ID: 1083323490

View in Genome Browser
Species Human (GRCh38)
Location 11:61861852-61861874
Sequence GAGGCCTAAACCAGAACCCA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 148}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083323490_1083323492 2 Left 1083323490 11:61861852-61861874 CCGTGGGTTCTGGTTTAGGCCTC 0: 1
1: 0
2: 0
3: 17
4: 148
Right 1083323492 11:61861877-61861899 TCATTTCATGTCTGAGCCGCTGG 0: 1
1: 0
2: 0
3: 6
4: 89

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083323490 Original CRISPR GAGGCCTAAACCAGAACCCA CGG (reversed) Intronic
903427924 1:23268329-23268351 GTGGCCAACACCAGGACCCAAGG - Intergenic
904047387 1:27616731-27616753 CAGACGGAAACCAGAACCCAAGG - Intronic
904622541 1:31783927-31783949 GAGGCCTAAGCCAACAACCAGGG + Intergenic
904853461 1:33477230-33477252 GAGGCTTAAAGCACAACTCATGG - Intronic
904874558 1:33644141-33644163 TAGGTCTAAACCATAACCCGGGG - Intronic
905031315 1:34886003-34886025 GAGGCCAGAACCCGGACCCAGGG + Intronic
905471870 1:38198391-38198413 GAAGCCTAAATCAGAAGCCATGG - Intergenic
907241934 1:53085735-53085757 GAGGCCTGAACCAGCACACGCGG + Intergenic
909311636 1:74158006-74158028 GTTGCCTAAACCAGAAACCCTGG + Intronic
912302544 1:108533115-108533137 GATGTCCAAACCAGAACCCTGGG + Intergenic
915345080 1:155193185-155193207 GAGGCTAAAACTAGAGCCCAGGG - Intergenic
917481015 1:175412309-175412331 AAGTCCTAAATCTGAACCCAGGG - Intronic
923542829 1:234900972-234900994 GATGCCTCATCCAGAACCCCTGG + Intergenic
924318864 1:242827129-242827151 GAGGCAGAGACCAGAACTCAGGG - Intergenic
1063973488 10:11397355-11397377 GAGGCCCAGAACAGAACCCCAGG - Intergenic
1064577973 10:16765287-16765309 GAGGCCAAAATCAGAAACTAGGG - Intronic
1065124819 10:22564249-22564271 GAGGCCTAAATCATAAAACAAGG - Intronic
1067012254 10:42725297-42725319 GAGGCCAAAATCAGAAACTAGGG + Intergenic
1067311346 10:45116596-45116618 GAGGCCAAAATCAGAAACTAGGG - Intergenic
1067380574 10:45769496-45769518 CAGGTCTAAAGGAGAACCCAGGG + Exonic
1067888272 10:50110148-50110170 CAGGTCTAAAGGAGAACCCAGGG + Exonic
1068455488 10:57249797-57249819 GAGGCCAAAACCAGCTCCCTCGG + Intergenic
1068934163 10:62619949-62619971 GAGGTCAAAACTAGAGCCCAAGG + Intronic
1070076431 10:73141091-73141113 GATGAGAAAACCAGAACCCAGGG + Intronic
1070355488 10:75635844-75635866 GAGCCCACAACCACAACCCATGG - Intronic
1070984214 10:80674144-80674166 GGGGCCAAAACCAGAGACCAGGG - Intergenic
1072017815 10:91366611-91366633 TATGCCTAAAGCAGAATCCAGGG + Intergenic
1073675124 10:105637840-105637862 TAGGCATAATCCAGAATCCAAGG - Intergenic
1075212490 10:120502931-120502953 GAAGCCCAAACCAGAAGCCTAGG + Intronic
1077619417 11:3706872-3706894 GGGACCTAAACCAGCACCCATGG + Intronic
1078456156 11:11477176-11477198 GTGGCCAAACCCAGAACCCATGG + Intronic
1082107577 11:48236831-48236853 TTGGCCAGAACCAGAACCCAAGG - Intergenic
1083147675 11:60771244-60771266 GAGGCCTCAGCCAGGACCCTGGG - Intronic
1083323490 11:61861852-61861874 GAGGCCTAAACCAGAACCCACGG - Intronic
1083516518 11:63263781-63263803 GAGGCCTAAGTCTGAACACAAGG + Intronic
