ID: 1083323893

View in Genome Browser
Species Human (GRCh38)
Location 11:61863640-61863662
Sequence AGGGCCCGGCCTCATTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083323893 Original CRISPR AGGGCCCGGCCTCATTCCCA GGG (reversed) Intronic
902771765 1:18649279-18649301 GGGGAAAGGCCTCATTCCCATGG - Intronic
902817243 1:18923276-18923298 GGTGCTGGGCCTCATTCCCAAGG - Intronic
903178267 1:21593147-21593169 AGAGGCCGGCCTCAGCCCCAGGG + Intergenic
905226281 1:36481263-36481285 AGGCCCCGGCATCCTTCCCCTGG + Intronic
905230528 1:36512385-36512407 AGGGTGCGGCCTCATTCCTGTGG + Intergenic
911379092 1:97089771-97089793 AGGGCCCCAGATCATTCCCAGGG + Intronic
913106767 1:115621902-115621924 ATTGCCCAGCCTCCTTCCCATGG - Intergenic
918208291 1:182328778-182328800 AGGGCCCAGCCGCATCCCCACGG + Intergenic
919619347 1:199847523-199847545 AGGGCCTGTCTTTATTCCCATGG - Intergenic
919761354 1:201100051-201100073 AGGGCCTGGGCACATTCCCCAGG + Intronic
920232519 1:204480089-204480111 AGGGCCCAGCCCCATTCCAAGGG + Intronic
921089677 1:211830738-211830760 AGGGCCCGGCCGCGTTCGCCCGG + Exonic
1067781346 10:49209549-49209571 AGGCCTCTGCCTCCTTCCCAAGG + Intergenic
1070655698 10:78269702-78269724 GGGGCAGGGCCTCATTCTCAAGG + Intergenic
1070820148 10:79349613-79349635 AGGGCCAGGCCCCAATTCCAGGG - Intronic
1077315858 11:1919140-1919162 GGGGCCTGGCCTCAGTTCCATGG + Intergenic
1079984990 11:27190756-27190778 AAGGCTCTTCCTCATTCCCAAGG + Intergenic
1083262863 11:61532519-61532541 AGTGACCTGCCCCATTCCCATGG - Intronic
1083323893 11:61863640-61863662 AGGGCCCGGCCTCATTCCCAGGG - Intronic
1083328122 11:61883949-61883971 AGAGCCCAGCCTGCTTCCCAGGG - Intronic
1084284640 11:68123008-68123030 AGTGGCCGGCCTCCGTCCCAGGG - Intergenic
1084694175 11:70744103-70744125 AGGCCCCTGCCTCCTACCCAAGG + Intronic
1084764721 11:71300827-71300849 AGGCCCCTGCCTCCTTCCCTGGG - Intergenic
1090401858 11:126454210-126454232 AGTGCTGGGCCTGATTCCCAGGG - Intronic
1092074947 12:5665311-5665333 AGGGCAAGGACCCATTCCCATGG + Intronic
1092524170 12:9299405-9299427 AGGCCCGGGCCTCCTTCCCAAGG - Intergenic
1092543098 12:9432407-9432429 AGGCCCGGGCCTCCTTCCCAAGG + Intergenic
1094509921 12:31090031-31090053 AGGCCCGGGCCTCCTTCCCAAGG - Exonic
1095397420 12:41776619-41776641 AGAGCCCTGCCTCTTTCCCTGGG - Intergenic
1100247914 12:92782845-92782867 AGGGTCCTGCCTCATACCCTGGG + Intronic
1102304342 12:111792957-111792979 CGTGCCCTGCCTCATTCACAGGG + Intronic
1103713480 12:122929732-122929754 TGGTCCCTGCCCCATTCCCAGGG - Exonic
1103918262 12:124386904-124386926 AGGGCCTGCCCACTTTCCCAGGG + Intronic
1105830378 13:24158920-24158942 AGGGCCAGGCCTGTTTCCCAAGG + Intronic
1117759311 14:59010136-59010158 AGGTTCTGGCCTCATGCCCAAGG - Intergenic
1117898488 14:60510576-60510598 AGAGCCCGGCCTCATCCCCCAGG + Intronic
