666014 10:78344050-78344072 TTGAATTGTATCCTTTAAATGGG - Intergenic
1070687415 10:78498507-78498529 TTGACTTGTACACTTTAAATTGG - Intergenic
1070717054 10:78730133-78730155 TTGAATTCTACACTTTAAATGGG - Intergenic
1070826862 10:79395866-79395888 TTGATTTGTCCACTTTAAATGGG - Intronic
1071010325 10:80931820-80931842 TTGAGTTGTACAGTTTAAATGGG + Intergenic
1071031319 10:81185720-81185742 TAGATTTGTATACTTTTAAAGGG - Intergenic
1071083826 10:81844527-81844549 GTGATTTTTATAGTTTAAATTGG - Intergenic
1071584739 10:86809186-86809208 TGGAATTGTATACTTTAAAATGG - Intronic
1071595728 10:86922555-86922577 TTGATTTGTATCCTTTCACTGGG - Intronic
1071729024 10:88229540-88229562 TTGAATTATAGACTTTAAATAGG - Intergenic
1072161164 10:92767997-92768019 TTTATTTGTTTCCTTTGAATAGG - Intergenic
1072210576 10:93242957-93242979 TTAAATTGTACACTTTAAATGGG + Intergenic
1072300516 10:94056668-94056690 TTGAATTGTATACTTTAAAAGGG - Intronic
1072335904 10:94398028-94398050 TTGAATTGTACACTTTAAAATGG + Intergenic
1072442510 10:95469582-95469604 CTGCTTTGGCTAATTTAAATAGG - Intronic
1072476328 10:95764024-95764046 CTGAATTGTCGACTTTAAGTTGG - Intronic
1072564124 10:96603194-96603216 CTGAATTGTCCACTTTAAAATGG - Intronic
1072572167 10:96668149-96668171 ATGAATTGTATACTTTAAATTGG + Intronic
1072582871 10:96754989-96755011 TTGAATTATACACTTTAAATGGG + Intergenic
1072796583 10:98360481-98360503 CTGAATTGTATACTTTAAATGGG + Intergenic
1072821593 10:98563522-98563544 TTGCATTGTATCCTTTAAATGGG + Intronic
1073007779 10:100338081-100338103 TTGAATTGTCTGTTTTAAGTGGG - Intergenic
1073385188 10:103121242-103121264 TTGAATTGTATACTTGAAAATGG + Intronic
1073700081 10:105916864-105916886 CTGCATTGTATACTTTAAATGGG + Intergenic
1074177254 10:111021361-111021383 TTGATTTGGTTACTTTAAAATGG - Intergenic
1074212303 10:111347357-111347379 TTGAATTGTACACTTCAAATAGG - Intergenic
1074238679 10:111613157-111613179 TTTATTTGTACATTTTAAATAGG + Intergenic
1074354682 10:112771577-112771599 TTGAATTGTATACTTTAAATGGG - Intronic
1074372584 10:112912165-112912187 TTGAATTGTATGATTTAAATGGG + Intergenic
1074393451 10:113077365-113077387 CTGAATTATATACTTTAAATGGG - Intronic
1074416447 10:113271431-113271453 TTGAATTGTACACTTTCAATGGG + Intergenic
1074612187 10:115032793-115032815 TTTATGTGACTATTTTAAATGGG + Intergenic
1074758269 10:116644084-116644106 TTGAATTGCACACTTTAAATGGG - Intronic
1075019402 10:118939928-118939950 GTGAGTTGTAAACTTTAAATGGG + Intergenic
1075353730 10:121751294-121751316 TTGGTTTGTATAATTTAAATGGG - Intronic
1075436927 10:122451444-122451466 CTGAAATGTATACTTTAAATGGG - Intergenic
1075578050 10:123595146-123595168 TTGAATTGTACACTTAAAATTGG + Intergenic
1075769882 10:124924352-124924374 CTGAATTGTATACTTTAAAGGGG - Intergenic
1075965871 10:126611013-126611035 TTGATTTATACACTTCAAATGGG - Intronic
1076630434 10:131849004-131849026 TTGTGTTTTCTGCTTTAAATAGG - Intergenic
1077460994 11:2709508-2709530 TTGAATCGTACACTTTAAATGGG - Intronic
1077595799 11:3530306-3530328 TTGATTTGTTTACTTTAAATTGG - Intergenic
1077666195 11:4112314-4112336 TTGAGTAGTACACTTTAAATGGG + Intronic
1077944582 11:6881459-6881481 TTGAATTATAAACTTTAAATGGG - Intergenic
1078194753 11:9126287-9126309 TTGAATTGTATACTTTAAATTGG - Intronic
1078260220 11:9699270-9699292 CTGAATTGTATACTTTAAAAGGG + Intronic
1078292168 11:10023402-10023424 CTGAATTGTATACTTTAAAATGG - Intronic
1078410485 11:11112154-11112176 TTGAGTTGTACACTGTAAATGGG + Intergenic
1078606604 11:12782590-12782612 TTGAATTGTACACTTAAAATGGG + Intronic
1078637780 11:13067957-13067979 TTGAACTGTATACTTTAAGTGGG + Intergenic
1078725593 11:13927852-13927874 TTGAATTATATACTTTAAGTGGG - Intergenic
1078901225 11:15644456-15644478 TTTATATGTATACTTTAAAAAGG + Intergenic
1078964367 11:16320732-16320754 TTGAATTGTATACATTAAGTGGG + Intronic
1078998242 11:16726479-16726501 TTTAATTGTATACTTTAAACAGG + Intronic
1079279051 11:19071766-19071788 TTCATTGCTCTACTTTAAATTGG - Intergenic
1079418533 11:20263929-20263951 CTGAATTGTATACTTTAAAAGGG + Intergenic
1079438720 11:20486274-20486296 TTGAATTGTACAATTTAAATGGG + Intronic
1079459277 11:20665887-20665909 TTGAATTGTATACTTTAAATGGG - Intergenic
1079500875 11:21099924-21099946 TTGATTTGTACCCTTTAAATGGG - Intronic
1079634075 11:22713292-22713314 TTTATTTGTCTTCATTATATAGG - Intronic
1079933084 11:26589465-26589487 TTGAATTGGACACTTTAAATGGG - Intronic
1079947016 11:26756574-26756596 TTTATTTGTCAACTTAAAAAAGG - Intergenic
1080603727 11:33846148-33846170 TTGAATTGACTGCTTAAAATGGG - Intergenic
1080856780 11:36118714-36118736 TTGAATTGTGTGCTTTAAATGGG - Intronic
1081088291 11:38828386-38828408 TTGTTGTGGCTACTGTAAATGGG - Intergenic
1081256409 11:40901796-40901818 TTGATTTTTCTCTTTTAAAGGGG + Intronic
1081502949 11:43684728-43684750 TTGAATTGTACACTTTAAATGGG - Intronic
1081624556 11:44642280-44642302 TTGAATTGTACACTTTAAATTGG - Intergenic
1081881021 11:46452068-46452090 TTGAAATGTATACTTTAAATAGG + Intronic
1081954856 11:47082581-47082603 CTGAATTGTACACTTTAAATAGG - Intronic
1082057667 11:47833106-47833128 TTGAATGGTATACTTTAAATGGG + Intronic
1082309627 11:50631061-50631083 TTGATTTGCCTATTTTTGATTGG + Intergenic
1082613941 11:55335768-55335790 TTGATTTGTGTATGTTGAATGGG + Intergenic
1082780035 11:57280150-57280172 TTGGATTGTACACTTTAAATGGG + Intergenic
1082860887 11:57855226-57855248 CTGAATTATATACTTTAAATGGG + Intergenic
1083321079 11:61847240-61847262 TTGATTTGTCTACTTTAAATGGG - Intronic
1083526319 11:63369076-63369098 TTCAATTGTATACTTTAAAAGGG + Intronic
1083984035 11:66198716-66198738 TTGAATTGTACACTTTAAATGGG + Intronic
1084136305 11:67184986-67185008 TTGATTTTTTTCCTTTGAATGGG - Intronic
1084152126 11:67292680-67292702 TTGAACTGTATGCTTTAAATGGG - Intronic
1084251693 11:67904285-67904307 TTGATTTGTTTACTTTAAATGGG - Intergenic
1084803574 11:71563851-71563873 TTGAATTGTATACCTTAAATGGG + Intronic
1084821146 11:71691742-71691764 TAGATTTGTTTACTTTAAATGGG + Intergenic
1084906339 11:72350867-72350889 CTAAATTGTGTACTTTAAATGGG - Intronic
1084985975 11:72872076-72872098 TTGTATTGTATACTTTAAAATGG - Intronic
1084997406 11:72994873-72994895 CTGAATTGTATACTTTAAAAAGG - Intronic
1085010131 11:73134003-73134025 TTGAATGGTACACTTTAAATGGG + Intronic
1085017471 11:73184745-73184767 TTGAATTGTATACTTTAAATGGG + Intergenic
1085161412 11:74350488-74350510 TTGAATTGCACACTTTAAATGGG - Intronic
1085166428 11:74404519-74404541 TTGAATTGTATACTTTAAATGGG - Intergenic
1085231036 11:74970887-74970909 TTGAACTGTACACTTTAAATGGG - Intronic
1085304844 11:75479553-75479575 CTGAATTGTATACTTTAAAAGGG - Intronic
1085344068 11:75755222-75755244 TTGAATTGTGTACTTTAAATTGG + Intergenic
1085376801 11:76070986-76071008 TTGAGTTGTACACTTTAAATGGG + Intronic
1085491502 11:76923208-76923230 TTAATTTGTACACTTTAAATAGG - Intronic
1085599532 11:77842763-77842785 TTGAATTGCATACTTTAAAAGGG - Intronic
1085919797 11:80939115-80939137 TTGAATTGAATACTTTAAAAAGG + Intergenic
1085939492 11:81191948-81191970 TTTTTTTTTCTAATTTAAATGGG - Intergenic
1086182206 11:83966289-83966311 TTGATTTTTTCACTTTAAAATGG + Intronic
1086259944 11:84927327-84927349 TTGTTTTGTTTTCTTTAGATAGG + Intronic
1086274111 11:85104675-85104697 TTGAATTGTATACTTTAAATGGG + Intronic
1086428294 11:86709014-86709036 TTCACTTGTACACTTTAAATAGG + Intergenic
1086523107 11:87694267-87694289 TTGGTGTGTCTATTTTAAATGGG + Intergenic
1086844761 11:91734747-91734769 CTGATTTGTGTACATTAATTTGG - Intergenic
1086873305 11:92065230-92065252 TTGATTTGTCATCTTTAGTTTGG + Intergenic
1087880309 11:103408048-103408070 TTGATGTGGCTAGTATAAATAGG + Intronic
1088017227 11:105075399-105075421 TTCATTTGCCAGCTTTAAATTGG - Intronic
1088159289 11:106849911-106849933 CTGAATTGTATACTTTGAATGGG - Intronic
1088711175 11:112510020-112510042 TTGAATTGTACACTTTAAACAGG - Intergenic
1088855483 11:113747376-113747398 TGGTTTTGTCTCCTTTAAAGTGG - Intronic
1088874797 11:113925898-113925920 CTGAATTGTATACTTTAAATTGG - Intronic
1089230915 11:116975233-116975255 TTGAATTTTACACTTTAAATTGG - Intronic
1089369178 11:117941973-117941995 TCTAATTGTATACTTTAAATGGG - Intergenic
1089575448 11:119439242-119439264 CTGAATTGTACACTTTAAATAGG - Intergenic
1090217043 11:124977746-124977768 ATGAATTGTACACTTTAAATGGG - Intronic
1090469082 11:126963400-126963422 TTGATTTATCTTCTTTTAATGGG - Intronic
1090571806 11:128055466-128055488 TTGACTTGTACATTTTAAATGGG - Intergenic
1090786906 11:130057471-130057493 TTGAATTGTACACCTTAAATGGG + Intergenic
1090791706 11:130095730-130095752 TTAATTTGTCAACTTTTAGTAGG + Intronic
1091210684 11:133855488-133855510 TTGAATTGTATATTTTAAATGGG - Intergenic
1091578269 12:1760357-1760379 TTAAATTGTACACTTTAAATGGG - Intronic
1091592757 12:1854885-1854907 CTGAATTGCATACTTTAAATTGG - Intronic
1092082632 12:5730201-5730223 TTGAATTGTGCACTTTAAATGGG + Intronic
1092421965 12:8339077-8339099 TTGATTTGTTTACTTTAAATTGG - Intergenic
1093374068 12:18402475-18402497 TTGAATTGTGCACTTTAAATGGG + Intronic
1093806323 12:23437406-23437428 TTGAATGGTCTACTCTAAATTGG - Intergenic
1093879592 12:24388637-24388659 TTGAATTGTATGCTTTGAATGGG - Intergenic
1094006493 12:25757982-25758004 TATATTTGGCTACTTAAAATTGG - Intergenic
1094128922 12:27053859-27053881 TTGAATTGTATACTGTAAATGGG + Intronic
1094140487 12:27175832-27175854 TTAAATTGTATACTTTAAGTGGG - Intergenic
1094286614 12:28801206-28801228 TTGAATTGTAAAATTTAAATGGG + Intergenic
1094294251 12:28886300-28886322 TTGAATTGTATTATTTAAATGGG - Intergenic
1094466767 12:30761964-30761986 TTAAATTGTATACTTTAAATGGG + Intergenic
1094557797 12:31519822-31519844 CTGAATTGTATACTTTAAAAGGG - Intronic
1094691172 12:32770985-32771007 GTGATTTTTTTACTTTTAATAGG + Intergenic
1095050734 12:37552085-37552107 TTGAATTTTACACTTTAAATGGG + Intergenic
1095135556 12:38597751-38597773 TTGAATTGTCTTTATTAAATAGG + Intergenic
1095323965 12:40864380-40864402 GTGAATTGTACACTTTAAATGGG - Intronic
1095650137 12:44598046-44598068 TTGATTGTTCTTCTTTAACTTGG + Intronic
1096132554 12:49171583-49171605 TTGAATTGTATACTTTAAATGGG + Intergenic
1097210321 12:57363299-57363321 TAGAATTGTGCACTTTAAATGGG - Intronic
1097391770 12:59023995-59024017 TTAATTTGTGTCCTTTAAAAGGG + Intergenic
1097422688 12:59399933-59399955 TTTATTTGTTTATTATAAATTGG + Intergenic
1097914806 12:65009657-65009679 TGGATTTCTCTTCTTTAAATTGG + Intergenic
1097988338 12:65807794-65807816 GTGAATTGTATACTGTAAATGGG - Intergenic
1098039038 12:66335577-66335599 TTGGTTTGTTTACTTTGGATGGG + Intronic
1098453713 12:70649279-70649301 GTGATTTGGATACTTGAAATGGG - Intronic
1099221478 12:79919916-79919938 TTTATTTGTACACTTTAAATGGG - Intronic
1099541043 12:83908022-83908044 TTGAATTGTATGCTTTAAGTGGG - Intergenic
1099606588 12:84809698-84809720 TTGATTTTTTTATTTTAAAGAGG - Intergenic
1099901632 12:88717856-88717878 TTGAATTATATACTTTAAATGGG + Intergenic
1100335768 12:93627666-93627688 TTGAATTGTATACTTTAAATGGG - Intergenic
1100350504 12:93776994-93777016 CTGAATTGCATACTTTAAATGGG + Intronic
1100485945 12:95027434-95027456 CTGAATTGTATACTTTAAATTGG - Intronic
1100602055 12:96120587-96120609 TTGAATTGCATACTTTACATGGG + Intergenic
1100625773 12:96330395-96330417 CTGAATTGTATACTTTAAAATGG - Intronic
1100709971 12:97245286-97245308 GTGTTTTGTCTCCTTCAAATTGG - Intergenic
1101000727 12:100355142-100355164 CTGAATTGTCCACTTGAAATGGG + Intergenic
1101046720 12:100814255-100814277 TTGAATTCTATACTTGAAATGGG - Intronic
1101591776 12:106131224-106131246 CTGAATTGTGCACTTTAAATGGG - Intronic
1101701928 12:107182100-107182122 TTGAATTGTACACATTAAATGGG - Intergenic
1101705747 12:107219334-107219356 TCGATTTGTATATTTTAATTAGG - Intergenic
1101721497 12:107354259-107354281 TTGATTTGTATACCTTAAATAGG - Intronic
1101795938 12:107973821-107973843 TTGAAATGTACACTTTAAATAGG - Intergenic
1102083945 12:110120772-110120794 CTGAATTGTACACTTTAAATGGG + Intergenic
1102291540 12:111704522-111704544 TTGAATTGTACTCTTTAAATAGG + Intronic
1102351501 12:112195716-112195738 CTGACTTGTGTACTTTAAATGGG + Intronic
1102424093 12:112827099-112827121 CGGAATTGTCCACTTTAAATGGG - Intronic
1102494482 12:113309975-113309997 TTAAATTGTATACTTTAAATGGG + Intronic
1102549522 12:113681538-113681560 TTGAGTTGTACACTTGAAATGGG + Intergenic
1102592492 12:113967305-113967327 TTGAATTGTGCACTTTAAGTGGG - Intergenic
1102909912 12:116705417-116705439 TTGACTTGTATACTTCAAATGGG + Intergenic
1102936536 12:116902087-116902109 TTGAATTGTATGCTTTCAATGGG + Intergenic
1103110276 12:118271183-118271205 TTGAATTGTACACTTTAAATGGG - Intronic
1103142549 12:118562139-118562161 CTGAATTGTATACTTTAAAAGGG - Intergenic
1103235342 12:119367985-119368007 TTGAACTGTACACTTTAAATGGG + Intronic
1103665093 12:122557858-122557880 CTGAACTGTATACTTTAAATAGG - Intronic
1103720132 12:122969391-122969413 TTGAATTGTAAACTTTAATTTGG + Intronic
1103741273 12:123093388-123093410 TTGAATTGTACACTTTCAATGGG + Intronic
1103842569 12:123876997-123877019 CTGAATTGTATACTTTAAAATGG - Intronic
1103877811 12:124142262-124142284 TTGAATTGTCCACTTTAAAATGG - Intronic
1104260038 12:127173787-127173809 TTAATTTGTATACTTTAAATAGG + Intergenic
1104415059 12:128591138-128591160 TTGAATTGTACATTTTAAATGGG - Intronic
1104435329 12:128751546-128751568 TTGAATTGTATACTTTAAATGGG + Intergenic
1104677047 12:130718258-130718280 CTGAATTGTTTACTTTAAAATGG + Intergenic
1104742772 12:131190512-131190534 TTGAATTGTTCACTTTAAAGTGG + Intergenic
1104994961 12:132648564-132648586 TTGAATTCTGCACTTTAAATGGG + Intronic
1105356776 13:19665904-19665926 TTGGGTTGTCTCCTTTAAAGCGG + Intronic
1105452776 13:20515296-20515318 CTGAATTGTACACTTTAAATGGG + Intronic
1105596712 13:21845821-21845843 TTGAATTGTACATTTTAAATGGG - Intergenic
1105801688 13:23909365-23909387 CTTAGTTGTATACTTTAAATGGG - Intergenic
1105885840 13:24640198-24640220 TAGATTTGTCTACTGTTAACAGG - Intergenic