1084170956 11:67400952-67400974 AAGGTCTAGACCTGAACCCAGGG + Intronic
1088803510 11:113329536-113329558 GAGGCCTTCACCAGAGCCGAAGG - Intronic
1089699987 11:120238936-120238958 GAGGACTAAACAAGAACTAAAGG + Intronic
1092274315 12:7047854-7047876 GGGGGCTCAACCAGAACCCCAGG + Intronic
1095719005 12:45380216-45380238 GAGTCCTAAACACCAACCCATGG + Intronic
1095756686 12:45775392-45775414 GATGCCCTAACCAAAACCCAAGG - Intronic
1096708885 12:53441181-53441203 GTAGCCTAAACCAGAAACCAAGG - Intergenic
1099487343 12:83244864-83244886 GAGAGCTAAACAAGAACTCATGG - Intergenic
1104874502 12:132024630-132024652 GAGCCCTAAACAAAAACACAGGG - Intronic
1104970802 12:132529776-132529798 GAGGCCAAAGGCAGAGCCCAGGG - Intronic
1106154068 13:27135961-27135983 GAATCCTACAGCAGAACCCATGG - Intronic
1106404991 13:29465590-29465612 GAGGCATCACCCAGACCCCAGGG - Intronic
1109199238 13:59412152-59412174 GATGCCTAAGCCAGGACCAAAGG + Intergenic
1109957642 13:69589567-69589589 GAGGCCACAACCAAAAGCCATGG - Intergenic
1112696782 13:101958469-101958491 GAGGCCTAAACCAGACTGAATGG - Intronic
1113720504 13:112552666-112552688 GAAGCCCAAACCAGAACCCTGGG + Intronic
1114409363 14:22486195-22486217 GAGGCCTTTACAAGAACCCTAGG - Intergenic
1118868260 14:69719933-69719955 GAGGCCAACCCCAGAAGCCAGGG - Intergenic
1119948532 14:78720106-78720128 GAGACCTAAAACAGAAACCCTGG - Intronic
1122343563 14:101044401-101044423 GAGGGCGAAGGCAGAACCCAGGG - Intergenic
1125457927 15:39879654-39879676 TTGGCCTTAACCAAAACCCAAGG + Intronic
1125647034 15:41281277-41281299 GTGGTCTAAACAAGAAGCCAGGG - Exonic
1125719837 15:41840049-41840071 AAGGCCTAATCCTGAACCCCAGG - Intronic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1130544341 15:84843495-84843517 GAGTCCCAACCCAAAACCCAGGG - Intronic
1131375632 15:91920752-91920774 GAGGGCATAACCAGAACCCAGGG - Intronic
1132198060 15:99928671-99928693 AAGGCCTGTACCAGAACCCAGGG - Intergenic
1133470000 16:6065852-6065874 GAGGCAAAATCCAGACCCCAAGG - Intronic
1133640080 16:7708324-7708346 AAAGCCTATACCAGAAGCCATGG + Intronic
1133988817 16:10689199-10689221 GAGTCCTAAAACAAACCCCAAGG + Intronic
1137545602 16:49400903-49400925 GAGACCCAAGCCAGAATCCAAGG + Intergenic
1139658832 16:68406164-68406186 GAGGCGTAAACCAGAATAAAAGG + Intronic
1142109034 16:88321445-88321467 GAGGCCTAACACAGCAGCCAAGG - Intergenic
1143862557 17:9901581-9901603 GAGGCCAAAGCCACAGCCCAGGG + Intronic
1144954051 17:19010303-19010325 AAGGCCCACACCAGAAGCCAGGG - Intronic
1146635005 17:34497286-34497308 GAGGCCAGAACCAGAAATCAGGG - Intergenic
1148866730 17:50632719-50632741 GATGCTGAAGCCAGAACCCAAGG + Intergenic
1150120742 17:62599582-62599604 GATGGTGAAACCAGAACCCAGGG - Intronic
1155607205 18:27620297-27620319 GAGGCCTACATCGGAACTCATGG - Intergenic
1156200631 18:34827575-34827597 GAGGCCTAAAACAAAACACAGGG - Exonic
1157211680 18:45748183-45748205 GAGGCTTAAAACAGAGCCCATGG + Intronic
1157475908 18:48023591-48023613 GTGGCCTAAACCAAAACGTATGG - Intergenic
1157683511 18:49625243-49625265 GAGGCTTAGACCAGTACCCCTGG - Intergenic
1162936904 19:13986027-13986049 GAAGCCTAAAGCAGATGCCAGGG - Intronic