1106691173 13:32118635-32118657 TTGAATTATATACTTTAAAAGGG - Intronic
1106707649 13:32299050-32299072 ATGAATTGTGTACTTTAAAATGG + Exonic
1107020391 13:35745195-35745217 TTGAATTGTGGACTTTAAAAGGG - Intergenic
1107099779 13:36577618-36577640 TTGATTTGTTTTCTGTAAATGGG + Intergenic
1107121454 13:36800824-36800846 TTGAATTGTACACTTAAAATGGG + Intergenic
1107267294 13:38571269-38571291 TTATTTTTTCTATTTTAAATGGG - Intergenic
1107292562 13:38872401-38872423 TTGAACTGTTTACTTTAAATAGG + Intronic
1107536958 13:41344771-41344793 TTGAACTGTATACTTTTAATAGG - Intronic
1107581960 13:41799806-41799828 TTGAATTGTATACTTTAAATAGG - Intronic
1107829484 13:44361761-44361783 CTGAATTGTATACTTTAAAATGG + Intergenic
1107917946 13:45171655-45171677 TTCACTTGTACACTTTAAATGGG - Intronic
1108234370 13:48387679-48387701 TTGAATTGTACACATTAAATGGG + Intronic
1108373140 13:49791073-49791095 TTTATTTGACTCATTTAAATGGG + Intronic
1108381419 13:49858248-49858270 TTCATTTGACTACATTAAAGAGG + Intergenic
1108381980 13:49863237-49863259 CTGAATTGTCCACTTTAAAATGG - Intergenic
1108533734 13:51350668-51350690 CTGAATTGTGTACTTTAAAATGG - Intronic
1108707950 13:53006983-53007005 TTAATTGGTTTACTTCAAATGGG + Intergenic
1108889165 13:55231326-55231348 TTGATTTCTAGACTTTAAATTGG - Intergenic
1109009737 13:56925356-56925378 TTGCTTTTTCTTTTTTAAATTGG - Intergenic
1109335034 13:60982765-60982787 TTTAATAGTATACTTTAAATGGG + Intergenic
1109382423 13:61581430-61581452 ATGATTTGTCTATTATCAATAGG + Intergenic
1110011535 13:70340667-70340689 TTGAATTGTATACTTTAAACAGG - Intergenic
1110183688 13:72647263-72647285 TGGTTTTGTCTATTTTAAAACGG + Intergenic
1110192834 13:72751063-72751085 TTGTTTCCTCTTCTTTAAATGGG + Intronic
1110207232 13:72929599-72929621 TTGAATTGTACACTTTAAATTGG + Intronic
1110334872 13:74316015-74316037 CTGACTTGTATACTTTAAATGGG + Intergenic
1110811262 13:79812886-79812908 TTGAATTGTGCACTTTAAATGGG - Intergenic
1110997796 13:82135771-82135793 TTAAATTGTACACTTTAAATAGG + Intergenic
1111441558 13:88287475-88287497 CTGTTTTGTCTATTTTACATTGG + Intergenic
1111481877 13:88839970-88839992 TTGATTTGTGTACTTCTATTTGG - Intergenic
1111786340 13:92791774-92791796 TTGAATTATACACTTTAAATGGG - Intronic
1112161147 13:96869177-96869199 CTGAATCGTTTACTTTAAATTGG - Intergenic
1112335370 13:98510856-98510878 TTGAATTGTATATTTTAAGTGGG + Intronic
1112469575 13:99675383-99675405 TTGAACTGTATACTTTAAATAGG - Intronic
1112557123 13:100478811-100478833 TTGCTTTTTCTACTATAAAAAGG + Intronic
1112566682 13:100557878-100557900 TTGTTTTGCCTACTTTTAATTGG - Intronic
1112616187 13:101008071-101008093 TTAATTTGTTTTCTTAAAATTGG + Intergenic
1112732636 13:102383064-102383086 TTGAATTGTATACTTTAAAAGGG + Intronic
1112741188 13:102474151-102474173 ATGAATTGTACACTTTAAATTGG + Intergenic
1112905602 13:104416387-104416409 TTGTTCTGTCTAGGTTAAATCGG - Intergenic
1113171297 13:107506432-107506454 TTGAATTGTACACTTTAAACAGG - Intronic
1113866611 13:113530326-113530348 TTGAATTGTATACTTTAAATGGG + Intronic
1113897023 13:113771033-113771055 TTGAATTGTGTGCTTTAAATGGG - Intronic
1114152118 14:20053884-20053906 TTGAAATGTCTACTTAAAATGGG - Intergenic
1114380285 14:22196399-22196421 TTGAGTTGTACACTTTAAATGGG + Intergenic
1114428720 14:22642236-22642258 TTGAATTGTATATTTTAAATGGG - Intergenic
1114752361 14:25219250-25219272 CTGAATTGTATACTTTAAAAAGG - Intergenic
1114812751 14:25919354-25919376 TTGATTTGTCTGATTTTCATAGG + Intergenic
1115037544 14:28877297-28877319 TTCATTTTTCTACTCTAAAATGG - Intergenic
1115128931 14:30029931-30029953 TTGAAGTGTACACTTTAAATGGG - Intronic
1115150420 14:30278082-30278104 TTGAATTGTACACCTTAAATGGG - Intergenic
1115176279 14:30564643-30564665 CTGAAATGTCTACTTTAAAATGG - Intronic
1115750136 14:36481198-36481220 TTGACTTGTATACTTTCAAATGG - Intronic
1115938291 14:38579779-38579801 TTGAACTGTATACTTTAAATGGG + Intergenic
1116202188 14:41811889-41811911 TTGAATTATATACTTTAAAAGGG + Intronic
1116296823 14:43121102-43121124 TTCATTTGTACTCTTTAAATGGG + Intergenic
1116454937 14:45108934-45108956 TTGAACTGTATACTTTAAATGGG - Intronic
1116468256 14:45257354-45257376 TTGAATTGTACACTTTAAAATGG - Intergenic
1116551611 14:46246873-46246895 TTGAATTGTATACTTTAAAAGGG + Intergenic
1116839653 14:49806905-49806927 CTGAATTGTATACTTTAAAGGGG - Intronic
1116894402 14:50301781-50301803 TTGATCTGTGCACTTTAAAAGGG + Intronic
1116977208 14:51129668-51129690 TTGAATTGTACATTTTAAATAGG - Intergenic
1117171491 14:53104241-53104263 TGGATTTTACAACTTTAAATGGG - Intronic
1117262899 14:54055139-54055161 TTGAAATGTATACTTTAAAAAGG + Intergenic
1117356938 14:54933633-54933655 ATGAATTGTATACTTTAAATGGG - Intergenic
1117473167 14:56067208-56067230 TTGAATTATATATTTTAAATGGG + Intergenic
1117573273 14:57071183-57071205 TTTATTTGTTTGCTTTAGATAGG - Intergenic
1117950177 14:61074947-61074969 GTGAATTGTATACTTTAAAGAGG + Intronic
1118317515 14:64734480-64734502 TTGAATTGTACACTCTAAATAGG + Intronic
1118371324 14:65139470-65139492 CTGAATTGTCCACTTTAAAATGG - Intergenic
1118512621 14:66492230-66492252 TTGTTTTGTTTATTTTATATTGG + Intergenic
1118547692 14:66911386-66911408 TTGAATTGTATCCTTTAAATGGG + Intronic
1118624716 14:67647654-67647676 TAAATTAGTCTAATTTAAATTGG - Exonic
1118688678 14:68316862-68316884 TTGAATTGTATACTTACAATGGG - Intronic
1118701363 14:68436768-68436790 TTGTTGTGACTACTGTAAATGGG + Intronic
1119040097 14:71266423-71266445 TTTAATTGTATACTTTAAATGGG + Intergenic
1119299942 14:73563650-73563672 TTGATTTGTACACTTAAAAATGG + Intergenic
1120143046 14:80949837-80949859 TTGATTTTTCTCCTGAAAATGGG - Intronic
1120254381 14:82099801-82099823 TTGATTTGTTTATTTTAATTGGG + Intergenic
1120735784 14:88050845-88050867 TTGAATTGTACTCTTTAAATGGG - Intergenic
1120785053 14:88526237-88526259 ATGAGTTGTTTACTTTAAAGTGG + Intronic
1121139308 14:91526960-91526982 TTGATTTGTCAAGTATAGATCGG - Intergenic
1121503078 14:94454329-94454351 TTGCTTTGTCTACGATAACTGGG + Intergenic
1121565065 14:94903237-94903259 ATGAATTTTATACTTTAAATGGG + Intergenic
1121642179 14:95492867-95492889 CTGAATTGTACACTTTAAATGGG + Intergenic
1121763171 14:96462733-96462755 TTGATGTCTCTACTGTACATGGG + Intronic
1122095420 14:99367020-99367042 TTGATTTGTATGCTTTAAATTGG - Intergenic
1122109391 14:99486023-99486045 CTGATTTGTACAGTTTAAATGGG - Intronic
1122147602 14:99701681-99701703 TTGAATCGTACACTTTAAATGGG - Intronic
1122305329 14:100762445-100762467 TTGACTTGCATACTTAAAATGGG + Intergenic
1122430779 14:101640463-101640485 CTGACTTGTACACTTTAAATGGG + Intergenic
1122460997 14:101895252-101895274 TTGAATTGTACTCTTTAAATGGG - Intronic
1122817869 14:104322559-104322581 TTGAATTGTTCACTTTAAATGGG - Intergenic
1123772479 15:23542272-23542294 TCGAATTGTACACTTTAAATGGG - Intergenic
1124010548 15:25835364-25835386 CTGAATTGTATACTTTAACTGGG + Intronic
1124248533 15:28092634-28092656 TGAATTTGTACACTTTAAATGGG + Intronic
1124433411 15:29627210-29627232 CTGAATTGTATACTTTAAAATGG - Intergenic
1124873598 15:33568280-33568302 TTGAATTGTGCTCTTTAAATAGG + Intronic
1124895311 15:33771068-33771090 TTAAGCTGTCTACTTTAAAACGG + Intronic
1125196358 15:37051576-37051598 TTAAATTGTACACTTTAAATGGG + Intronic
1125199123 15:37084127-37084149 TTTAAGTGTATACTTTAAATGGG + Intronic
1125450802 15:39805053-39805075 TTGACTTGTATACTTCCAATAGG + Intronic
1125477773 15:40059035-40059057 TTGAATTGTATACTTTCAGTGGG + Intergenic
1125788766 15:42346475-42346497 TTTAATTGTATACTTTAAATTGG + Intronic
1125987484 15:44068715-44068737 CTGATTTGTATACTTTAAACAGG + Intronic
1125994028 15:44139080-44139102 ATGACTTGTACACTTTAAATGGG + Intronic
1126007232 15:44269603-44269625 TTGAATTATACACTTTAAATGGG + Intergenic
1126463117 15:48935038-48935060 TTGAATTGTATACTTTAAATGGG + Intronic
1126535532 15:49758503-49758525 CTGAATTGTACACTTTAAATGGG + Intergenic
1126611947 15:50538609-50538631 TTGAATTGTATACTCTAAATGGG + Intronic
1126775430 15:52096337-52096359 TTGAGTTGTATAATTTAAAATGG + Intergenic
1126994841 15:54429195-54429217 TTGAACTGTAGACTTTAAATGGG + Intronic
1127093549 15:55490376-55490398 TTAAATTGTACACTTTAAATGGG + Intronic
1127178989 15:56395005-56395027 TTGAATTGCATACTTTAAAAGGG - Intronic
1127209870 15:56762560-56762582 TGGAATTATATACTTTAAATGGG - Intronic
1127229411 15:56972034-56972056 TTGAATTGTGTATTTTAAATAGG + Intronic
1127242172 15:57128568-57128590 TTGAATTGTATACTTTAAAAGGG - Intronic
1127291662 15:57576612-57576634 TTGGTTTGTACACTTTAAATGGG - Intergenic
1127302645 15:57671580-57671602 TTTGTTTATCTACTTTCAATTGG + Intronic
1127312927 15:57768375-57768397 ATAAATTGTATACTTTAAATGGG - Intronic
1127648097 15:60977492-60977514 TTGAATTGTATACCTTAAAATGG - Intronic
1127672455 15:61208511-61208533 TTGAATTGTATACTTAAGATGGG + Intronic
1127673352 15:61216763-61216785 GTGATTTGTCCTCTTTTAATTGG + Intronic
1128139501 15:65288535-65288557 TTAAATTGTACACTTTAAATGGG - Intronic
1128178969 15:65583640-65583662 CTGAATTGTGTACTTTAAAATGG + Intronic
1128508420 15:68297264-68297286 TTCATTTGTCTTTTTTAAGTGGG + Intronic
1129261268 15:74368918-74368940 TTGAATTGCATACTTTAAATGGG + Intergenic
1129428894 15:75483662-75483684 TTGACTTATATACTTTAAATAGG + Intronic
1129519026 15:76174248-76174270 CTGAATTGTGGACTTTAAATGGG - Intronic
1129536817 15:76319955-76319977 TTGATTTATATAAATTAAATGGG - Intergenic
1129536930 15:76321051-76321073 TTGAATTATACACTTTAAATGGG + Intergenic
1129639861 15:77364277-77364299 TTGAATTTTACACTTTAAATGGG + Intronic
1129748721 15:78044235-78044257 TTGAATTGTACATTTTAAATGGG + Intronic
1129792687 15:78352114-78352136 TGGAATTGTATACTTTCAATGGG + Intergenic
1130047252 15:80455113-80455135 TTGGATTCTCTACTTTACATAGG - Intronic
1130369272 15:83270202-83270224 TTGAATTGTACACCTTAAATGGG - Intronic
1130446423 15:84006218-84006240 TTGATTTGCCTTTTATAAATTGG + Intronic
1130533712 15:84767797-84767819 TTGAATTGTGCACTTTAAATGGG - Intronic
1130568019 15:85014798-85014820 ATGAATTGTCTACTTTATAAGGG - Intronic
1130612057 15:85370247-85370269 TTGAATTGTACACTTAAAATTGG + Intergenic
1130624159 15:85496211-85496233 CTGATTTCCCTTCTTTAAATGGG - Intronic
1130627986 15:85535676-85535698 TTGTTTTGTCTTGTTTAAAGAGG + Intronic
1130636945 15:85631393-85631415 TTGAATTATATACGTTAAATGGG + Intronic
1131569100 15:93515272-93515294 TTGAATTGTACACTTTCAATAGG + Intergenic
1132056394 15:98652874-98652896 TTGGATTATGTACTTTAAATCGG + Intronic
1132139791 15:99382993-99383015 CTGAGTTGTATACTTTAAATGGG - Intronic
1132140753 15:99391750-99391772 TTAAATTGGCTATTTTAAATAGG + Intergenic
1133010844 16:2910817-2910839 TTTAATTGTACACTTTAAATGGG + Intergenic
1133086767 16:3370578-3370600 TTGATGTGGCTAGTATAAATAGG + Intronic
1133120220 16:3601917-3601939 GTGATTTGTTCAGTTTAAATGGG + Intronic
1133174281 16:4002110-4002132 TGGAGTTATATACTTTAAATGGG - Intronic
1133194743 16:4161014-4161036 TTGAATTGTACACTTTAAATGGG - Intergenic
1133255988 16:4516367-4516389 CTGAATTGTACACTTTAAATGGG + Intronic
1133376330 16:5290501-5290523 TTGATTTGTTCATTTTAAATGGG + Intergenic
1133426474 16:5694702-5694724 GTGAGTGGTCTACTTTAAATCGG - Intergenic
1133464681 16:6018746-6018768 GGGATTTGTCTACTTTGATTGGG + Intergenic
1133647260 16:7775981-7776003 TTGAAATGTACACTTTAAATAGG + Intergenic
1133831879 16:9330799-9330821 TTGATTTGCTCACTTTAAAATGG + Intergenic
1134088381 16:11374373-11374395 CTGAATTGTGTACTTTAAAATGG - Intronic
1134113167 16:11528714-11528736 TTGAGTTTTGTGCTTTAAATGGG - Intergenic
1134114583 16:11538539-11538561 CTGAATTGTACACTTTAAATGGG + Intergenic
1134314901 16:13109561-13109583 TTGAATTGTATACTTAAAATGGG - Intronic
1134411617 16:14007085-14007107 TTGACTTGTACATTTTAAATTGG - Intergenic
1134542650 16:15080364-15080386 TTAAATTGTATACTTTAAGTTGG - Intronic
1134562464 16:15222406-15222428 TTAAATTGTGTACTTTAAATGGG + Intergenic
1134624867 16:15716318-15716340 TTGAATTATACACTTTAAATGGG + Intronic
1134852965 16:17496825-17496847 TTGAATTACTTACTTTAAATTGG + Intergenic
1134923006 16:18134033-18134055 TTAAATTGTGTACTTTAAATGGG + Intergenic
1135174861 16:20218908-20218930 TTGAGTTGTACACTTTAAAATGG - Intergenic
1135184809 16:20306469-20306491 TTGATTTGCCTACTCTACACTGG + Intergenic
1135357245 16:21779736-21779758 TTGAATTGTAAACTTTAAATGGG + Intergenic
1135360235 16:21806497-21806519 TTAAATTGTATACTTTAAGTTGG - Intergenic
1135455749 16:22595852-22595874 TTGAATTGTAAACTTTAAATGGG + Intergenic
1135506706 16:23044088-23044110 TTGCAGTGTATACTTTAAATGGG - Intergenic
1135779132 16:25283804-25283826 TTGGTGTGGCTACTGTAAATGGG - Intergenic
1136001117 16:27293749-27293771 TTGAATTGTACACTTTACATGGG - Intergenic
1136153881 16:28369494-28369516 TTGAATTGTATGCCTTAAATGGG + Intergenic
1136209210 16:28745770-28745792 TTGAATTGTATGCCTTAAATGGG - Intergenic
1136262578 16:29090450-29090472 TTAAATTGTATACTTTAAGTTGG + Intergenic
1136494736 16:30635500-30635522 TTGAATTGTACACTTCAAATAGG + Intergenic
1136524063 16:30816505-30816527 TTGAATTGTGCACTTTAGATGGG + Intergenic
1136531566 16:30873480-30873502 TTGAACTGTACACTTTAAATGGG + Intronic
1136604748 16:31325762-31325784 TTGAAATGTATGCTTTAAATAGG - Intronic
1137062837 16:35807747-35807769 TTGGATTATATACTTTAAATGGG + Intergenic
1137309669 16:47242081-47242103 TTAAATTGTATACTTCAAATGGG + Intronic
1137311690 16:47267149-47267171 TTGAACTGTATACTTTAAGTGGG + Intronic
1137341161 16:47607191-47607213 CTGAATTGTAAACTTTAAATAGG - Intronic
1137351953 16:47721002-47721024 TTGAATTGTATACTTTCAGTGGG + Intergenic
1138044324 16:53704984-53705006 TTGATTTGTCTACGTATATTGGG + Intronic
1138139094 16:54551487-54551509 CTGAATTGTACACTTTAAATAGG - Intergenic
1138191574 16:55017863-55017885 TTAAATTGTATACTTTAAATGGG + Intergenic
1138301490 16:55933589-55933611 CTGAATTGTATACTTTAAGTGGG + Intronic
1138338861 16:56274876-56274898 TTGAATTGTATACTTTAAGTAGG + Intronic
1138369393 16:56513806-56513828 CTGAATTGTATACTTTAAGTAGG + Intronic
1138725172 16:59129231-59129253 TTGAGTTGCATACTTTAAAATGG - Intergenic
1139394241 16:66627475-66627497 TTGAATTATATACTTTAATTGGG - Intronic
1139688944 16:68626949-68626971 CTGAGTTGTACACTTTAAATTGG - Intergenic
1139740138 16:69028326-69028348 CTGAATTGTGCACTTTAAATGGG - Intronic
1139793208 16:69458173-69458195 TTGATTTGTACATTTTAAATAGG - Intronic
1140140713 16:72254647-72254669 TTGAATTGTACACTTTAAATGGG - Intergenic
1140317601 16:73914080-73914102 CTGAATTGTGCACTTTAAATGGG + Intergenic
1140334180 16:74088523-74088545 TTATTTTGTCTTTTTTAAATAGG + Intergenic
1140571711 16:76114763-76114785 TTGAATTGTACACTTTAAAATGG - Intergenic
1140855959 16:78977920-78977942 TTGAACTGTCTACTTTGAAATGG - Intronic
1140934853 16:79660973-79660995 TTGAATTGTACATTTTAAATGGG + Intergenic
1141131760 16:81442370-81442392 TTGATTTGTAAACATTAAGTAGG - Intergenic
1141215265 16:82017832-82017854 CTGATTTGTACACTTTAAATTGG + Intergenic
1141240026 16:82257340-82257362 TTGAATTGTGCAATTTAAATGGG - Intergenic
1141358016 16:83366996-83367018 TTGAATTATATACTTTAAATGGG - Intronic
1141380837 16:83575270-83575292 TTGAATTGTACACTTTAAATAGG + Intronic
1141398645 16:83727051-83727073 TTGAATTGTATATTTTAAATGGG - Intronic
1141607364 16:85162125-85162147 TTGAATTGTACACTTTAAATGGG + Intergenic
1141767628 16:86069188-86069210 CTGTTTTGTACACTTTAAATGGG + Intergenic
1141861148 16:86717320-86717342 CTGAATTGTCCACTTTAAATGGG + Intergenic
1141924864 16:87161416-87161438 CTGAGTTGTACACTTTAAATGGG + Intronic
1142902962 17:3025012-3025034 TTGCATTGTATACTTTAAATAGG + Intronic
1143744299 17:8979510-8979532 TTGAACTGTGCACTTTAAATGGG + Intergenic
1143938344 17:10510881-10510903 TTGAATTTTATACTTTAAATAGG + Intronic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1144097107 17:11909781-11909803 TTGAATTGCACACTTTAAATGGG - Intronic
1144316235 17:14064343-14064365 TTTAATTGTACACTTTAAATAGG - Intergenic
1144399230 17:14879136-14879158 TTGAATTGTATACTTTAAGTGGG + Intergenic
1144700040 17:17331411-17331433 TTGAATTGTACACTTTAAATTGG + Intronic
1145044512 17:19602562-19602584 TTGATGTGGCTAGTATAAATAGG - Intergenic
1145059318 17:19722654-19722676 TTGAATTGTATACTTTAAAAAGG + Intergenic
1145238983 17:21228521-21228543 TTGGTTTCTCTCCTTTAAAAAGG + Intergenic
1145371355 17:22308919-22308941 TTGAATTTTACACTTTAAATGGG + Intergenic
1146041994 17:29464527-29464549 TTGAATTGTGTACATTAAAATGG + Intronic
1146084150 17:29812218-29812240 TTGAATTGTATACTTTTAATAGG - Intronic
1146103510 17:30009263-30009285 TTCAATTGTACACTTTAAATGGG - Intronic
1146139394 17:30351976-30351998 TTTAATTGTATACTTTAAATGGG - Intergenic
1146483260 17:33222526-33222548 TTGAATTGCACACTTTAAATGGG + Intronic
1146592505 17:34139868-34139890 TTGAATTGTACACTTTATATGGG + Intronic
1146795616 17:35778416-35778438 CTGAATTGTACACTTTAAATGGG + Intronic
1146818460 17:35964192-35964214 CTGAATTGAATACTTTAAATGGG + Intergenic
1147222691 17:38948000-38948022 CTGAATTGTACACTTTAAATGGG - Intronic
1147460680 17:40566075-40566097 TTGAATTCTATACTTTAAAAAGG - Intergenic
1147707969 17:42440743-42440765 TTGACTTGTACGCTTTAAATGGG + Intergenic
1147718807 17:42525629-42525651 TTGAATTGTACACTTTACATTGG + Intergenic
1147773082 17:42881003-42881025 TTGAATTATGTACTTTAAATGGG + Intergenic
1147851318 17:43445485-43445507 TTGAATTGTATAATTTAAAAGGG - Intergenic
1147983654 17:44291326-44291348 CTGAATTGTGCACTTTAAATGGG - Intergenic
1148165338 17:45480114-45480136 TTGAACTGTATACTTTAAATGGG - Intronic
1148318832 17:46731454-46731476 CTGAATTGTACACTTTAAATGGG + Intronic
1148427261 17:47610060-47610082 CTGAATTGTATACTTTAAAAGGG - Intronic
1148474762 17:47920813-47920835 CTGAATTGTATACTTTAAAAGGG - Intronic
1148803478 17:50249779-50249801 TTGAATTGTACACTTTAAATGGG - Intergenic
1149275365 17:55027735-55027757 TTGATCTGTTTATTTTAAAATGG - Intronic
1149290176 17:55210391-55210413 TTGTTTTGTTTACTTTAAATTGG + Intergenic
1149448923 17:56734392-56734414 TTGTTTGGGCTAGTTTAAATTGG - Intergenic
1149462832 17:56846521-56846543 TTGACTTGTTCACTTCAAATGGG + Intronic
1149640982 17:58202416-58202438 TTGAATTGTCTATTTCATATGGG - Intronic
1149677012 17:58474410-58474432 TTGTTTTGTCTTCTTTAATAGGG - Intronic
1149831673 17:59877797-59877819 TTGACTTGCACACTTTAAATGGG + Intronic
1149882020 17:60301932-60301954 TTGATTTTTCAACTTTACAATGG + Intronic
1149899164 17:60457828-60457850 TTGAATTGTACACATTAAATGGG - Intronic
1149939389 17:60846848-60846870 CTGAATTGTATACTTTAAAATGG - Intronic
1149950656 17:60981179-60981201 ATGATTTGTCTACTTTGACTTGG + Intronic
1150195866 17:63298643-63298665 TTGAATTGTACACTTTAAAGTGG + Intronic
1150330418 17:64289801-64289823 TTTATTGTTCTATTTTAAATTGG - Intergenic
1150367889 17:64607314-64607336 TTGAATTGCCCACTTTAAAGAGG + Intronic
1150396569 17:64826835-64826857 TTGAACTGTATACTTTAAATGGG - Intergenic
1150637530 17:66925360-66925382 ATGATTTATACACTTTAAATGGG - Intergenic
1150679165 17:67270551-67270573 TTCAGTTGTGCACTTTAAATGGG - Intergenic
1150685290 17:67315782-67315804 CTGATTTGTTCACTTTAAAATGG - Intergenic
1150715383 17:67568461-67568483 TTAACTTGTATACTTGAAATGGG + Intronic
1151251421 17:72838530-72838552 TTGAATTGTGAACTTTAAAAGGG + Intronic
1151396901 17:73828998-73829020 CTGAATTGTCCACTTTAAATGGG - Intergenic
1151544574 17:74784903-74784925 CTGATGTGTGTACTTTAAATGGG + Intronic
1152154849 17:78626225-78626247 TTGAATTGTACACTTTAAATGGG + Intergenic
1203166230 17_GL000205v2_random:98810-98832 TTCATTTCTCTTTTTTAAATAGG + Intergenic
1152999933 18:445486-445508 TTGAATTGTATACTTTAAATGGG - Intronic
1153073639 18:1135877-1135899 ATGAATTTTATACTTTAAATGGG - Intergenic
1153081191 18:1227216-1227238 CTGAATTGTACACTTTAAATGGG - Intergenic
1153120059 18:1711999-1712021 TTGAATTGTACACTTTAAGTTGG + Intergenic
1153136147 18:1919672-1919694 TTGAATTCTCTTCTTTAGATTGG - Intergenic
1153328431 18:3846910-3846932 TTAAATTGTCTACTTTAAATGGG + Intronic
1153627134 18:7032307-7032329 TTGAATTGTACACTTAAAATGGG - Intronic
1153734038 18:8045782-8045804 TTGAATTGTACACTTTACATGGG + Intronic
1154095187 18:11407922-11407944 TAGATTTGTCTACCTTAATTTGG - Intergenic
1154373720 18:13791018-13791040 TTGAATTTTATACTTTAAATGGG - Intergenic
1154393899 18:13969613-13969635 TTAATCTGTGCACTTTAAATGGG + Intergenic
1154970990 18:21409489-21409511 TTGAATTGTATAGTTGAAATGGG + Intronic
1155102674 18:22628248-22628270 TTGAGCTGTATATTTTAAATGGG + Intergenic
1155308627 18:24502656-24502678 TTGAACTGTACACTTTAAATGGG + Intergenic
1155430786 18:25755121-25755143 TTTATTTATCTATTTTAAATGGG - Intergenic
1155526780 18:26724034-26724056 TTGAATTGTCCACTTAAAATTGG - Intergenic
1155594253 18:27465501-27465523 TTGAATTATATACCTTAAATGGG + Intergenic
1155854678 18:30817924-30817946 ATAAATTGTATACTTTAAATGGG + Intergenic
1156022272 18:32613367-32613389 TTGATTTATAGACTTTAAATAGG - Intergenic
1156567016 18:38203417-38203439 TTGAATTATAAACTTTAAATGGG - Intergenic
1156691839 18:39716630-39716652 TAGAATTGTACACTTTAAATGGG - Intergenic
1156984924 18:43338938-43338960 TTAAATTGTCTATTTTATATTGG + Intergenic
1157315556 18:46586367-46586389 TTGACTTGTACACTTTAAATGGG + Intronic
1157367623 18:47080343-47080365 TTGAATCGTATACTCTAAATGGG - Intronic
1157732520 18:50016688-50016710 TTGAATTGTATATTTTAAATGGG - Intronic
1157809094 18:50680447-50680469 TTGAATTGTAGACTTTAAATAGG - Intronic
1157852687 18:51071650-51071672 TTGAATTGTCCAATTTAAATGGG - Intronic
1157912188 18:51626724-51626746 TTGATGTGGCTATTTTAATTTGG + Intergenic
1157944589 18:51964914-51964936 TTGAATTGTACACTTTAAATTGG - Intergenic
1157993885 18:52531560-52531582 TTCAATTGTCTACTTTAAGAAGG - Intronic
1158330209 18:56354170-56354192 CTGAAATGTATACTTTAAATGGG - Intergenic
1158510269 18:58084367-58084389 TTTAATTGTATACTCTAAATGGG + Intronic
1159044713 18:63358422-63358444 TTGAATTATATATTTTAAATGGG + Intronic
1159065082 18:63560512-63560534 TTGGTTTGTGTACTTTTAACAGG - Intronic
1159308914 18:66682599-66682621 TTCATTTGTCTTGTTAAAATAGG - Intergenic
1159386616 18:67734343-67734365 TTGAATTATACACTTTAAATGGG - Intergenic
1159494054 18:69177652-69177674 TTGAATTGTACACTTTAGATGGG - Intergenic
1159579089 18:70214973-70214995 CTGAATTGTACACTTTAAATTGG + Intergenic
1160028096 18:75235423-75235445 TAGATTTCTCAACTATAAATTGG + Intronic
1160055902 18:75480293-75480315 TTGAACTGTATAATTTAAATGGG - Intergenic
1160166391 18:76516421-76516443 TTGAATTGTACACTTCAAATGGG + Intergenic
1160369046 18:78356100-78356122 TTAAATTGTACACTTTAAATTGG + Intergenic
1160589683 18:79936408-79936430 TTGAATTGTACACTTTAAACAGG - Intronic
1160625130 18:80198918-80198940 TTGAATTCTACACTTTAAATGGG - Intronic
1160760694 19:782668-782690 TTTGTTTGTTGACTTTAAATTGG - Intergenic
1161602138 19:5190778-5190800 CTGAATTGTCCACTTTAAAGCGG - Intronic
1161671321 19:5612567-5612589 TTGCTTTTTCTTTTTTAAATAGG - Exonic
1161934176 19:7361123-7361145 CTGAATTGTATGCTTTAAATGGG - Intronic
1162120289 19:8461719-8461741 TTTATTTGTGTCCTTTAAATGGG + Intronic
1162120928 19:8467678-8467700 TGGATTAGTCTAAGTTAAATAGG + Intronic
1163111541 19:15164162-15164184 TTGAATTGTACACTTTAAATGGG + Intronic
1163553288 19:17978065-17978087 CTGAATTGTGCACTTTAAATGGG + Intronic
1165028227 19:32977615-32977637 TTGAGTTTTCAACTTTAAGTGGG - Exonic
1165405199 19:35626307-35626329 TTGATTGGGCTTCTTAAAATAGG + Intergenic
1165551253 19:36588203-36588225 TTGAATTGTACACTTTAAATGGG + Intronic
1165587480 19:36931762-36931784 CTCACTTGTATACTTTAAATGGG - Intronic
1165842066 19:38794182-38794204 TTGACTTGTATACTTTGAATGGG - Intergenic
1166574281 19:43822592-43822614 CTGAATTGTACACTTTAAATGGG + Intronic
1166574288 19:43822756-43822778 CTGAATTGTACACTTTAAATGGG + Intronic
1166697483 19:44860890-44860912 CTTAATTGTATACTTTAAATGGG + Intronic
1166771018 19:45282388-45282410 CTGAATTGTGCACTTTAAATGGG - Intronic
1166961568 19:46499708-46499730 TTGAGTTGTGCACTTTAAATGGG - Intronic
1167151195 19:47711091-47711113 CTGAATTGTATGCTTTAAATGGG - Intergenic
1167167351 19:47807673-47807695 CTGAATTGTATACTTTAAGTGGG + Intronic
1167216452 19:48168819-48168841 CTGACTTGTACACTTTAAATGGG + Intronic
1167228125 19:48263417-48263439 TTGAATTGTATAGTTTAAGTGGG + Intronic
1167337283 19:48894862-48894884 TGGAATTGTGAACTTTAAATGGG + Intronic
1167354821 19:48997024-48997046 CTGAGCTGTATACTTTAAATGGG - Intronic
1168071560 19:53955585-53955607 TTGAATTGTACACTTTAAGTGGG + Intergenic
1168302427 19:55413610-55413632 TTGATTTATGTAGTTTATATGGG + Intergenic
1168341883 19:55629151-55629173 TTGAATTATACACTTTAAATGGG + Intergenic
1168651019 19:58092203-58092225 ATGAACTGTCCACTTTAAATAGG + Intronic
925214308 2:2081123-2081145 TTGAATTATGAACTTTAAATGGG + Intronic
925680175 2:6412065-6412087 CTGATGTGTACACTTTAAATGGG - Intergenic
925780044 2:7373601-7373623 TTGAATTATCCACTTTACATGGG + Intergenic
925938911 2:8796221-8796243 TTTCTTTCTGTACTTTAAATTGG - Intronic
925957441 2:8981288-8981310 TTGAATTGTACACTTTAAATGGG + Intronic
926144985 2:10391473-10391495 TTACATTGTATACTTTAAATGGG - Intronic
926219760 2:10926849-10926871 GTGATTTGTAAACTTTAAATGGG + Intergenic
926459985 2:13117144-13117166 CTGAATTGTATACTTTAAAAGGG + Intergenic
926832828 2:16982128-16982150 CTGAATTGTCTACTTTAAACTGG - Intergenic
926848139 2:17164999-17165021 CTGAATTGTGTACTTTAAGTGGG - Intergenic
926983270 2:18594094-18594116 TTGAATTGTACACTTTAAATGGG - Intergenic
927115265 2:19894099-19894121 TTGAACTGTACACTTTAAATGGG + Intergenic
927480581 2:23450771-23450793 CTGAATTGTATACCTTAAATGGG - Intronic
927551740 2:24007304-24007326 CTGAATTGTATACTTTAAATGGG - Intergenic
927571303 2:24163027-24163049 TTGACTTGTACACTTAAAATGGG + Intronic
927727108 2:25434114-25434136 TTGAATTGTATACTTAAAACGGG - Intronic
928013670 2:27634345-27634367 CTGAATTGTATACCTTAAATGGG - Intronic
928033926 2:27804244-27804266 TTGGATTGTACACTTTAAATGGG - Intronic
928119434 2:28572863-28572885 TTGAACTGTATACTTTCAATTGG + Intronic
928567051 2:32563682-32563704 ATGAATTGTATACTTTAAATGGG - Intronic
928587719 2:32778362-32778384 TTGAATTGTATATATTAAATAGG - Intronic
928717665 2:34081028-34081050 TTGAATTCTATATTTTAAATGGG - Intergenic
928914939 2:36460494-36460516 CTGAATTGTGTACTTTAAAAGGG + Intronic
929059567 2:37909470-37909492 TTGGATTGTATACTTTAAATGGG + Intergenic
929336437 2:40752901-40752923 TTGTTTAGTCTATTTTAATTTGG - Intergenic
929343944 2:40857673-40857695 TTGAATTGTACACTTTAAATAGG + Intergenic
929619215 2:43337210-43337232 TTGTTTTGTCTTCTTTAAAAGGG - Intronic
929696861 2:44124880-44124902 TTGCGTTGTACACTTTAAATGGG + Intergenic
929891333 2:45920843-45920865 TTGAGTTGTACACTTTACATGGG + Intronic
929946134 2:46373725-46373747 TTGAACTGTATACTTCAAATGGG + Intronic
930074375 2:47394815-47394837 TTGAATTGTACACTTTAAGTGGG + Intergenic
930099639 2:47592992-47593014 TGGAATTGTATACTTTAAAATGG + Intergenic
930213874 2:48672802-48672824 TTGAATTGTATACTTTAAATAGG - Intronic
930241519 2:48940525-48940547 TTGATTTGTGTAGATTAAAAGGG - Intergenic
930490867 2:52069982-52070004 TAGAGCTGTCTACTTTAAATAGG - Intergenic
930899566 2:56487311-56487333 TTGATTTCTCCTCTCTAAATAGG - Intergenic
930950900 2:57143850-57143872 TCGATTTTTTTACTTTAAACTGG - Intergenic
930951728 2:57150717-57150739 TTGATTTGTGTATTTTGAACTGG - Intergenic
931060167 2:58519477-58519499 TGGATTTATGTACTTTAACTTGG + Intergenic
931266290 2:60663242-60663264 TTGAATTGTATACTTTAAATAGG - Intergenic
931440907 2:62289758-62289780 CTGAATTGTGTACTTTAGATGGG - Intergenic
931735899 2:65193705-65193727 TCGAATTGTATACTTTAAATGGG + Intergenic
932329995 2:70893155-70893177 TTGAATTATACACTTTAAATGGG + Intergenic
932506530 2:72237944-72237966 TTGAGATGTATACTTTAAATGGG - Intronic
932529077 2:72507417-72507439 TTCAATTATGTACTTTAAATGGG - Intronic
932555574 2:72821916-72821938 TTTAATTGTATACTTTAAATGGG + Intronic
932828991 2:74970016-74970038 CTGAATTGTACACTTTAAATTGG - Exonic