1165757843 19:38304547-38304569 GAGGCCTAAGGCAGGACCCTGGG - Intronic
925842971 2:8009578-8009600 GAAGCAGAAACCAGAGCCCACGG - Intergenic
926571174 2:14531402-14531424 GAGACCTAACCCAGAACCATAGG - Intergenic
927908291 2:26877786-26877808 CAGGACAAAACCAGAACCCAAGG - Intronic
928664733 2:33539156-33539178 GATGCCAAAGCCAGACCCCACGG + Exonic
929303816 2:40336466-40336488 GAGGCCTAAACTAGTACAGAGGG + Intronic
932607845 2:73176423-73176445 GAGTCTTAAACCAGATCTCAGGG + Intergenic
934017288 2:87901001-87901023 GAAGACTATTCCAGAACCCATGG - Intergenic
935386131 2:102501738-102501760 GAAGCCAAACCCAGAACCCAAGG + Intronic
938094879 2:128455121-128455143 AGGGGCTGAACCAGAACCCAGGG + Intergenic
942243267 2:173983600-173983622 GATGCCTACACTAGAAACCATGG + Intergenic
946131340 2:217609433-217609455 GAGGACTAGACAAGAATCCAAGG + Intronic
948165949 2:235862801-235862823 GAGGCATAAAGAACAACCCAGGG - Intronic
1173153026 20:40584087-40584109 GAGGCCTCAACCTTAACCCAGGG + Intergenic
1173200108 20:40948261-40948283 GAGTCCTGAAGCAGACCCCAAGG + Intergenic
1175586454 20:60144694-60144716 GAGTCCCAATCCAGACCCCAAGG - Intergenic
1181545058 22:23597986-23598008 CTGACCTAAACCAGAACTCAGGG - Intergenic
1181815252 22:25431896-25431918 CTGACCTAAACCAGAACTCAGGG + Intergenic
1182667602 22:31970889-31970911 GGCGCCTGAACCAAAACCCACGG - Intergenic
1183323123 22:37177161-37177183 GAACCCCAAACCAGGACCCATGG - Intergenic
1185232818 22:49693193-49693215 GAGACCTACACCAGACCCCAGGG - Intergenic
952382127 3:32813635-32813657 GTGGCCTAACCCCCAACCCAAGG + Intergenic
953701446 3:45199012-45199034 GAGGCCTAAACCAGTCCACATGG - Intergenic
954956557 3:54526453-54526475 GAGGCTGAAACCAGTACCCAGGG - Intronic
955532261 3:59886488-59886510 GAGGCCCTCACCAGAAGCCAAGG - Intronic
964353736 3:155829562-155829584 GATTTCTAAACCAGAACCTATGG + Intronic
967886798 3:194338783-194338805 GAGTTCTAGTCCAGAACCCATGG - Intergenic
969470629 4:7385497-7385519 GAGGCCAAGACCAGCCCCCAGGG - Intronic
969877389 4:10145815-10145837 GAGGCATAAAGAGGAACCCATGG - Intergenic
970382459 4:15521839-15521861 CAGGACTAAACCAGAACCTAAGG - Intronic
972325382 4:38010632-38010654 GAAGCCTAAGCCAGAGCCCTGGG + Intronic
975315945 4:72953184-72953206 AAGGCCTCAACCACACCCCAGGG + Intergenic
977458703 4:97297610-97297632 GAGGAGTAAACCAGCAGCCATGG + Intronic
977661027 4:99586341-99586363 CAGGCCTAAAAAAGAATCCATGG - Intronic
982864581 4:160493833-160493855 GAGTCCTGATCCAGACCCCAAGG - Intergenic
984815333 4:183831006-183831028 GAGGACTAACCCAGAATCCCAGG - Intergenic
985571303 5:646936-646958 GACGGCAAAACCAGAACCCCAGG - Intronic
988124504 5:27011528-27011550 GAGGCCTAAATCTGAAAGCAAGG - Intronic
997826431 5:137110891-137110913 GAATCCTAAAGCAGATCCCATGG + Intronic
998476046 5:142422950-142422972 AAGTCATAAACCAGAACCAATGG - Intergenic
999812697 5:155142913-155142935 GAGGCCCTCACCAGAAGCCAAGG - Intergenic
1000423263 5:161061383-161061405 GAGCCCTAATCAATAACCCATGG - Intergenic
1000954185 5:167522955-167522977 GAGGCCAAAAGCAAAAACCAGGG + Intronic
1001766695 5:174254220-174254242 CAGGTCTAAACCAGTACACAAGG + Intergenic