932869508 2:75383721-75383743 TTGAATTGTTTACTTAAAATGGG - Intergenic
933048995 2:77577834-77577856 TTGAATTGTATAATTCAAATGGG + Intronic
933192830 2:79355471-79355493 TTAAATTGTATACTTTAAAGTGG - Intronic
933204955 2:79496111-79496133 TTGAATTGTATACTTTAAATGGG + Intronic
933465804 2:82649719-82649741 CTGAATTGTACACTTTAAATGGG + Intergenic
933677590 2:85070563-85070585 CTGAATTGTCCACTTTAAAATGG - Intergenic
933708861 2:85310801-85310823 CTGAACTGTATACTTTAAATGGG - Intergenic
933868156 2:86543875-86543897 GTGAATTGTATACTTTAAAATGG - Intronic
933872268 2:86578575-86578597 TTAAATTGTATGCTTTAAATGGG + Intronic
933878364 2:86643419-86643441 CTGAATTGTATACTTTAAAATGG - Intronic
933881612 2:86675347-86675369 TTCATTTGACTACACTAAATGGG - Intronic
934537472 2:95147377-95147399 TTGAATTGTTCACTTTATATGGG - Intronic
935005816 2:99075427-99075449 TTGAGTTTTCTAATTTTAATTGG + Intronic
935061996 2:99616388-99616410 TTGAATTATATACTTTAAAGGGG - Intronic
935065963 2:99648176-99648198 CTGAATTGTATGCTTTAAATGGG - Intronic
935085851 2:99844267-99844289 CTGAATTGTTTACTTTAAAATGG - Intronic
935086900 2:99856437-99856459 TTGAATTGTCCATTTAAAATTGG + Intronic
935137173 2:100317350-100317372 TTTAGCAGTCTACTTTAAATTGG + Intronic
935583305 2:104778492-104778514 CTGACTTGTATACTTTAAAATGG + Intergenic
935662310 2:105477639-105477661 TTGATTGGGCTACTCTTAATGGG + Intergenic
935930436 2:108118251-108118273 TTGAATTGTGCACTTTTAATGGG + Intergenic
935976884 2:108586933-108586955 TTGATTTATTTACTTTATTTTGG - Intronic
935987058 2:108685180-108685202 TTGATTTATTTACTGTAAGTAGG + Exonic
936057888 2:109274934-109274956 TTGAATTGTTCACTTTAAAATGG + Intronic
936378637 2:111964574-111964596 TTGATTTATTAATTTTAAATAGG - Intronic
936478411 2:112862475-112862497 ATGATTTGTCTAGTAAAAATGGG + Intergenic
936488917 2:112953318-112953340 TTGATTTATCTCCTTTTTATGGG + Intergenic
936550513 2:113434971-113434993 TTGACTTGTACACTTTAAATTGG - Intergenic
936696750 2:114959219-114959241 GTGAATTGTACACTTTAAATTGG - Intronic
937181358 2:119998475-119998497 CTGAATTGTACACTTTAAATGGG + Intergenic
937373735 2:121320915-121320937 CTGAATTGTATACTTTAAAAGGG - Intergenic
937426142 2:121800725-121800747 TTGAATTGTACACTTTCAATGGG + Intergenic
937619044 2:123964644-123964666 TTGGATTATATACTTTAAATAGG + Intergenic
937659632 2:124415800-124415822 CTGAATTATTTACTTTAAATTGG + Intronic
937823852 2:126343126-126343148 TTGAACTGTATACTTTAAATGGG + Intergenic
937945055 2:127325913-127325935 TTGACTTGTATACTTTAAATGGG - Intronic
938197884 2:129347283-129347305 TTGAATTGTACACTTTAAGTAGG + Intergenic
938385635 2:130864826-130864848 TTCAATTGTCTACTTTAAGTGGG + Intronic
938469996 2:131551121-131551143 GTGAATTTTATACTTTAAATGGG + Intergenic
938573649 2:132584831-132584853 TTGATTTGTCTGCATTCATTTGG + Intronic
938879782 2:135573112-135573134 TTGAATTATACACTTTAAATGGG + Intronic
938925766 2:136040499-136040521 TTGAATTGTCTACTTTAAATGGG + Intergenic
939140431 2:138347468-138347490 TTGATGTGTCTACCCTACATAGG + Intergenic
939152450 2:138488999-138489021 CTGAATTGTATACTTTACATGGG - Intergenic
939201972 2:139047417-139047439 TTGGTTTGCCTCCTTTACATTGG - Intergenic
939232661 2:139450316-139450338 TTGAATTATGTACTTTAAATAGG - Intergenic
939293147 2:140221182-140221204 TTGATGTGGCTAATATAAATAGG + Intergenic
939686176 2:145203652-145203674 TTTATTTATTTACTTAAAATAGG + Intergenic
939924648 2:148157989-148158011 TTGAATTGTGCACTTTAAAATGG + Intronic
940099250 2:150015140-150015162 TAAAGTTTTCTACTTTAAATTGG + Intergenic
940151736 2:150609616-150609638 TTGATTTTTCTTGTTTAAAACGG - Intergenic
940252793 2:151698268-151698290 TTGAATTGTATACTTTAAATTGG - Intronic
940304359 2:152209941-152209963 TTTAATTGTATACTTTAAGTAGG - Intergenic
940329574 2:152459755-152459777 TTGAGTTGCATACTTTAAATGGG + Intronic
940435912 2:153654077-153654099 TTGATTACACTACTTTACATGGG - Intergenic
940546716 2:155098628-155098650 TTGAAATGTACACTTTAAATGGG + Intergenic
940645389 2:156387159-156387181 CTGAATTTTATACTTTAAATGGG + Intergenic
941676172 2:168345665-168345687 CTGATTTGGCTACTTGAAATAGG - Intergenic
941752555 2:169148412-169148434 GTGAATTGTACACTTTAAATGGG + Intronic
941793894 2:169579456-169579478 TTGAATTGTACACTTTAAATGGG - Intergenic
941979186 2:171435859-171435881 TTGAACTGTACACTTTAAATGGG - Intronic
942009098 2:171740828-171740850 CTGAATTGTATACTTTAAAAGGG - Intronic
942281742 2:174371234-174371256 TTGAATTGTATGCTTCAAATAGG + Intronic
942324071 2:174760671-174760693 CTGAATTGTATACTTTAAAGTGG + Intronic
942384541 2:175427565-175427587 TTGGGTTGTATACTTTAAATGGG + Intergenic
942391940 2:175503827-175503849 CTGAATTGTATACTTAAAATTGG - Intergenic
942479243 2:176365355-176365377 TTTCTTTTTCTACTTTGAATTGG + Intergenic
942502975 2:176611494-176611516 TTAAAATGTATACTTTAAATGGG - Intergenic
942705591 2:178768231-178768253 TTGAATTGTATACTTTAAATTGG - Intronic
943413426 2:187567876-187567898 CTTTTTTGTCTACTTTAAAGTGG + Intergenic
943442171 2:187938691-187938713 TGGATTTTTCTAGTTTAGATAGG - Intergenic
943568856 2:189548537-189548559 TTCAGTTGTATACTTTAAATGGG - Intergenic
943926726 2:193793489-193793511 TTGGTTTTTACACTTTAAATGGG + Intergenic
944623726 2:201547244-201547266 CTGAGTTCTATACTTTAAATGGG + Intronic
944706191 2:202291421-202291443 ATGATTTGTATACTTAAAAGGGG + Intronic
944961117 2:204875129-204875151 CTGAATTGTATACTTAAAATGGG - Intronic
945215389 2:207428238-207428260 TGGAATTGTACACTTTAAATAGG + Intergenic
945223732 2:207510740-207510762 TTGATTTCTATACTCTGAATTGG + Intergenic
945234726 2:207624092-207624114 CTGAATTGTGCACTTTAAATAGG + Intronic
945263320 2:207865318-207865340 TTGAATTGTAGACTTTAAATAGG - Intronic
945282864 2:208052754-208052776 TTGAATTGTGCACTTCAAATGGG - Intergenic
945437586 2:209837715-209837737 TTTATTGGTCAACTTTAAAAAGG - Intronic
945511722 2:210711507-210711529 TTGAATTGTACACTTTAAATGGG - Intergenic
945511724 2:210711564-210711586 TTTAATTGTATACTTTAAACGGG - Intergenic
945760290 2:213905486-213905508 TTGAATTATCTACTTAAAACAGG + Intronic
945880490 2:215320271-215320293 CTGATTTGTACATTTTAAATTGG - Intronic
945938963 2:215929443-215929465 TTGAATTATATACTTAAAATAGG + Intergenic
946063899 2:216969432-216969454 CTGAATTGTACACTTTAAATGGG - Intergenic
946167377 2:217873144-217873166 TTGAATTGTATACTTTAAAGAGG + Intronic
946184378 2:217970842-217970864 TTGAATTGTACACTTTAAATGGG + Intronic
946921788 2:224587596-224587618 TAGATTTGGCAACTTTATATTGG + Intergenic
947040505 2:225913353-225913375 TTGAATTGTGCACTTTAAAATGG - Intergenic
947051875 2:226054277-226054299 CTGATTAGTATATTTTAAATTGG + Intergenic
947087653 2:226474044-226474066 TTGAATTGTACACTTGAAATGGG + Intergenic
947131263 2:226927773-226927795 TTATTTTGTCTACTTTTAATTGG + Intronic
947133998 2:226958507-226958529 TTGAATTGTCCACTCTAAGTAGG + Intronic
947471840 2:230408243-230408265 TTGAATTGTACAATTTAAATGGG + Intergenic
947852623 2:233300567-233300589 CTGAATTGTTTACTTTAAAATGG - Intergenic
947873749 2:233454584-233454606 TTGAATTGTACATTTTAAATTGG + Intronic
947924253 2:233907310-233907332 TTGCTTTGTGTGCTTTACATGGG + Intergenic
947927558 2:233935096-233935118 TTGATTGGTCTTCTTTTAAATGG - Intronic
948333188 2:237187085-237187107 ATGATTTGGCTTCTTTAAAAAGG + Intergenic
948333448 2:237190019-237190041 GTGATTTGACTTCTTTAAAAAGG - Intergenic
948422992 2:237871931-237871953 TTGAATTGTCTATGTAAAATGGG + Intronic
948796466 2:240405064-240405086 TTGAATTGTATACTTTCAATGGG - Intergenic
948957063 2:241301598-241301620 TTGCTTTGTCTTCTTTATGTTGG - Intronic
1168875274 20:1167387-1167409 CTGAATTGTATACTTTAAACAGG - Exonic
1168900400 20:1359032-1359054 TGGAAATGTATACTTTAAATGGG - Intronic
1169281545 20:4271552-4271574 CTGAAGTGTATACTTTAAATGGG - Intergenic
1169696461 20:8392748-8392770 GTGTTTTGTCTTCTTTGAATGGG + Intronic
1169848977 20:10029632-10029654 TTGTTTTGACTCCTTTATATTGG - Intronic
1170070834 20:12364890-12364912 TTTATCTGGCTATTTTAAATGGG - Intergenic
1170185996 20:13591153-13591175 TCCATTTGTCTACTTTTATTTGG - Intronic
1170220140 20:13933285-13933307 TTGAATTGTACACTTTAAATGGG - Intronic
1170258848 20:14379389-14379411 TCGAATTGTATACTTTAAATGGG - Intronic
1170485253 20:16809043-16809065 TCTATTTGTCTGTTTTAAATGGG - Intergenic
1170688874 20:18594122-18594144 TTGGTTTCTCTTTTTTAAATTGG + Intronic
1170689203 20:18597397-18597419 TTGACTTGTACACTTTAAATAGG - Intronic
1170984958 20:21249139-21249161 TTGAAGTGTACACTTTAAATAGG + Intergenic
1170992251 20:21313954-21313976 CTGAGTTGTACACTTTAAATGGG - Intronic
1170993865 20:21332525-21332547 TTTAATTGTATACTTTAAAATGG - Intronic
1171247827 20:23627056-23627078 CTGAATTGTATACTTTAAGTGGG - Exonic
1171455346 20:25268460-25268482 TTCATATGTATACTTTAAAAAGG + Intronic
1171545244 20:25995558-25995580 TTGAATTTTACACTTTAAATGGG + Intergenic
1172089446 20:32418477-32418499 CTGAATTGTATACTTTAAATTGG - Intronic
1172431587 20:34897238-34897260 ATGAATTGTATACTTTAAATGGG - Intronic
1172455378 20:35067972-35067994 CTGAATTGTGTACTTCAAATGGG + Intronic
1172761144 20:37323336-37323358 CTGAATTGTATACTTTAAAATGG - Intergenic
1173303905 20:41829602-41829624 TTGAATTATATAATTTAAATGGG + Intergenic
1173447773 20:43135572-43135594 TTTGTTTGTCTACATTGAATAGG - Intronic
1173486643 20:43446059-43446081 TTGAACTGTCTACTTAAAATAGG - Intergenic
1173561244 20:44007142-44007164 TTAAGTAGTATACTTTAAATGGG - Intronic
1173653040 20:44679631-44679653 CTGAATTGTACACTTTAAATGGG - Intergenic
1173816232 20:45990500-45990522 TAGAATTGTATACTTAAAATAGG + Intergenic
1174213990 20:48902074-48902096 TTGAATTGTACACTTTAAAAGGG - Intergenic
1174214739 20:48907655-48907677 CTGAATTGTACACTTTAAATGGG - Intergenic
1174267549 20:49342866-49342888 TTGAACTGTACACTTTAAATGGG - Intergenic
1174473792 20:50781375-50781397 TTGAAACGTATACTTTAAATAGG + Intergenic
1174602580 20:51736704-51736726 CTGAATTGTACACTTTAAATAGG + Intronic
1174936313 20:54874056-54874078 TTCATTTGTAAACTTTAAAAAGG + Intergenic
1174944421 20:54969612-54969634 TGGATTTGTATACTTTAAACAGG + Intergenic
1175211286 20:57358046-57358068 TTGATGTGGCTAGTTTAAATAGG + Intronic
1175336124 20:58197461-58197483 TTGAATTTTTCACTTTAAATGGG - Intergenic
1175679907 20:60978427-60978449 TTGAATTGTATACTTGAAATGGG - Intergenic
1175781467 20:61684923-61684945 TTGAATTGTACACTTTAAACAGG - Intronic
1176089039 20:63310906-63310928 TGGAGTTGTACACTTTAAATGGG - Intronic
1176405525 21:6360286-6360308 TTCATTTCTCTTTTTTAAATAGG - Intergenic
1176677810 21:9796657-9796679 TTGTTTTTTGTACTTGAAATTGG - Intergenic
1177193425 21:17876930-17876952 TTGATTAATCTAATTTAAATTGG + Intergenic
1177398708 21:20572817-20572839 TTGAACTGTATAATTTAAATGGG + Intergenic
1177638566 21:23817062-23817084 TTGAATTGCATACTTTAAAATGG - Intergenic
1178479288 21:32965511-32965533 TTGATTTGATTACTTCAATTTGG + Intergenic
1178838880 21:36122458-36122480 TTGAATTGTATACTTTAAATGGG + Intergenic
1178912504 21:36686997-36687019 TTAAATTGTACACTTTAAATGGG + Intergenic
1178958028 21:37041111-37041133 TTTAATTGTATACTTTAAATGGG - Intergenic
1178971128 21:37177851-37177873 TTAAGTTGTCTATTTTTAATAGG - Intronic
1179074627 21:38108517-38108539 TTGAATCATATACTTTAAATGGG + Intronic
1179082509 21:38185148-38185170 ATTATTTGTCTGCTTTTAATTGG - Intronic
1179204620 21:39263126-39263148 TTGAATTGTACACTTAAAATTGG + Intronic
1179228704 21:39480219-39480241 TTGAATTGTACACTTTAAATGGG - Intronic
1179435009 21:41355793-41355815 TTGAATTGTACACTTTACATTGG + Intronic
1179533690 21:42037841-42037863 GTGAATTGTACACTTTAAATGGG + Intergenic
1180262100 21:46678543-46678565 TTCATTTGTACACTTAAAATTGG + Intergenic
1180605079 22:17052526-17052548 TTGAATTGTACACTTAAAATAGG + Intergenic
1180927092 22:19563051-19563073 TTGAATTGTGTGCTTAAAATTGG - Intergenic
1182207303 22:28641625-28641647 CTGAATTGTATACTTTAAAATGG + Intronic
1182388378 22:29967580-29967602 CTGAATTGTATACTTTAAAAGGG - Intronic
1182400612 22:30073962-30073984 CTGATTTGTATATTTTAAAGTGG + Intergenic
1182628629 22:31667206-31667228 CTGAATTGTCCACTTTAAAATGG + Intergenic
1182725006 22:32438006-32438028 TTGATTTATCTACTTTTCCTGGG - Intronic
1182928411 22:34149666-34149688 TTGAATTGTGCACTTTAAATGGG + Intergenic
1183266329 22:36828334-36828356 CTGAATTGTCTACTTTAAAGTGG + Intergenic
1183798260 22:40138971-40138993 TTGAGCTGTATACTATAAATGGG - Intronic
1183799267 22:40147997-40148019 CTGAATTGTGTACTTTAAACAGG + Intronic
1183886527 22:40887978-40888000 TTGATTTGCATACTTAAAAACGG - Intronic
1184107236 22:42375135-42375157 TTGAATTGTACACTTTAAAAGGG - Intergenic
1184200279 22:42963950-42963972 TTGAATTGTGCCCTTTAAATGGG - Intronic
1184761108 22:46544971-46544993 TTGAATTGTACACTTTAAAGTGG - Intergenic
1184967569 22:47992047-47992069 ATGATTTTTCTACTTTACAATGG + Intergenic
949130454 3:493928-493950 TTGAGTTGTACATTTTAAATAGG - Intergenic
949276163 3:2284343-2284365 TTGATATGTATACTATAGATTGG - Intronic
949479605 3:4481055-4481077 TTGAATTGTATACTTTATATGGG - Intergenic
949751056 3:7353258-7353280 TTGATTTTTCTAATTTATACAGG + Intronic
949768656 3:7554256-7554278 GTGATGTGGCTACTTTAAACAGG - Intronic
949854304 3:8446361-8446383 CTGAATTGTCTACTTTAAAATGG - Intergenic
949877683 3:8637011-8637033 TTGATTTTTCTACTTTATGATGG + Intronic
949997300 3:9628286-9628308 TTGAATTATGTACTTTAGATAGG - Intergenic
950235299 3:11314618-11314640 TTGCATTATGTACTTTAAATGGG + Intronic
950706741 3:14787434-14787456 CTGAATTGTACACTTTAAATGGG + Intergenic
950883377 3:16342070-16342092 CTGAATTGTTTGCTTTAAATAGG - Intronic
950925718 3:16739394-16739416 TTGAATTGTACACTTTAAAATGG - Intergenic
950969430 3:17171301-17171323 TTGATTTGTCTACTTTTTGGAGG + Intronic
951016828 3:17741580-17741602 TTCATTTGTCAACTCTGAATTGG - Intronic
951025350 3:17822535-17822557 TTGGTTTTTCAACTTTGAATGGG - Intronic
951232393 3:20194307-20194329 TTGAATTATACACTTTAAATTGG - Intergenic
951425016 3:22534369-22534391 TTAATTTGCCTACTTTTGATGGG - Intergenic