1002972084 6:2033932-2033954 GAGGCATATAAAAGAACCCATGG + Intronic
1003998655 6:11570779-11570801 GAGGGCTACACCAGAACCTTAGG + Intronic
1006922522 6:37636177-37636199 GGTGCCTAACCCAGGACCCAAGG + Exonic
1007088748 6:39168795-39168817 GAGGCCCAAACAAGAACCATGGG - Intergenic
1007759267 6:44123267-44123289 AAGGCCCAGACCAGAGCCCAAGG + Intronic
1009391569 6:63149917-63149939 GATGCCTATCCCAGAGCCCATGG - Intergenic
1010180798 6:73084773-73084795 CAGGCCCACACAAGAACCCAAGG - Intronic
1011396971 6:86920271-86920293 GAGGCTTAAACCATATCCCAAGG + Intergenic
1013036379 6:106388019-106388041 CAGGCATAAACCAGGACACATGG - Intergenic
1014264217 6:119256668-119256690 AAGCCCTGAACCAGAACCTAGGG - Intronic
1015747850 6:136529501-136529523 GAGGCTTAAATCAGTCCCCATGG + Intronic
1017884295 6:158586499-158586521 GAGGTCTAAACCATTGCCCAAGG + Intronic
1018207711 6:161451072-161451094 GAGGACTAGAACAGAACCGATGG + Intronic
1018931486 6:168242961-168242983 GAGGCCTGCACAGGAACCCAGGG - Intergenic
1019135493 6:169905153-169905175 GTGCCCTAAACCAGCATCCAGGG + Intergenic
1021825776 7:24549639-24549661 GACGCATAAACCAAGACCCAGGG + Intergenic
1023389991 7:39700454-39700476 GAAGCCTAAACTAGCACACATGG - Intronic
1024225128 7:47320731-47320753 GATGCCTTAACCCGAACCCCAGG - Intronic
1024641133 7:51329542-51329564 GGGTCCTGAACCAGACCCCAGGG + Intergenic
1032203936 7:129845278-129845300 CAGTCCTAAACCAGAAGCCCTGG - Intronic
1032505544 7:132431737-132431759 GAGGCCAAGACCAGAGCTCATGG - Intronic
1034859958 7:154586419-154586441 GGGGCCAAAACCATAACCCGTGG - Intronic
1035757865 8:2047543-2047565 CAAGCCTAAATCAGAACCCTTGG - Intronic
1037862584 8:22416313-22416335 GGGGCCTACACCACCACCCAAGG - Intronic
1040630946 8:49209765-49209787 GAGGCCTCAGCCAGTACCCTGGG + Intergenic
1044093745 8:88035526-88035548 AGGGCATAAACCAGAACTCATGG - Exonic
1045958659 8:107940474-107940496 GACTCCTAAACCAGAATCTAGGG - Intronic
1047610646 8:126517570-126517592 CAGTCCTAAATCAGAACTCAGGG - Intergenic
1051094514 9:13450904-13450926 GGGGCCTAAACCACAAACAATGG + Intergenic
1051972248 9:22903388-22903410 CAGGCCTAAACTAAGACCCAGGG - Intergenic
1061630015 9:131866417-131866439 GAGGCCTGAGCCAGAAACCTGGG + Intronic
1185919875 X:4079037-4079059 GAGGCAGAAGCCAGAAGCCAAGG - Intergenic
1188970167 X:36605739-36605761 GAGGCCTAAAACATAAACCTGGG - Intergenic
1189221681 X:39377610-39377632 GATTCCTAAAAAAGAACCCAGGG - Intergenic
1192539312 X:71954829-71954851 GGGGCCTAAAGCAGAAGCAAAGG + Intergenic
1193193840 X:78606316-78606338 AAGGCCTTAACCAGCAGCCAGGG + Intergenic
1194004931 X:88479031-88479053 GAGGGCAAAACCAGTGCCCATGG - Intergenic
1194997797 X:100610826-100610848 GGGTCCTAATCCAGATCCCAAGG + Intergenic
1196787261 X:119431847-119431869 GAGGTCTAAACGAGAAGCTAAGG + Intronic
1199127195 X:144137544-144137566 GAAGACTATTCCAGAACCCATGG + Intergenic
1199798614 X:151227687-151227709 GAGGCCTTACCCAGGACCCTGGG - Intergenic
1200253010 X:154563825-154563847 GAGCCCTAACCCAGAACACCAGG - Intronic
1200264757 X:154640590-154640612 GAGCCCTAACCCAGAACACCAGG + Intergenic