951444487 3:22762639-22762661 TTGTTATGTCTACTTTAAAATGG - Intergenic
951484578 3:23197768-23197790 TTGAATTATATACTTTAAATTGG + Intergenic
951843385 3:27059268-27059290 TTGATTTTACTATTTGAAATAGG - Intergenic
951949464 3:28183531-28183553 TTGATTTGTGTATGTTGAATTGG - Intergenic
952025863 3:29081295-29081317 TTTAATTGTGTACTTTAAAGGGG - Intergenic
952409802 3:33037374-33037396 TTGAATGGTGTACTTTGAATGGG + Intronic
952421518 3:33135903-33135925 CTGAATTGTATACTTTAAAAAGG - Intronic
952433827 3:33252273-33252295 TTGAATTGTGCACTTTAAATGGG - Intergenic
952468842 3:33622668-33622690 CTGAATTGTATACTTTAAAATGG - Intronic
952677882 3:36054756-36054778 CTGAGTTGTGTATTTTAAATGGG + Intergenic
952809529 3:37388826-37388848 TTGAATTGTACACTTTAAATTGG - Intronic
952853315 3:37747162-37747184 TTGAATTGTATGCTTTAAATGGG - Intronic
953062222 3:39436587-39436609 CTGAGTTGTACACTTTAAATGGG - Intergenic
953124909 3:40082731-40082753 CTGATATGGCTCCTTTAAATGGG + Intronic
953245140 3:41184247-41184269 CTGAATTGTACACTTTAAATGGG - Intergenic
953345049 3:42168420-42168442 TTGAATTGTCTAGTTAAAATGGG - Intronic
953443658 3:42942931-42942953 CTTAATTGTATACTTTAAATGGG - Intronic
953596909 3:44324685-44324707 CTGACTTGTATACTTTAAATGGG - Intronic
954775696 3:53015895-53015917 ATGAATTGTATACTTTAAGTAGG + Intronic
954902326 3:54030609-54030631 CTGCGTTGTATACTTTAAATGGG + Intergenic
954981993 3:54754697-54754719 TTCAGTGGTCTGCTTTAAATGGG + Intronic
955101771 3:55857130-55857152 CTGAATTGTATACTTTATATTGG + Intronic
955150741 3:56364463-56364485 TTGAATTGTTCACTTTAAATGGG + Intronic
955359316 3:58259375-58259397 TTGAATTGTACACTTTAAAATGG - Intronic
955486010 3:59435460-59435482 TTGAATTGAATGCTTTAAATGGG + Intergenic
955960833 3:64339901-64339923 TTGAGTTGTATACTTTATATGGG + Intronic
955964388 3:64373276-64373298 TTGAATTATATAATTTAAATTGG + Intronic
956034699 3:65078674-65078696 TTAAGTTGGCTACTTTGAATTGG + Intergenic
956094869 3:65705440-65705462 CTGAATTGTATACTTTAAAATGG + Intronic
956210500 3:66796924-66796946 CTGAATTGTATATTTTAAATTGG + Intergenic
956464364 3:69504348-69504370 TTGAATTGTACACTTTAAGTGGG - Intronic
956564641 3:70622391-70622413 CTGAATTGTGCACTTTAAATTGG - Intergenic
956901784 3:73724095-73724117 TTAAACTGTGTACTTTAAATAGG - Intergenic
957025781 3:75180114-75180136 TAGATATGTATACTTTAAATAGG + Intergenic
957065770 3:75520691-75520713 TTGATTTGTTCACTTTAAATGGG - Intergenic
957251225 3:77773384-77773406 TTGTTTTCTCTAGTTTGAATAGG + Intergenic
957350833 3:79019853-79019875 TTGATTTTTTTTTTTTAAATGGG - Intronic
957667120 3:83247219-83247241 TTGATTTGTCTAATATACAGTGG + Intergenic
957698211 3:83672064-83672086 TTTATATGTCTATTTAAAATGGG + Intergenic
957856144 3:85881628-85881650 TTGATTTGTCTAATTCTACTGGG + Intronic
958602153 3:96309347-96309369 TTGATTTGTATTATTTTAATAGG - Intergenic
958824449 3:99013618-99013640 TTTAACTGTCTACTTAAAATGGG - Intergenic
958860499 3:99439339-99439361 TTTATTTGTTTATTTTGAATTGG - Intergenic
958862591 3:99463232-99463254 TTTATTTGTCTATTTTTTATTGG - Intergenic
958999425 3:100945354-100945376 TTGAGCTGTATACTTAAAATGGG - Intronic
959466864 3:106699045-106699067 TTAAATTGTCTTCATTAAATAGG - Intergenic
959760080 3:109951612-109951634 TTGAAGTTTATACTTTAAATGGG + Intergenic
959918238 3:111842635-111842657 TTGAATTGTAAACTTTAAGTAGG - Intronic
960010236 3:112826030-112826052 TTGAATTGCATGCTTTAAATGGG + Intronic
960551662 3:118982596-118982618 TTAATTTTTCTATTTGAAATGGG - Intronic
960587845 3:119336680-119336702 TTGACTTGTATACTTTAAATAGG - Intronic
960712856 3:120548400-120548422 TTCATTTGCCCATTTTAAATTGG + Intergenic
960742192 3:120846531-120846553 CTGAATTGTATACTTTAAATGGG - Intergenic
960770606 3:121189836-121189858 TTTATTTGTTTATTTTAAGTTGG - Intronic
960771185 3:121194059-121194081 TTGAATCATATACTTTAAATGGG - Intronic
960880849 3:122343175-122343197 TTCACTTGTACACTTTAAATGGG - Intergenic
960894089 3:122483346-122483368 TTGTTTTGTTTTTTTTAAATTGG + Intronic
961049015 3:123730872-123730894 CTGAATTGTGTACTTTAAAAGGG + Intronic
961197869 3:125018485-125018507 CTGAATTGTGTGCTTTAAATGGG + Intronic
961287381 3:125817369-125817391 TTGATTTGTTCACTTTAAATGGG + Intergenic
961317675 3:126051584-126051606 TTGATTTTTCTACTTTTAATGGG - Intronic
961405411 3:126675915-126675937 TTGAGTTGTACACTTTCAATGGG + Intergenic
961598550 3:128040667-128040689 CTGAATTGTGCACTTTAAATAGG + Intergenic
961606947 3:128102791-128102813 TGGAATTGTATACTTAAAATGGG + Intronic
961870295 3:129982747-129982769 TTGAATTGTACACTTTAGATGGG - Intergenic
961899705 3:130198600-130198622 TTGATTTGTTTACTTTAAATTGG - Intergenic
962188762 3:133288416-133288438 TTTATATGTATTCTTTAAATCGG + Intronic
962339160 3:134567403-134567425 CTGAATTGTGTACTTTAAATGGG + Intronic
962396620 3:135020290-135020312 TTGAATTGTACACTTTAATTGGG - Intronic
962499182 3:135971998-135972020 CTGATTTGTACACTTTAAAATGG - Intronic
962518876 3:136179754-136179776 TTGACATATCTACTTTAAAACGG + Intronic
962694307 3:137932380-137932402 TTGATTTGCCTCCTTGAAAAGGG - Intergenic
962771147 3:138611333-138611355 AAGAATTGTATACTTTAAATGGG - Intronic
963047527 3:141113783-141113805 CTGAATTGTATACTTTAAAATGG + Intronic
963491518 3:146007683-146007705 TTGAGTTGCATGCTTTAAATGGG + Intergenic
963954472 3:151237951-151237973 TTGGTGTCTCTACTATAAATAGG + Intronic
964366172 3:155952992-155953014 TTGAATTGTACACCTTAAATGGG - Intergenic
964527181 3:157627506-157627528 TTGAATTGTACACTTTAAATAGG - Intronic
964604311 3:158542783-158542805 TTGAATTATGTACTTTAAAAGGG + Intronic
964800687 3:160554239-160554261 CTGAATTGTATACTTTAAATGGG - Intronic
964827467 3:160844768-160844790 TTGAATTGTACACTTTATATGGG - Intronic
964875896 3:161368284-161368306 CTGAATTGTGTACTTTAAGTAGG - Intronic
965138883 3:164810052-164810074 TTTATTTGTCTACTCTCAGTTGG - Intergenic
965533940 3:169804824-169804846 CTGAATTGTATACTTTAAAATGG - Intronic
965697002 3:171419462-171419484 TTGAATTGAATACTTCAAATGGG + Intronic
965699283 3:171443130-171443152 TTCTTCTGTCTTCTTTAAATTGG - Intronic
965760141 3:172066827-172066849 TTGATTATTATACTTTTAATTGG + Intronic
965932820 3:174068077-174068099 TTGCTTTGACTACTGGAAATTGG + Intronic
966117077 3:176477797-176477819 TTGAATTGTACCCTTTAAATGGG + Intergenic
966168006 3:177042958-177042980 TTGAATTGTATGCTTTAAACAGG - Intronic
966956954 3:184891557-184891579 CTGAATTGTATACTTTAAAAGGG - Intronic
966987097 3:185190955-185190977 TTGAGTTGTATATTTTAAGTGGG - Exonic
967048520 3:185760417-185760439 TTGAACTGTACACTTTAAATGGG - Intronic
967238152 3:187408529-187408551 TTGATTTGTTTTTTTTTAATAGG - Intergenic
968023665 3:195419105-195419127 TTGAATTGTACACTTCAAATGGG - Intronic
968175444 3:196545408-196545430 TAGATTTGTGTACTTTAAGTGGG + Intergenic
968257907 3:197295639-197295661 ATGATTTATCTACTTAAAAAAGG + Intronic
968543570 4:1182215-1182237 TTGACTTTTTTTCTTTAAATGGG - Intronic
968859133 4:3152434-3152456 ATGAATTATATACTTTAAATGGG - Intronic
969010367 4:4056754-4056776 TTGATTTGTTCACTTTAAATGGG - Intergenic
969043213 4:4317361-4317383 ATGAATTGTTCACTTTAAATTGG - Intronic
969078228 4:4597721-4597743 TTGACTTGTAGACTTTAAATAGG + Intergenic
969140685 4:5068750-5068772 TTTATATTTCTGCTTTAAATTGG + Intronic
969352730 4:6606963-6606985 CTGAATTGCCCACTTTAAATGGG - Intronic
969582834 4:8075715-8075737 TTGACTTGTGCCCTTTAAATGGG + Intronic
969689565 4:8696731-8696753 TTGACTTGTGTACTTCAAAGAGG - Intergenic
969743686 4:9053141-9053163 TTGATTTGTTCACTTTAAATGGG + Intergenic
969803090 4:9585233-9585255 TTGATTTGTTCACTTTAAATGGG + Intergenic
969859866 4:10027294-10027316 CTGAATTGTTTACTTTAAAATGG + Intronic
969929648 4:10618484-10618506 TTGAATAGTATACTTTAAAATGG + Intronic
970043864 4:11827735-11827757 TTGATTTGTTTTTTGTAAATGGG + Intergenic
970200804 4:13602619-13602641 TTTAATTGTCTGCTTTAAATTGG + Exonic
970448487 4:16143720-16143742 TTGACTTGTACACTTTAAATGGG + Intergenic
970498038 4:16647391-16647413 TTGAGTTGTATACTTTAAATAGG + Intronic
970953587 4:21785203-21785225 TTGAATTGGATACTTTAAATGGG - Intronic
970978083 4:22064439-22064461 TTGATTTACCCACTTTACATTGG - Intergenic
971102809 4:23486687-23486709 GAGAATTGTGTACTTTAAATGGG - Intergenic
971466491 4:26968641-26968663 CTGAATTGTATACTTAAAATTGG + Intronic
971554340 4:27994229-27994251 CTGATTTGTGTACTTAAAAAAGG - Intergenic
972461688 4:39309781-39309803 CTGATTTGTATACTTTATAAGGG + Intronic
972502164 4:39688533-39688555 TAGAATTGTACACTTTAAATAGG - Intergenic
972683224 4:41327010-41327032 ATGAGTTGTATATTTTAAATTGG + Intergenic
972938076 4:44164140-44164162 CTGAATGGTATACTTTAAATAGG + Intergenic
973176180 4:47208550-47208572 TTGAATTGTATACTTTAAATGGG + Intronic
973259533 4:48148209-48148231 CTGAATTGTATACTTTAAATGGG + Intronic
973529666 4:51823142-51823164 TTGAATTGTTTACTTTAAAATGG - Intergenic
973643062 4:52922221-52922243 TTGAATTTTATACTTTAAATGGG - Intronic
973915311 4:55628210-55628232 TTGAGTTGTACACTTTAAATGGG - Intronic
973973057 4:56234124-56234146 CTGAGTTGTATACTTTAAAAGGG - Intronic
974008338 4:56583429-56583451 CTGAATTGTATACTTTAAAAGGG + Intronic
974281780 4:59804609-59804631 TTGAATCATATACTTTAAATTGG + Intergenic
974422332 4:61693260-61693282 TTAATTTGGTTACTTTATATAGG - Intronic
974432065 4:61811597-61811619 TTGAATTGTTTACATTAAATGGG + Intronic
974555335 4:63439476-63439498 TTCAATTGTGTACTTTAAATAGG + Intergenic
974667911 4:64989273-64989295 CTGAATTGTTTACTTTAAAATGG + Intergenic
974902714 4:68021077-68021099 TTGAATTGCACACTTTAAATTGG - Intergenic
975285694 4:72616694-72616716 TTGAATTATACACTTTAAATGGG + Intergenic
975350203 4:73337817-73337839 TTGAATTGTACACTTTAAGTGGG - Intergenic
975757057 4:77581210-77581232 TTGAATTGTACACTTTAAATGGG + Intronic
975907935 4:79237519-79237541 TTGAATTCTATACTTAAAATGGG - Intronic
976166258 4:82258191-82258213 TTGAGTTGTATACTCTAAATGGG - Intergenic
976215046 4:82708198-82708220 ATGACTTGTATACATTAAATAGG + Intronic
976253073 4:83073059-83073081 TTGAATTGTTTACTTTAAAATGG - Intronic
976321403 4:83720802-83720824 TTTATTTGTTTTTTTTAAATTGG + Intergenic
976695402 4:87914818-87914840 TAGATTTTTCTACTTTACAATGG + Intergenic
976706924 4:88028794-88028816 CTGATTTTTTTACTTTAAAATGG - Intronic
976721082 4:88169478-88169500 TTTATTTATCTACTTTTGATGGG + Intronic
976797687 4:88953065-88953087 TTGAATTGTACACTCTAAATGGG - Intronic
976918991 4:90413108-90413130 CTGATTTGTGTACATTAATTTGG - Intronic
976942293 4:90718049-90718071 TTGATTTCTATAGTATAAATGGG - Intronic
977329183 4:95615425-95615447 CTGAATTGTATACTTCAAATGGG - Intergenic
977590956 4:98826640-98826662 TTTAATTGTATACTTTCAATAGG - Intergenic
977874928 4:102138387-102138409 TTGATTTATCTACTTCATTTTGG + Intergenic
978056714 4:104278648-104278670 TTGAATTGTGTACTTTAAATCGG + Intergenic
978081423 4:104597347-104597369 TTTATTTTTCTACTAGAAATTGG - Intergenic
978135137 4:105248679-105248701 CTGAATTGTATACTTTAAAAGGG - Intronic
978170234 4:105660863-105660885 TCAAATTGTATACTTTAAATAGG - Intronic
978354462 4:107856895-107856917 CTGATTTGTACACTTTAAAAAGG - Intronic
978493242 4:109331483-109331505 TTGAATAGAATACTTTAAATGGG + Intergenic
979386356 4:120069446-120069468 TTGATTTGTCTACAGTTGATTGG + Intergenic
979469473 4:121077598-121077620 TTGATGTTTCAACTTTACATTGG - Intergenic
979655510 4:123188729-123188751 TTGTTTTATCTATTATAAATAGG + Intronic
980126025 4:128775142-128775164 TTGAATTGTGTATTTTAACTGGG + Intergenic
980214912 4:129839640-129839662 TTGAGTTGTACACTTTAAATGGG + Intergenic
980545531 4:134256746-134256768 TTGATTTGTGTATTTAAATTGGG + Intergenic
980726797 4:136772346-136772368 TGGTTTTGACTACTTTAAAATGG - Intergenic
980847595 4:138342617-138342639 TTCCTTTGTCTACTTTTATTTGG + Intergenic
981345184 4:143666928-143666950 TTGAATTATAGACTTTAAATGGG + Intronic
981515169 4:145599801-145599823 CTGAATTGTATACTTTAAAATGG - Intergenic
981542868 4:145863850-145863872 TTGAATTGTGTACTTTGAATGGG + Intronic
981574943 4:146194439-146194461 CTGTTTTATTTACTTTAAATAGG + Intronic
981901196 4:149865820-149865842 TTGAATTGTACACTTTAAAATGG - Intergenic
981977951 4:150754113-150754135 TTGTTTTGTGCACTTTATATGGG - Intronic
982201229 4:152963005-152963027 TTGATTTGTCTTCTTTAGGGAGG + Exonic
982236548 4:153256077-153256099 TTAAATTGTACACTTTAAATGGG + Intronic
982314422 4:154017172-154017194 TTCAGTTGTGTACATTAAATAGG + Intergenic
982362667 4:154537623-154537645 TTGGTTTGTCTACTTTCATTTGG + Intronic
982649609 4:158070899-158070921 TTGAGTTGTGCACTTTAAATGGG + Intergenic
982947416 4:161642232-161642254 TTGTATTGTATACTTAAAATTGG - Intronic
983097510 4:163581262-163581284 TTGATATGCCTACATAAAATAGG + Intronic
983136867 4:164094971-164094993 TTGGTTTGTTTACTGTTAATGGG - Intronic
983168627 4:164510495-164510517 ATGAGTTGTGTACTCTAAATGGG - Intergenic
983179224 4:164628449-164628471 TATCTTTGTCTACTTTTAATGGG - Intergenic
983251898 4:165354895-165354917 TTGAATTGTATACTTTAAAAGGG + Intergenic
983549286 4:168998647-168998669 CTGAATTGTAAACTTTAAATGGG + Intronic
983669887 4:170224222-170224244 TTGAACTGTACACTTTAAATGGG - Intergenic
983777899 4:171631178-171631200 TTGATCTCTCTACATTAAAAAGG + Intergenic
983865139 4:172757581-172757603 TTGATGTTTCTACTTTGTATAGG - Intronic
984264156 4:177476436-177476458 TTTATTAGTTTACTTAAAATTGG - Intergenic
984350548 4:178586912-178586934 TTGAATTGTTCACTTTAATTTGG + Intergenic
984436088 4:179712100-179712122 TTGAATTGTACACCTTAAATGGG + Intergenic
985241628 4:187936910-187936932 TTGAATTGTACACTTTATATGGG + Intergenic
985397716 4:189562137-189562159 TTGTTTTTTGTACTTGAAATTGG + Intergenic
986310785 5:6549607-6549629 TTGAATTGTACACTTTAAGTGGG - Intergenic
986518072 5:8583885-8583907 TAGATATGTTTAATTTAAATGGG + Intergenic
986633566 5:9798350-9798372 TTGAATTGTATACTTAAAACAGG + Intergenic
986752108 5:10796531-10796553 TTGAATTGTGCCCTTTAAATGGG - Intergenic
986880895 5:12169580-12169602 TTTATTTGTGTGGTTTAAATAGG + Intergenic
986891468 5:12313308-12313330 TTGAATTATATCCTTTAAATGGG - Intergenic
987251361 5:16104431-16104453 TTGAATTGTACACTTAAAATGGG + Intronic
987335079 5:16891590-16891612 CTGAATTATATACTTTAAATGGG + Intronic
987755332 5:22093733-22093755 TTGAATTCCATACTTTAAATAGG + Intronic
987886127 5:23815388-23815410 TTGATTTGAATACATTAAAATGG + Intergenic
988632064 5:32942225-32942247 ATGAATTGTGTACTTTAAAAGGG + Intergenic
988650610 5:33145964-33145986 TTGTATTGTTGACTTTAAATGGG + Intergenic
988677197 5:33444369-33444391 TTGAATTGTGTACTTTACATGGG + Intronic
988988221 5:36642586-36642608 TTAAATTGTACACTTTAAATGGG - Intronic
989010339 5:36864466-36864488 CTGAATTGTACACTTTAAATGGG - Intergenic
989038655 5:37203097-37203119 TTGAACTGTATACTTTAAAAAGG - Intronic
989362438 5:40618081-40618103 CTGAATTGTGTACTTAAAATTGG - Intergenic
989371897 5:40719102-40719124 TTGAATTGTATGTTTTAAATGGG - Intronic
989471517 5:41824738-41824760 TTGAATTGTCTTCTTAGAATTGG - Intronic
989812017 5:45689103-45689125 TTGAATTGCTTACTTTAAATGGG + Intronic
990392694 5:55342811-55342833 TTGATTTGTCTATTTTAGGAGGG + Intronic
990563859 5:57009557-57009579 TTGAATTGTACAATTTAAATGGG - Intergenic
991197364 5:63952125-63952147 TTGAATTATACACTTTAAATGGG + Intergenic
991236171 5:64400441-64400463 TTTAATTGTATACTTTAAATGGG + Intergenic
991284077 5:64950662-64950684 TTGAATTGCCTACTTAAAATTGG - Intronic
991284133 5:64951518-64951540 TTGAACTGTATACTTTCAATAGG - Intronic
991327152 5:65446921-65446943 GTGAATTGTATACTTTAAATGGG + Intronic
991941377 5:71855732-71855754 CTGAATTGTACACTTTAAATGGG - Intergenic
991981752 5:72238990-72239012 TTTATTTATCTACTTTGATTAGG + Intronic
992081585 5:73238788-73238810 TTGGATTGTATACTTTAAATGGG + Intergenic
992140271 5:73789527-73789549 TTGAAGTGTATACTCTAAATGGG + Intronic
992236540 5:74715530-74715552 TTGTTTTGTCTACTGTAACATGG - Exonic
992245713 5:74820295-74820317 CTGAATTGTATATTTTAAATGGG + Intronic
992254069 5:74904242-74904264 TTGAATTGTACACTTAAAATAGG + Intergenic
992348776 5:75908073-75908095 TTGAATTGTGTACTTTAAATGGG - Intergenic
992406926 5:76468070-76468092 CTGAGTTGTTTACTTTAAAAGGG + Intronic
992432249 5:76720539-76720561 ATGAATTGTATACTTTAAAATGG - Intronic
992517479 5:77509804-77509826 TTAAATTGTATACTTTAAATGGG + Intronic
992557141 5:77915126-77915148 TTGAATAGTCTGCTTTAAATGGG + Intergenic
992661459 5:78965587-78965609 TTGAATTGTACACTTTAATTGGG + Intronic
992663008 5:78980191-78980213 TTGAATTGGATACTTTAAAATGG + Intronic
993230046 5:85223781-85223803 TTGAGTTGTATACTTTAAATTGG - Intergenic
993705547 5:91165684-91165706 TTGAAGTGTATACTTTAAATAGG - Intergenic
993813782 5:92515441-92515463 TTGAGTGGTACACTTTAAATAGG + Intergenic
993853996 5:93049508-93049530 TTGACTTATATACTTTAAATGGG + Intergenic
994311458 5:98276900-98276922 TGGATTTCTCTACCTTAATTTGG + Intergenic
994407918 5:99368860-99368882 TTGATGTGTTTAATTTAAACTGG - Intergenic
994595572 5:101829106-101829128 TTGAATTGTGTACTTGTAATGGG - Intergenic
994607324 5:101985242-101985264 TTGTTTTTTCTATTCTAAATTGG - Intergenic
994731877 5:103501296-103501318 TTGAATTGTACACTTTAAGTGGG - Intergenic
994780670 5:104086092-104086114 TTGAGCTGTAGACTTTAAATGGG - Intergenic
994979292 5:106852648-106852670 TTGATATGGCAACTTTAAAGAGG - Intergenic
995570609 5:113476859-113476881 TTGAATTGTATGCTTTAAATGGG + Intronic
995649210 5:114348931-114348953 TTGATTTATACACTTTAAATGGG - Intergenic
995762076 5:115574082-115574104 TTGAGTTGTATACTTGAAATGGG - Intergenic
995906953 5:117136094-117136116 TTGCTTTGTCTTCTTTTACTTGG + Intergenic
996050815 5:118930994-118931016 TTAATTTGTACATTTTAAATTGG + Intronic
996150276 5:120026314-120026336 TTGAAATGTACACTTTAAATAGG - Intergenic
996634048 5:125669195-125669217 ATGACTTGTGTACTTTAAAATGG - Intergenic
996697266 5:126411861-126411883 TTTGTGTGTCTATTTTAAATGGG + Intronic
996857475 5:128025235-128025257 TTGAATTGTGCACTTTCAATGGG + Intergenic
996915594 5:128708388-128708410 TTGATTTGTTTTTTTTAAACTGG + Intronic
996934738 5:128935689-128935711 TTGATTTATCTCCTCAAAATGGG - Intronic
996971040 5:129368163-129368185 TTGAATTGTACACTTTAAATGGG + Intergenic
997291495 5:132739105-132739127 TTGACTTGTACAATTTAAATCGG - Intergenic
997308622 5:132860387-132860409 CTGAATTGTACACTTTAAATGGG + Intergenic
997500608 5:134370861-134370883 TTGTTTTGTTTTCTTTAAACCGG - Intronic
998023121 5:138788461-138788483 CTGCATTGTATACTTTAAATGGG - Intronic
998044800 5:138978098-138978120 TTGAGTTGTACACTTTAAATGGG - Intronic
998171743 5:139876443-139876465 CTGAATTGTATACTTTAAAAGGG + Intronic
998178392 5:139916425-139916447 GTGAATTATATACTTTAAATGGG - Intronic
998178462 5:139917189-139917211 TTGAATTGTACACTTTAAATGGG - Intronic
998248780 5:140534540-140534562 ATGAATTATATACTTTAAATGGG + Intronic
998553010 5:143095243-143095265 TTGAATTGTATACTTTAAAATGG - Intronic
998565891 5:143215493-143215515 TTGAATTGTACATTTTAAATGGG - Intronic
998594309 5:143512471-143512493 TTGAATTGTATATGTTAAATGGG - Intergenic
998654038 5:144154988-144155010 TTGAATTGTACACTTTAAAATGG + Intergenic
998683900 5:144502647-144502669 TTAATATGTATACTTTACATGGG - Intergenic
998777817 5:145622289-145622311 TTTAATTGCATACTTTAAATAGG + Intronic
998794476 5:145803724-145803746 TTTTTTTTTTTACTTTAAATTGG - Intronic
998867913 5:146523778-146523800 TTGAATTGTACACTTTAAATGGG - Intergenic
998959930 5:147474807-147474829 CGGAATTGTATACTTTAAATTGG - Intronic
998966644 5:147548432-147548454 ATGAATTGTATACTTTAAATGGG - Intergenic
999067840 5:148710396-148710418 TTGAATTGTACACTTTAAATGGG + Intergenic
999170808 5:149593195-149593217 TTGATTTGTACACTTTAAATGGG - Intronic
999617394 5:153438753-153438775 TTTAATTGTATACTTTAAATGGG - Intergenic
999716900 5:154368386-154368408 TTGAATTGTATGCTTTAAATGGG + Intronic
999784561 5:154879694-154879716 TGGATTTGTCAGCTTTTAATAGG + Intergenic
999861497 5:155652102-155652124 TTGATTTATGCACTTTAAATGGG + Intergenic
1000102788 5:158032828-158032850 TTGAATTGTATATTTTAAATGGG - Intergenic
1000234926 5:159348851-159348873 TTGAATTGTATACTTTAAATGGG - Intergenic
1000540998 5:162539962-162539984 TTGATTTGGCAGTTTTAAATAGG + Intergenic
1000545649 5:162597989-162598011 ATGAATTGTATACTTTAAATAGG - Intergenic
1000620821 5:163484630-163484652 CTGAATTGTCCACTTTCAATGGG - Intronic
1000842297 5:166234907-166234929 TTCATTTCTCTCCTTTGAATGGG - Intergenic
1000955345 5:167536473-167536495 ATGATTTTTCTACTTTTAAAGGG - Intronic
1001248864 5:170129584-170129606 TTGAATTGTACACTTTAAATAGG + Intergenic
1001296850 5:170504480-170504502 GTGGTTTGTCTACTCTGAATTGG - Intronic
1001447820 5:171799640-171799662 CCGAATTGTCTACTTTAAAATGG + Intergenic
1001621438 5:173088817-173088839 TTGAATTGTCTACTTAATATAGG + Intronic
1001640376 5:173239538-173239560 CTGAACTGTATACTTTAAATGGG - Intergenic
1001643098 5:173259380-173259402 ATGATTTTTCTACTGTAAAATGG - Intergenic
1001801112 5:174545014-174545036 TTCATTTGCCTCCTGTAAATTGG + Intergenic
1002277243 5:178111980-178112002 TTGAATTGTTTGCTTTAAAACGG - Intergenic
1002437245 5:179239055-179239077 TTGAATCGTACACTTTAAATGGG + Intronic
1002810051 6:619884-619906 TTGATTTTTATACATTGAATGGG - Intronic
1003301364 6:4885778-4885800 CTGAATTCTCTAATTTAAATGGG - Intronic
1003338740 6:5199484-5199506 CTGACTTGTATACTTCAAATGGG + Intronic
1003551185 6:7103624-7103646 TTGAATTGTACATTTTAAATGGG - Intergenic
1004200139 6:13540766-13540788 CTGAACTGTGTACTTTAAATGGG + Intergenic
1004764029 6:18704025-18704047 CTGAATTGTTTACTTTAAAACGG - Intergenic
1004835754 6:19529672-19529694 TTCAGTTGTCTACAATAAATTGG - Intergenic
1004958115 6:20753043-20753065 ATGAATTGTACACTTTAAATGGG - Intronic
1005049062 6:21666810-21666832 TTCATTTGTTTATTTTTAATAGG + Intergenic
1005179317 6:23085987-23086009 GTGATTTCTCTGCTTTAAATAGG - Intergenic
1005355115 6:24975108-24975130 TTGAATTATACACTTTAAATTGG + Intronic
1005419296 6:25632473-25632495 TTGAGTTGTATACTTTAAGTGGG - Intergenic
1005474849 6:26197686-26197708 TTGATTTGTCTATTTAAACTTGG + Intergenic
1005782444 6:29206721-29206743 TTGACTTGTACACTTTAAATGGG - Intergenic
1006038232 6:31230806-31230828 TTGAATTGTATACTTTAAATGGG + Intergenic
1006047901 6:31313788-31313810 TTGAATTGTATACTTTAGATGGG + Intronic
1006830622 6:36965766-36965788 TTGAGTTGCATATTTTAAATGGG - Intergenic
1006976468 6:38106887-38106909 TTGATCTGTTTAATTTATATAGG - Intronic
1006997728 6:38277759-38277781 CTGAATTATATACTTTAAATGGG + Intronic
1007048303 6:38799635-38799657 TTGAGATGTACACTTTAAATGGG - Intronic
1007106395 6:39286077-39286099 TTGACTTGTACAATTTAAATGGG - Intergenic
1007364364 6:41380770-41380792 TTGAAGTGTATACTTTAAATGGG + Intergenic
1007502424 6:42308571-42308593 ATGACTTGTATACTTTAAAATGG + Intronic
1007509737 6:42365823-42365845 TCGATTTGTGAACTGTAAATGGG - Intronic
1007548951 6:42714457-42714479 TTGAATTGCATACTTTTAATGGG + Intronic
1007891722 6:45300711-45300733 CTGAATTGTATACTTTAAAATGG + Intronic
1008017085 6:46532646-46532668 TTGAATCTTATACTTTAAATGGG - Intergenic
1008285423 6:49643547-49643569 TTGAATTGTATGCTTCAAATGGG - Intergenic
1008399209 6:51045077-51045099 TTAATTTCTCTTTTTTAAATGGG - Intergenic
1009012460 6:57858684-57858706 TGGATTTTTCTATTTTAACTTGG + Intergenic
1009046006 6:58238007-58238029 TTGAATTGTATACTTTAAGTGGG + Intergenic
1009221816 6:60992319-60992341 TTGAATTGTATACTTTAAGTGGG + Intergenic
1009436952 6:63629810-63629832 TTGAGTGGTACACTTTAAATGGG + Intergenic
1009636629 6:66274125-66274147 TTGAATTTTATACTTTAAAATGG - Intergenic
1009917954 6:70019216-70019238 TTGATTTATCATCTGTAAATGGG + Intronic
1010256817 6:73767620-73767642 TTTAGTTATCTATTTTAAATTGG - Intronic
1010339815 6:74736067-74736089 TTGAGTTGTACACTTAAAATTGG - Intergenic
1010376548 6:75176965-75176987 TTAACTTGTTTTCTTTAAATGGG - Intronic
1010422915 6:75694473-75694495 CTGAATTGTATACTTCAAATGGG - Intronic
1010835003 6:80575073-80575095 TTTAATTGCATACTTTAAATAGG + Intergenic
1011169612 6:84490884-84490906 CTGAATTGTATACTTTAAAAGGG + Intergenic
1011241001 6:85271346-85271368 CTGAATTGTGTACTTTAAAATGG - Intergenic
1011776065 6:90732070-90732092 CTGAATTGTATACTTTAAAATGG - Intergenic
1011842673 6:91521145-91521167 TTGAATTATATACTTTAAATGGG - Intergenic
1012112047 6:95247932-95247954 TGTATTTGTCTACTGAAAATTGG - Intergenic
1012243603 6:96901332-96901354 TTTTTTTTTTTACTTTAAATGGG + Intergenic
1012404068 6:98874441-98874463 TTGTTTTGTTTCCCTTAAATAGG - Exonic
1012515286 6:100052532-100052554 TTTATTTGCCAACTTGAAATTGG + Intergenic
1013563976 6:111337220-111337242 GTGAATTATATACTTTAAATGGG + Intronic
1013754667 6:113446944-113446966 TTGAATTGTATACTTATAATAGG + Intergenic
1014158979 6:118144990-118145012 TTGAATTGTACACTTTAAATGGG - Intronic
1014335854 6:120135470-120135492 TTGTTGTTGCTACTTTAAATGGG - Intergenic
1014489118 6:122040066-122040088 GCGAGTTGTATACTTTAAATGGG + Intergenic
1015064715 6:129010536-129010558 ATCTTTTGCCTACTTTAAATAGG + Intronic
1015650725 6:135456114-135456136 TATATTTGTCTACTATCAATTGG + Intronic
1015935151 6:138401738-138401760 TTGACTAGTACACTTTAAATGGG + Intergenic
1015965957 6:138694951-138694973 TTGAGTTATACACTTTAAATAGG - Intergenic
1016256400 6:142110687-142110709 TTTAATTGTACACTTTAAATGGG + Intergenic
1016400218 6:143672188-143672210 TTGAACTGTTTGCTTTAAATGGG + Intronic
1016456590 6:144237224-144237246 CTGAATTGTATACTTAAAATAGG - Intergenic
1016473119 6:144396578-144396600 TTGAATTGTAAACTTTAATTGGG + Intronic
1016564199 6:145434646-145434668 CTGATTTGTCATCTTTAAAATGG - Intergenic
1016595502 6:145794000-145794022 GTGAATTGTATACTTTAAAATGG - Exonic
1016734581 6:147462946-147462968 TTTAGTTGTATACCTTAAATGGG - Intergenic
1016793172 6:148088345-148088367 TTGAATTGTACACTTTAAAAAGG - Intergenic
1016917172 6:149254678-149254700 ATGATATCTCTACTTTAAACTGG + Intronic
1017155699 6:151320895-151320917 CTGAACTGTGTACTTTAAATGGG - Intronic
1017225738 6:152019205-152019227 TTGAATTATGCACTTTAAATGGG + Intronic
1017440705 6:154462108-154462130 CTGAATTGTTTACTTTAAATAGG - Intronic
1017452693 6:154568613-154568635 TTGAATTGTGCACTTTAAATAGG + Intergenic
1017583400 6:155892875-155892897 CTCAGTTGTATACTTTAAATGGG + Intergenic
1017585243 6:155913606-155913628 TTGAACTGTATACTTTAAAAGGG + Intergenic
1017745207 6:157440928-157440950 CTGAATTGCATACTTTAAATGGG + Intronic
1017976054 6:159358340-159358362 CTGATTTATCTAATTTAAAACGG + Intergenic
1018158614 6:161014779-161014801 TTGATTTGGACACTTTAAATGGG - Intronic
1018376044 6:163213754-163213776 TTTATTTGTAAACTTTAAGTGGG - Intronic
1018715276 6:166527590-166527612 TTGAATTGTACACTTTAAATGGG - Intronic
1019944464 7:4315575-4315597 TTGAATTGTACACTTTAAACAGG + Intergenic
1020230113 7:6311934-6311956 TGGAATTGTTTACTTTAAAATGG + Intergenic
1020474120 7:8575200-8575222 CTGATTTATTTGCTTTAAATTGG - Intronic
1020675680 7:11182312-11182334 TTGAATTGTATACTTTAAATGGG + Intergenic
1020725914 7:11814238-11814260 TTGAATTGTATGCTTTAAATGGG + Intronic
1021194282 7:17657820-17657842 ATGAATTGTGTACTTTAAAAAGG + Intergenic
1021310455 7:19089339-19089361 TTGGTTTGTATGCTTTAAATGGG + Intronic
1021410351 7:20322997-20323019 TCCATTTGTTTTCTTTAAATTGG + Intergenic
1021454702 7:20817464-20817486 CTGAATTGTATACTTTAAATGGG - Intergenic
1021534365 7:21686433-21686455 TTGTTTTGTCTTCTTTTATTAGG + Intronic
1021552742 7:21888920-21888942 TTGAGTTGTATAATTTAAATTGG - Intronic
1021607541 7:22423726-22423748 TTGAATTGTCTATTTAAAATAGG + Intronic
1021707718 7:23384411-23384433 CTGATTTGTACACTTTAAATGGG + Intronic
1021715545 7:23458782-23458804 TTGATTTATCTTCTTTATTTAGG - Intronic
1021808496 7:24379752-24379774 TTGAATTGTACACTTGAAATGGG + Intergenic
1022093961 7:27126584-27126606 TTGTTTTGCCTGCTTCAAATTGG - Intronic
1022338087 7:29442143-29442165 TTGAATTGTATACTTTAAAATGG + Intronic
1022886180 7:34646742-34646764 TTAAGTTGTGTACTTAAAATGGG + Intergenic
1023032310 7:36101012-36101034 TTGAATTGTTCACTTTAAAATGG - Intergenic
1023204945 7:37738703-37738725 TTGAATTGTACACTTAAAATTGG - Intronic
1023288931 7:38648964-38648986 GTGATTTCTACACTTTAAATGGG + Intergenic
1023935357 7:44736235-44736257 TTGAATTGTATACTTTATATAGG + Intergenic
1024014921 7:45305023-45305045 CTGGTTTGTACACTTTAAATTGG + Intergenic
1024097276 7:45992479-45992501 TTCAATTGTCCAATTTAAATGGG - Intergenic
1024519256 7:50289264-50289286 CTGAATTGTATACTTTAAAAAGG + Intergenic
1024668714 7:51570752-51570774 CTGGTTTGTATACTTTAAAAGGG - Intergenic
1025296660 7:57780619-57780641 TTGAATTTTACACTTTAAATGGG + Intergenic
1026050012 7:66938420-66938442 TTGAATTGTATACTTTAAATGGG + Intronic
1026357096 7:69567620-69567642 TTGAATTGTACACTTTAAATGGG + Intergenic
1027193875 7:76014843-76014865 TTGAATTGCACACTTTAAATGGG - Intronic
1027287493 7:76662554-76662576 CTCATTTATCTAATTTAAATTGG + Intergenic
1027345832 7:77258391-77258413 ATGATTTTTCTACTTTACAGTGG + Intronic
1027448908 7:78306907-78306929 TTCACTTGACTATTTTAAATAGG - Intronic
1027585543 7:80054108-80054130 TTAAATTGTATTCTTTAAATGGG - Intergenic
1027622719 7:80510987-80511009 TTGCTTTGTATTCTTTATATAGG + Intronic
1027659237 7:80969230-80969252 TTTATTTATATACTTTTAATTGG + Intergenic
1027787753 7:82601765-82601787 TTGAAATGTATACTTTAAATTGG + Intergenic
1027858014 7:83537717-83537739 TTTAATTGTGCACTTTAAATGGG - Intronic
1028203101 7:87985354-87985376 CTGAATTGTATACTTGAAATGGG - Intronic
1028241290 7:88424246-88424268 TTCAACTGTATACTTTAAATGGG - Intergenic
1028277150 7:88871137-88871159 TTGAATTGTCTCCTGCAAATAGG + Intronic
1028424573 7:90672197-90672219 CTGAATTGTATACTTAAAATGGG - Intronic
1028911969 7:96217850-96217872 TTGAATTATATACTTTAAATGGG + Intronic
1029009949 7:97249282-97249304 TTGATTGGTCTACTGTAAATGGG + Intergenic
1029069654 7:97884755-97884777 TTGATTTGTTCACTTTAAATGGG - Intergenic
1029132823 7:98346097-98346119 GTGAACTGTATACTTTAAATGGG + Intronic
1029166906 7:98598554-98598576 TTGAATTGTACACTTTACATGGG - Intergenic
1029656099 7:101925569-101925591 CTGAACTGTGTACTTTAAATGGG + Intronic
1029792430 7:102858958-102858980 CTGAATTGTATACTTTAAATTGG + Intronic
1030015505 7:105216138-105216160 CTGAATGGTATACTTTAAATGGG + Intronic
1030149253 7:106386548-106386570 TTAATTTTTCTACTTTACAATGG - Intergenic
1030184441 7:106747151-106747173 TTGAATTGTACACTTCAAATGGG + Intergenic
1030294715 7:107911022-107911044 TTGAATTGTACATTTTAAATGGG - Intronic
1030551193 7:110962033-110962055 TTGAACTGTATATTTTAAATGGG + Intronic
1030582591 7:111377009-111377031 TTGAATTGTATACTTCAAATGGG + Intronic
1030665108 7:112268359-112268381 TTAATTTGTTTAATTTGAATAGG + Intronic
1030674705 7:112372402-112372424 TTGAATTGTGTACTTTAAGTGGG + Intergenic
1030693193 7:112556018-112556040 ATGAATTGTACACTTTAAATGGG + Intergenic
1030726210 7:112927878-112927900 TTGGTTTGGCAACTTTAAGTTGG - Intronic
1030914368 7:115294474-115294496 TTGAACTGTACACTTTAAATAGG - Intergenic
1031102251 7:117495902-117495924 TTGGATTGTATGCTTTAAATGGG - Intronic
1031119019 7:117699419-117699441 CTGAACTGTATACTTTAAATGGG - Intronic
1031469749 7:122155102-122155124 TTGAATTGTACACTTTAAATAGG + Intergenic
1031906237 7:127463055-127463077 TTGAATTGTCCACATCAAATAGG + Intergenic
1031915209 7:127556532-127556554 TTTAATTGTACACTTTAAATGGG - Intergenic
1032002605 7:128275221-128275243 TTGAATTTTGTACTTTAAAATGG + Intergenic
1032026927 7:128450498-128450520 TTGAATTGTATCCTTTAAAACGG - Intergenic
1032093471 7:128923782-128923804 TTAAATTGTATACTTTAGATGGG - Intergenic
1032269605 7:130392232-130392254 TTGAGTTGTGCACTTAAAATGGG + Intergenic
1032276653 7:130462601-130462623 TTTATTTCTCTAGTGTAAATAGG + Intergenic
1032341164 7:131074555-131074577 TTGTCTTCTCTAGTTTAAATTGG - Intergenic
1032494543 7:132351267-132351289 TTGACTTGTACTCTTTAAATAGG + Intronic
1032607475 7:133371272-133371294 ATGAATTGTATACTTTCAATAGG - Intronic
1032611068 7:133414794-133414816 TTGAATTGTATACTTTGAATTGG - Intronic
1032665424 7:134031231-134031253 TTGAATTTTACACTTTAAATTGG + Intronic
1033066242 7:138157462-138157484 TTGAATTGTACACCTTAAATGGG + Intergenic
1033092431 7:138398489-138398511 TTGAATTGTTTATTTTAAATGGG + Intergenic
1033290656 7:140079992-140080014 TTGCTTTGTAAACTTTATATAGG - Intergenic
1033487366 7:141804318-141804340 TTGATGTGGCTAGTATAAATAGG + Intergenic
1033862113 7:145641078-145641100 TTGATTTGTGTGGTTTAACTGGG + Intergenic
1034009253 7:147509940-147509962 TTGCTTTGTTTCCTCTAAATCGG + Intronic
1034247376 7:149657292-149657314 TTAAATTGTGTACTTTAAATGGG + Intergenic
1034399164 7:150850116-150850138 TTGAATTATACACTTTAAATGGG - Intronic
1034823091 7:154235054-154235076 TTTAATTGTATGCTTTAAATGGG - Intronic
1035029382 7:155847536-155847558 TTGAATTGTACACATTAAATGGG - Intergenic
1035489395 7:159259683-159259705 TTGGATTGTACACTTTAAATTGG - Intergenic
1035594484 8:844757-844779 TTGAATTGTGTACTTTAAACAGG - Intergenic
1036112782 8:5922515-5922537 TTGAATTGTACACTTAAAATTGG + Intergenic
1036127919 8:6080607-6080629 TTGATTTTTCAACTTTATAATGG + Intergenic
1036248892 8:7144912-7144934 TTGATTTGTTCACTTTAAATTGG + Intergenic
1036251895 8:7169423-7169445 TTGATTTGTTCACTTTAAATGGG - Intergenic
1036365596 8:8118038-8118060 TTGATTTGTTCACTTTAAATGGG + Intergenic
1036417102 8:8560992-8561014 CTGATTTGTACACTTTAAAATGG + Intergenic
1036439525 8:8768122-8768144 TTGAATTGTATACTTTAAAAGGG - Intergenic
1036588436 8:10146643-10146665 TCGGATTGTATACTTTAAATGGG + Intronic
1036885353 8:12548068-12548090 TTGATTTGTTCACTTTAAATGGG - Intergenic
1037285955 8:17300637-17300659 CTGAATTGTATACTTTAAAAGGG - Intronic
1037289892 8:17339296-17339318 TTGAGTCGTATGCTTTAAATGGG - Intronic
1037451273 8:19017433-19017455 TTGATTTGTACTCTTTAAATGGG - Intronic
1038601290 8:28945866-28945888 TTGACCTATATACTTTAAATGGG - Intronic
1038866323 8:31442186-31442208 TTCATTTGTATCCTTTAAAAAGG + Intergenic
1039004102 8:33014386-33014408 TTGATGTGGCTAGTATAAATAGG - Intergenic
1039069721 8:33638610-33638632 CTGAATTGTATACTTTAAAATGG - Intergenic
1039175649 8:34801528-34801550 TTGAATTATCTACTTTACATGGG - Intergenic
1039237700 8:35520522-35520544 TTGAATTGTACATTTTAAATCGG + Intronic
1039383832 8:37112859-37112881 TTGAATTGTATTCTTTAAATGGG - Intergenic
1039523139 8:38189244-38189266 CTGAATTATATACTTTAAATAGG + Intronic
1039708774 8:40034364-40034386 TTGGATTGTACACTTTAAATAGG + Intergenic
1039971860 8:42327072-42327094 TTGAATTGTACACTTTAAATGGG + Intronic
1040730824 8:50444926-50444948 TTTAATTGTACACTTTAAATGGG - Intronic
1040823980 8:51597682-51597704 TGTATGTGTCTACTGTAAATAGG + Intronic
1040886655 8:52270838-52270860 TTGAATTGTGCACTTTAAGTGGG + Intronic
1041199883 8:55442904-55442926 CTGAATTGTACACTTTAAATAGG + Intronic
1041285677 8:56259063-56259085 TTGACCTGTCCACTTTAAGTGGG - Intergenic
1041370527 8:57154973-57154995 TTGAACTGTACACTTTAAATGGG - Intergenic
1041415564 8:57604174-57604196 CTGAATTGTATACTTTACATGGG - Intergenic
1041592342 8:59602764-59602786 TTGAATTTTATACTTTAATTGGG - Intergenic
1041656330 8:60354261-60354283 TTTAATTCTCTATTTTAAATCGG + Intergenic
1041684619 8:60631939-60631961 CTGAATTGTCCACTTTAAAATGG - Intergenic
1041766610 8:61425480-61425502 TTGAATTGTGCACTTTAAATGGG - Intronic
1041806739 8:61859344-61859366 TTGAATTCTATACTTTAGATGGG - Intergenic
1041883844 8:62785550-62785572 CTGAATTGTGCACTTTAAATGGG + Intronic
1042283840 8:67084971-67084993 TTGAATTGTACACTTTAAATAGG - Intronic
1042375332 8:68044595-68044617 GTGATTTGTAGATTTTAAATGGG + Intronic
1042398557 8:68318868-68318890 TTCAATTGTACACTTTAAATAGG - Intronic
1042414519 8:68503867-68503889 TTAATTAGTCTACTGTAAAAGGG + Intronic
1042498226 8:69479863-69479885 TTCATGTGTCCACTTTACATTGG + Intronic
1042721222 8:71828618-71828640 GTAAATTGTCTACTTTAAAATGG - Intronic
1042826260 8:72982955-72982977 TTGATTTGTATCCTTTCATTTGG + Intergenic
1043201574 8:77375801-77375823 TTAAGTTGTGTACTTGAAATAGG - Intergenic
1043329638 8:79099313-79099335 TTGAATTGTGTACCATAAATGGG + Intergenic
1043521048 8:81045648-81045670 CTGAACTGTATACTTTAAATAGG + Intronic
1043973141 8:86555261-86555283 TTGTTATGTCTACTTCAAAAAGG - Intronic
1044766416 8:95580262-95580284 TTTAATTGTATGCTTTAAATGGG + Intergenic
1045071441 8:98508596-98508618 TTGAATTACATACTTTAAATGGG + Intronic
1045076538 8:98575388-98575410 CTGATTTGTATACTTTAAAATGG - Intronic
1045116406 8:98987386-98987408 TTGTTTTGTTTTCTGTAAATGGG - Intergenic
1045136112 8:99220267-99220289 TTGTTTAGGCTAGTTTAAATTGG + Intronic
1045175343 8:99717549-99717571 CTGAATTGTATACTTGAAATAGG - Intronic
1045262939 8:100593147-100593169 TTGAATCGTATACTTTATATGGG + Intronic
1045436176 8:102166941-102166963 TTGAATCGTATACTTTAAAAGGG + Intergenic
1045440949 8:102210126-102210148 TTGAATTGTACATTTTAAATGGG + Intronic
1045554603 8:103203460-103203482 TTTAATTGTATGCTTTAAATGGG - Intronic
1045578741 8:103454974-103454996 CTGAATTGTATACTTTAAACTGG - Intergenic
1045882206 8:107054490-107054512 TTAAATTGTATACTTTAAATAGG + Intergenic
1045986171 8:108251953-108251975 TGGAACTGTATACTTTAAATGGG - Intronic
1046069700 8:109235694-109235716 TTGAATTATACACTTTAAATAGG - Intergenic
1046357414 8:113106900-113106922 TTGAATTGTACACTTTCAATGGG - Intronic
1046541134 8:115585435-115585457 TTCCTTTTTCTACTTAAAATTGG - Intronic
1046579678 8:116076899-116076921 TTGAGTTGCCTAGTTGAAATTGG - Intergenic
1046593308 8:116231269-116231291 CTGAATTGTTTACTTTAAAATGG - Intergenic
1046641073 8:116732326-116732348 TTTATTTGGCTATTTTAGATTGG - Intronic
1046645290 8:116779175-116779197 TGAATTGGTATACTTTAAATGGG + Intronic
1046799217 8:118406579-118406601 CTGAGTTGTCCACTTTAAAATGG - Intronic
1046962717 8:120126969-120126991 TTGAATTGTACACTTTAAATTGG - Intronic
1047265887 8:123308853-123308875 TTTTTTTTTTTACTTTAAATGGG + Intergenic
1047312378 8:123703462-123703484 TTGAATTGAACACTTTAAATGGG + Intronic
1047547814 8:125837103-125837125 TTAATTTTTCTACAATAAATGGG - Intergenic
1047756692 8:127924308-127924330 TTGTGTTGTATACCTTAAATGGG - Intergenic
1048185303 8:132234986-132235008 TTGATTTATATACATTAAAATGG + Intronic
1048188033 8:132262343-132262365 TTGAATTGTACACTTTAAATGGG + Intronic
1048987319 8:139741547-139741569 CTGAATTGTACACTTTAAATGGG - Intronic
1048998356 8:139808155-139808177 CTGAATTGTATACTTCAAATGGG - Intronic
1049105114 8:140607894-140607916 TTGAGTTATGTACTTTAAACCGG + Intronic
1049723608 8:144134178-144134200 TTAAATTGTACACTTTAAATGGG - Intergenic
1049902423 9:181852-181874 TTGACTTGTACACTTTAAATTGG + Intergenic
1049934249 9:485341-485363 TTGAATTGTATACTTTAAATGGG - Intronic
1050069354 9:1793998-1794020 TTGAATTGTATACTTAAAAGAGG - Intergenic
1050133044 9:2432539-2432561 TTGACTTCTACACTTTAAATAGG - Intergenic
1050234997 9:3568406-3568428 GTGAAATGTCTACTTTAAAGAGG - Intergenic
1050383120 9:5052517-5052539 TTAAATTGTATATTTTAAATGGG - Intronic
1050473410 9:6016482-6016504 TTGAGTTGTTAAATTTAAATTGG + Intergenic
1050732717 9:8727877-8727899 TTGAATTGTATACTTTAAATGGG - Intronic
1050809205 9:9722112-9722134 CTGAATTGTATACTTTAAAAGGG - Intronic
1051266007 9:15308852-15308874 TTGAATTGTGTACTTACAATAGG + Intergenic
1051300303 9:15643592-15643614 TTGAATTGTATACTTTTAAAGGG - Intronic
1051309567 9:15755916-15755938 TTGATTTGTATACTTTAAATGGG + Intronic
1051474554 9:17490688-17490710 ATGATTTATATACTTTAAAATGG + Intronic
1051479777 9:17546813-17546835 TTGATTTGTGTATGTTAAACCGG - Intergenic
1051481404 9:17565681-17565703 TTGAATTGTACACATTAAATGGG - Intergenic
1051593686 9:18801947-18801969 TTGAATTGTATACTTTAAGTGGG - Intronic
1051703416 9:19850498-19850520 TTGAATTGTACACTTTAAAAGGG - Intergenic
1052243991 9:26311562-26311584 TTGATTTGTCTTCTTTATAAAGG + Intergenic
1052313132 9:27090228-27090250 CTGAATTTTATACTTTAAATGGG - Intergenic
1052422694 9:28264320-28264342 TTGATCTGTCTATTCTAATTAGG + Intronic
1052512993 9:29445696-29445718 TTGAATTGTACACTTTAAATGGG + Intergenic
1053033591 9:34804750-34804772 CTGAATTGTCTACTTTATGTGGG - Intergenic
1053034444 9:34812203-34812225 TTGTTTTGTCTGTTTTAATTGGG - Intergenic
1053170160 9:35872770-35872792 TTGAATTGTACATTTTAAATGGG - Intergenic
1053170163 9:35872804-35872826 TTGCATTGTACACTTTAAATGGG + Intergenic
1053221048 9:36313472-36313494 CTGAATTGTATACTTTAAACGGG + Intergenic
1053383942 9:37672164-37672186 TTGACTTGTGTACTTTAAATTGG + Intronic
1053387314 9:37703563-37703585 TTGAATTGTACACTTCAAATGGG - Intronic
1053745446 9:41192141-41192163 TTGACTTGTACACTTTAAATTGG + Intronic
1053853111 9:42309726-42309748 CTGAAGTGTATACTTTAAATGGG + Intergenic
1054481824 9:65673072-65673094 TTGACTTGTACACTTTAAATTGG - Intronic
1054682899 9:68239131-68239153 TTGACTTGTACACTTTAAATTGG - Intronic
1054730310 9:68695724-68695746 TTGAATTGTATACTCTAAATAGG - Intergenic
1054782990 9:69183152-69183174 TTGAATTTTATACTTTAAAATGG - Intronic
1054797395 9:69315475-69315497 TTGACTGGTAGACTTTAAATGGG - Intergenic
1055423530 9:76169243-76169265 TTCATTTATCTTGTTTAAATAGG + Intronic
1055498635 9:76881441-76881463 TTGAATTGTTCACTTTAAAATGG - Intronic
1055566168 9:77570253-77570275 TTGAATTGTACACATTAAATGGG - Intronic
1055984315 9:82040676-82040698 CTGAATTGTATACTTTAAATGGG - Intergenic
1056012624 9:82347750-82347772 CTGAATTGTCTACTTTAAAATGG - Intergenic
1056158723 9:83866573-83866595 TTGAGTTATATACTTTAAATTGG - Intronic
1056262951 9:84867144-84867166 CTGAATTGTATACTTTAAATGGG + Intronic
1056319965 9:85426655-85426677 TTGAGTTGTACACTTAAAATGGG + Intergenic
1056351844 9:85757365-85757387 TTGAGTTATATACTTTAAATTGG + Intergenic
1056373689 9:85985705-85985727 TTGAATTGTATACTTTAAATAGG + Intronic
1056445369 9:86660915-86660937 ATGATTTGTCTACTTTACAATGG - Intergenic
1056485199 9:87049622-87049644 TTGACTTGTAAACTTTAAAAGGG + Intergenic
1056674368 9:88661456-88661478 TTGAATTGTACACCTTAAATGGG + Intergenic
1056703196 9:88927595-88927617 TTGGATTGTATACTTTTAATGGG - Intergenic
1056784941 9:89584754-89584776 TAGCTTTGTATACTTTATATAGG - Intergenic
1056825045 9:89871264-89871286 TTGAATTGTTCACTTTAAAATGG + Intergenic
1057012943 9:91622511-91622533 TTGAATTGTACACTTTAAATAGG - Intronic
1057115863 9:92521065-92521087 TTGAATTGTACACTTTAAAATGG + Intronic
1057438926 9:95067720-95067742 CTGAATTGTATACTTTAAAATGG - Intronic
1057574484 9:96231101-96231123 CTGAATTGTATACTTTAAATGGG + Intergenic
1057740478 9:97706938-97706960 TTGAATTGTACACTTTAAATGGG - Intergenic
1057885448 9:98826481-98826503 TTGAATTGTACACTTCAAATGGG - Intronic
1058262206 9:102848638-102848660 TTGATATGTTTTATTTAAATTGG + Intergenic
1058529075 9:105888204-105888226 CTGAATTGTACACTTTAAATGGG - Intergenic
1058584615 9:106493635-106493657 TTGAATTGTACACTTTAAATGGG + Intergenic
1058842233 9:108921080-108921102 TTGAATTGTGTACTTCAAATGGG - Intronic
1059090349 9:111350385-111350407 TTGGATTGTATATTTTAAATGGG - Intergenic
1059242659 9:112820563-112820585 TTGAATTGTACATTTTAAATGGG - Intronic
1059333336 9:113550996-113551018 CTGAATTGTGTACTTTAAATGGG - Intronic
1059355271 9:113694401-113694423 TTGAATTGTATACTTTAAATGGG + Intergenic
1060136845 9:121165260-121165282 TTGAATTGTACACTTTAAATAGG + Intronic
1060290977 9:122302205-122302227 TTGAGTTGTACACTTTCAATGGG - Intronic
1060609932 9:124954630-124954652 CTGAATTGTATACTTTAAATGGG - Intronic
1060763902 9:126279037-126279059 TTGATTTCTCTATTTTATCTTGG - Intergenic
1060840338 9:126788483-126788505 CTGAATTGTATACTTTAAAAGGG + Intergenic
1060955762 9:127638323-127638345 TTGAATTATACACTTTAAATGGG - Intronic
1061030289 9:128077753-128077775 CTGAACTGTATACTTTAAATGGG + Intronic
1061220980 9:129251938-129251960 TTGAGTTGTACACTTTAAAAGGG + Intergenic
1061428174 9:130514267-130514289 TTGAATTGTACACTTAAAATTGG + Intergenic
1062140169 9:134951851-134951873 TTGAGTTGTGTATTTTAAATGGG - Intergenic
1062227707 9:135462773-135462795 TTGAATTGTACACTTTAAATGGG - Intergenic
1062701611 9:137908582-137908604 CTGACTTGTACACTTTAAATGGG - Intronic
1202781576 9_KI270718v1_random:2921-2943 TTGACTTGTACACTTTAAATTGG + Intergenic
1203439907 Un_GL000195v1:179891-179913 TTCATTTCTCTTTTTTAAATAGG - Intergenic
1203625434 Un_KI270750v1:14368-14390 TTTATTTGTGTATTTTATATTGG + Intergenic
1185767097 X:2734309-2734331 TTCATTTTTCTTTTTTAAATTGG + Intronic
1185959372 X:4531666-4531688 CTGAATTGTATACTTTAAAATGG - Intergenic
1185986134 X:4836423-4836445 TTGAATTGTATACTTTAAATGGG - Intergenic
1186473144 X:9836749-9836771 CTGAATTGTATACTTAAAATGGG - Intronic
1186505761 X:10090749-10090771 TTGATTTTTCTGTTTTAACTAGG + Exonic
1186519233 X:10191056-10191078 CTGAATTGTATACTTTAAATGGG - Intronic
1186580263 X:10810043-10810065 TTGAATTGTACACTTTAAAAGGG - Intronic
1186659499 X:11654919-11654941 CTGAATTGTATACTTTAAAAGGG - Intronic
1186692237 X:11990419-11990441 CTGACTTGTTTACTTTAAAATGG + Intergenic
1186699711 X:12077249-12077271 CTGTTTTGTGTACTTTGAATTGG + Intergenic
1186767366 X:12784652-12784674 TTGAATTTTACACTTTAAATGGG - Intergenic
1186807064 X:13150853-13150875 CTGAATTGTATACTTTAAAGTGG - Intergenic
1186874763 X:13806047-13806069 TTGAATTGTATACTTGAAACAGG - Intronic
1186900254 X:14047036-14047058 TTGAATTGTGTATTTTAAATTGG - Intergenic
1186966600 X:14793486-14793508 TAGAATTGTATACTCTAAATGGG + Intergenic
1187024825 X:15424071-15424093 TTGATTTCTTTCTTTTAAATAGG - Intronic
1187068839 X:15867705-15867727 TTGAATTGTATGCTATAAATGGG - Intergenic
1187083602 X:16018336-16018358 TTGAATTGTACACTTTAAATAGG - Intergenic
1187101002 X:16191734-16191756 TTTCTTCGTCTACTTTAATTAGG - Intergenic
1187155504 X:16717374-16717396 TTGAATTGTACACTTTAAACAGG + Intergenic
1187173775 X:16876419-16876441 TTGAATTGTATACTTTATATGGG - Intergenic
1187184592 X:16970559-16970581 CTGAATTGTACACTTTAAATAGG - Intronic
1187194047 X:17064655-17064677 CTGAATTGTATACTTTAAATGGG - Intronic
1187330007 X:18329125-18329147 TTGAATTGTGCACTCTAAATAGG + Intronic
1187330453 X:18334379-18334401 TTGAATTGTATACCTTAAAAGGG + Intronic
1187340066 X:18413183-18413205 ATGAATTGTACACTTTAAATGGG - Intergenic
1187373656 X:18731635-18731657 TTGAATTGCACACTTTAAATGGG - Intronic
1187379710 X:18789453-18789475 TTGAATTATACACTTTAAATGGG - Intronic
1187438558 X:19295434-19295456 TTGAACTGTCCACTTTAAGTGGG - Intergenic
1187516110 X:19972528-19972550 TTGAATTGTATACTTTAAATGGG - Intergenic
1187517063 X:19981990-19982012 CTGAATTGTACACTTTAAATGGG + Intergenic
1187553708 X:20331294-20331316 TTGAGTTGTACACTTTAAATGGG - Intergenic
1187616748 X:21003305-21003327 TTGATTCCTCTCCTTTGAATTGG + Intergenic
1187770050 X:22685434-22685456 CTTAATTATCTACTTTAAATGGG + Intergenic
1187848161 X:23562958-23562980 TTGATTTGTGTATGTTAAACTGG + Intergenic
1187860792 X:23680588-23680610 CTGAATTGTATTCTTTAAATGGG - Intronic
1187877850 X:23818979-23819001 TTGAATTGTACACTTTAAATGGG - Intergenic
1188034319 X:25299616-25299638 CTGAATTGTATACTTTAAAATGG + Intergenic
1188545007 X:31295393-31295415 TTGAATTGTACACCTTAAATGGG - Intronic
1188702068 X:33277384-33277406 TTGAATTGTACACTTTAAAATGG + Intronic
1189073675 X:37891587-37891609 TTGAATTGTACACTTTAAATGGG + Intronic
1189085201 X:38015682-38015704 TTGAATTGTACACTTCAAATGGG - Intronic
1189137513 X:38563941-38563963 CTGAATCGTATACTTTAAATAGG - Intronic
1189175522 X:38953409-38953431 CTGAATTGTATAATTTAAATGGG + Intergenic
1189233906 X:39473229-39473251 TTGATTTGACAACTGTACATCGG - Intergenic
1189393951 X:40603311-40603333 TTGACTTGTACACTTAAAATGGG + Intronic
1189403818 X:40699361-40699383 TTGAATTGTATACTTAAAATGGG + Intronic
1189405548 X:40719757-40719779 CTGAATTGTATACTTTAAGTGGG + Intronic
1189513533 X:41687645-41687667 TTGAATTGTATACTTAAAAATGG + Intronic
1189758660 X:44298550-44298572 TGGAATTGTATACTTAAAATAGG + Intronic
1189904092 X:45740096-45740118 CTGAATTGTACACTTTAAATGGG - Intergenic
1189970793 X:46416362-46416384 TTAAATTGTATACTTGAAATAGG - Intergenic
1190017681 X:46841887-46841909 ATGAATTATATACTTTAAATGGG - Intronic
1190031880 X:46981727-46981749 CTGAATTGTATACTTTAAGTGGG - Intronic
1190108862 X:47576868-47576890 TTGGATTGTCTACTTTAAATGGG + Intronic
1190394765 X:49970293-49970315 TTAAATTGTACACTTTAAATGGG - Intronic
1190395031 X:49973589-49973611 TTGAATTGTACACTTTAAATGGG - Intronic
1190422822 X:50302495-50302517 TTGAATTGTATACTTTAAATGGG - Intronic
1190447741 X:50546486-50546508 TTGAATTGTATACATTCAATGGG - Intergenic
1190894309 X:54601318-54601340 TTAATGTGTGTACTTTAAATGGG + Intergenic
1190924051 X:54885881-54885903 TTGATGTATACACTTTAAATGGG - Intergenic
1190954672 X:55180992-55181014 TTGATATGGCTAGTATAAATAGG + Intronic
1191218673 X:57961383-57961405 TTGAGCTGTGCACTTTAAATAGG - Intergenic
1191907711 X:66111554-66111576 TAGAATTGACCACTTTAAATGGG + Intergenic
1191945793 X:66534041-66534063 CTGATTTGTCTATTTTTACTTGG + Intergenic
1191965580 X:66753509-66753531 TTAAACTGTATACTTTAAATGGG - Intergenic
1192229185 X:69253109-69253131 TTGAGTTATATAGTTTAAATGGG + Intergenic
1192289633 X:69780388-69780410 TTGAATTGTACAATTTAAATAGG - Intronic
1192405301 X:70879256-70879278 TTGAATTGTATACTTGAAATGGG + Intronic
1192420356 X:71024098-71024120 TTGAATTGTATATTTAAAATAGG + Intergenic
1192454222 X:71264154-71264176 CAGAATTGTATACTTTAAATGGG - Intergenic
1192539961 X:71959481-71959503 TTAAATTGTACACTTTAAATGGG - Intergenic
1192595284 X:72400657-72400679 TTGAATTGTATACTATGAATGGG - Intronic
1192604257 X:72498296-72498318 TTGCTTTTTCTAGGTTAAATTGG + Intronic
1192666274 X:73089844-73089866 CTGAATTGTCCACTTTAAAATGG + Intergenic
1192801433 X:74468131-74468153 TTGAATTGTGTACTTTAGTTGGG - Intronic
1192849262 X:74936912-74936934 TTGAATTATATACTTTAAAATGG - Intergenic
1192927055 X:75766258-75766280 TTGAATTATACACTTTAAATAGG + Intergenic
1192960160 X:76121646-76121668 CTGAATTGTATACTTTAAAATGG + Intergenic
1193099217 X:77589377-77589399 TTGAGTTCTACACTTTAAATGGG + Intronic
1193108254 X:77703080-77703102 AGGAATTGTGTACTTTAAATGGG - Intronic
1193109041 X:77708846-77708868 CTGAATTTTATACTTTAAATGGG + Intronic
1193128340 X:77893440-77893462 CTGAATTGTATACTTTAAAATGG - Intronic
1193141484 X:78032009-78032031 TTGAATTGTACACTTTAAAAAGG - Intronic
1193252319 X:79306145-79306167 TTTATTTATTTACATTAAATTGG - Intergenic
1193564241 X:83057620-83057642 GTGAATTGTATACTTTAAAGTGG + Intergenic
1193653335 X:84166879-84166901 TTGAATTGTATATTTTAAATGGG + Intronic
1194287609 X:92029862-92029884 TTGATTTGTCCATTTCAGATGGG + Intronic
1194296922 X:92137561-92137583 TTTAGTTGTGCACTTTAAATGGG - Intronic
1195052518 X:101110134-101110156 TTGATATGTCTACGTTATCTTGG - Intronic
1195070278 X:101272749-101272771 CTGAATTGTATAGTTTAAATGGG + Intronic
1195110578 X:101644917-101644939 TTGAATTTTACACTTTAAATAGG - Intergenic
1195253031 X:103066414-103066436 TTGAATTTTACACTTTAAATGGG - Intergenic
1195309173 X:103614170-103614192 TTGAATTGTGCACTTTACATGGG + Intronic
1195582204 X:106518006-106518028 TTGAACTGTATACTTTAAATGGG - Intergenic
1195783976 X:108496897-108496919 TTGATTTATACATTTTAAATTGG - Intronic
1195790472 X:108579037-108579059 TTGAATTGTACACTTTAAATGGG - Intronic
1195946470 X:110218674-110218696 TTGAATTATATACTTTAAAAGGG - Intronic
1196044003 X:111237503-111237525 TTGACTTTTACACTTTAAATTGG + Intergenic
1196046229 X:111259153-111259175 TTGCTTTGTATACTTAAAACAGG + Intronic
1196055069 X:111346780-111346802 TTGAATTATACACTTTAAATGGG + Intronic
1196064959 X:111453952-111453974 TTGAATTGTACACTGTAAATGGG + Intergenic
1196087796 X:111704793-111704815 TTGAATTGTATACTTTAAGTGGG + Intronic
1196250776 X:113457596-113457618 TTGAACTGTATACTTAAAATAGG + Intergenic
1196254655 X:113502425-113502447 TTTATGTGACTATTTTAAATGGG + Intergenic
1196401321 X:115319792-115319814 TTTATGTGTCTATTATAAATGGG - Intergenic
1196402737 X:115333055-115333077 CTGAGTTGTTTACTTTAAAATGG - Intergenic
1196411202 X:115421063-115421085 TTGAATTGTACATTTTAAATGGG + Intergenic
1196630835 X:117937768-117937790 TTGATTTGTGCACTTTAAATGGG - Intronic
1196643110 X:118086473-118086495 CTGATTTGAATACTTTAAAAAGG + Intronic
1196702842 X:118690505-118690527 CTGAATTGTGTACTTTAAATGGG - Intergenic
1196743905 X:119050608-119050630 TTGACTTGTCCACTTACAATAGG + Intergenic
1196749661 X:119104063-119104085 CTGAATTGTATACTTTAAAATGG + Intronic
1196750250 X:119109610-119109632 TTGAATTATATACTTTAAATGGG - Intronic
1196751748 X:119124371-119124393 TTGAATTGTATACTTTAAATAGG + Intronic
1196928069 X:120653647-120653669 TTGAATTGACTACTTTAGAAGGG - Intergenic
1197181684 X:123543644-123543666 CTGATTTGTCTTATTTACATAGG - Intergenic
1197185706 X:123584851-123584873 CTGATTTGTCAACTGTAAAATGG + Intergenic
1197331795 X:125161751-125161773 TTGAATTTTATACTTTAAATGGG + Intergenic
1197340484 X:125260305-125260327 TTGGTTTGTACATTTTAAATGGG + Intergenic
1197461438 X:126746905-126746927 TTGAATTGTACACTTTAAAATGG - Intergenic
1197494158 X:127156546-127156568 TTAATTTTTCTTCTTTGAATGGG + Intergenic
1197611177 X:128640124-128640146 TTGATTTTTCTACATTTCATGGG - Intergenic
1197661930 X:129183374-129183396 TTTATTTGTTTATTTTAAGTTGG + Intergenic
1197711069 X:129668220-129668242 TTGAATTGTACACTTTAAACTGG - Intergenic
1197795659 X:130295507-130295529 TTGAATTGTACACTTGAAATGGG + Intergenic
1197826112 X:130591972-130591994 CTGAATTGTATACTTTAAATGGG - Intergenic
1198116136 X:133546664-133546686 CTGAATTGTATACTTTAAAATGG + Intronic
1198161160 X:134010114-134010136 TTTATTTGTATAGTTGAAATGGG + Intergenic
1198166804 X:134065587-134065609 TTGAATTGTACATTTTAAATGGG - Intergenic
1198194779 X:134349224-134349246 TTGAATTATACACTTTAAATGGG + Intergenic
1198405964 X:136312695-136312717 TTGAATTGTATACTTTAAATGGG - Intronic
1198412007 X:136380099-136380121 ATGAACTGTATACTTTAAATGGG + Intronic
1198547189 X:137704851-137704873 CTGAATTGTTTACTTTAAAATGG - Intergenic
1198673185 X:139103648-139103670 TTGAATTGTATGCCTTAAATGGG + Intronic
1198711898 X:139513488-139513510 TTAAATTGTACACTTTAAATTGG - Intergenic
1198719463 X:139600250-139600272 CTGAATTGTATACTTTAAAAGGG + Intronic
1198726624 X:139684943-139684965 TTGAATTGCATACTTTAAGTAGG + Intronic
1198728195 X:139699380-139699402 TTGAATTGTACACTTTAAATGGG - Intronic
1198959109 X:142165215-142165237 TTTTTTTGCCTACTTTAAATTGG + Intergenic
1198987077 X:142467027-142467049 CTGATTTGTGTACATTAATTTGG + Intergenic
1199007070 X:142712938-142712960 TTGAACTGTATACTTTAAATGGG - Intergenic
1199010421 X:142752217-142752239 TTCATATGTCTATTTTAAATGGG + Intergenic
1199224856 X:145360820-145360842 TTGAATTGTACACTTTCAATGGG + Intergenic
1199333559 X:146590356-146590378 TTCATTTTTCTTCTTTAAATTGG + Intergenic
1199473690 X:148222830-148222852 TTGAATTGTAGACTTTAAATGGG - Intergenic
1199513187 X:148646259-148646281 CTGAATTGTACACTTTAAATGGG + Intronic
1199617299 X:149667458-149667480 TTGATTTGTACATTTCAAATGGG + Intergenic
1199625344 X:149735791-149735813 TTGATTTGTACATTTCAAATGGG - Intergenic
1199764220 X:150929080-150929102 TTGAATTACTTACTTTAAATTGG + Intergenic
1199828961 X:151529816-151529838 TTGAATTGTATACCTCAAATGGG - Intergenic
1200076044 X:153551698-153551720 TCGAATTATCTACTTTAAATGGG + Intronic
1200182839 X:154161410-154161432 GTGAATTGTACACTTTAAATTGG + Intergenic
1200188493 X:154198524-154198546 GTGAATTGTACACTTTAAATTGG + Intergenic
1200194142 X:154235665-154235687 GTGAATTGTACACTTTAAATTGG + Intergenic
1200199898 X:154273468-154273490 GTGAATTGTACACTTTAAATTGG + Intronic
1200314633 X:155118894-155118916 TAGAACTGTATACTTTAAATTGG + Intronic
1200315320 X:155126537-155126559 TTAAATTGTTCACTTTAAATGGG + Intronic
1200364134 X:155643874-155643896 TTGATCTTTCTACTTAAGATAGG + Intronic
1200605144 Y:5254422-5254444 TTGATTTGTCCATTTCAGATGGG + Intronic
1201010155 Y:9543842-9543864 TTGCTCTTTCTACTTTATATGGG - Intergenic
1201254523 Y:12093872-12093894 TTGCTTTGTATACTTTAAATGGG + Intergenic