1122906693 14:104804943-104804965 AGGGTCCAGCCTCCTTCCCCAGG - Intergenic
1123587068 15:21770201-21770223 AGGGCAAGGACCCATTCCCATGG - Intergenic
1123623706 15:22212766-22212788 AGGGCAAGGACCCATTCCCATGG - Intergenic
1124719987 15:32103649-32103671 AGGCCCAGGCCTTCTTCCCATGG + Intronic
1126805129 15:52340336-52340358 GGGCCTCGGCCTCATTCTCATGG + Exonic
1127735361 15:61834310-61834332 AGAGCCCGGCCTCTGTCCCGCGG - Intergenic
1128640017 15:69329074-69329096 AGGGCGAAGCCGCATTCCCAGGG - Intronic
1129169915 15:73801397-73801419 TGGGCCCTGCCTCATTCGCTGGG + Intergenic
1129190860 15:73936872-73936894 AGGGCTCGGGCTCTTGCCCAAGG + Intronic
1129606580 15:77028099-77028121 AGGGCCCGGGACCATCCCCACGG - Intronic
1130295283 15:82643338-82643360 CGTGCCCAGCCTCATTCCCAAGG - Intronic
1131862810 15:96672777-96672799 AAGGCCCGACCTCATTACAAGGG + Intergenic
1132696855 16:1205859-1205881 AGAGCCAGGCTTCTTTCCCAGGG + Intronic
1134053830 16:11156731-11156753 AGGGCTGGGCTTGATTCCCAAGG - Intronic
1135685960 16:24498553-24498575 AGGGGCTGGCCCCATTCCCGTGG - Intergenic
1137755039 16:50894389-50894411 AGGGACCAGCCTGATACCCATGG - Intergenic
1138267904 16:55673235-55673257 AGGGCACAGCATCATTCCTAGGG - Intronic
1140909479 16:79438426-79438448 AGCGCCCGGCTTCACTGCCAAGG + Intergenic
1141744982 16:85919635-85919657 TGGGCCCCGCCTCAGACCCATGG - Intronic
1141991920 16:87615472-87615494 AGGGCCCGGCCCCACTCACTGGG - Intronic
1142115155 16:88352653-88352675 AGGGGAAGGGCTCATTCCCACGG - Intergenic
1142646342 17:1316066-1316088 AGGGCCCGGCTGCCCTCCCAGGG + Intergenic
1143600747 17:7944275-7944297 AGGCCCCAGCCCCTTTCCCATGG + Intronic
1143836882 17:9699947-9699969 AGTGCCTCCCCTCATTCCCATGG - Intronic
1143856399 17:9854160-9854182 AGAGCCTGTTCTCATTCCCAAGG + Intronic
1148773299 17:50079189-50079211 AGGGCCAGGACCCATTGCCATGG - Exonic
1150223682 17:63511157-63511179 AGGGGCCTGCCTCTCTCCCATGG - Intronic
1151349439 17:73522948-73522970 AGGGCCTGGCCTCCAGCCCAGGG - Intronic
1151593987 17:75065606-75065628 TGGGCCCCACCTCATTGCCATGG - Exonic
1151654833 17:75490993-75491015 AGGGCTCAGCCTCATTTCCCTGG - Intronic
1152072744 17:78142046-78142068 AGGGCCCGGCCCCCCTCCCAAGG + Exonic
1152117075 17:78394937-78394959 AGGGCCCGACCTCCTGGCCAGGG - Intronic
1152226282 17:79094363-79094385 AGGGCTCGGCCTCTCCCCCAAGG + Intronic
1152739798 17:82013849-82013871 AGGGCCAGCCCTGATGCCCAGGG - Intronic
1153689143 18:7573989-7574011 ATTGCCGGGCCTCATCCCCAGGG - Intronic
1160665818 19:327687-327709 AGGGTCCAGCCCCATGCCCATGG + Intronic
1161007543 19:1944035-1944057 CGGGCCAGGCCTCCTTCACATGG - Intronic
1161155259 19:2729239-2729261 AGGCGCAGGGCTCATTCCCAAGG - Intronic
1161510695 19:4669695-4669717 AGGGCCCGGCCTCACACCCTCGG + Intronic
1162034920 19:7933569-7933591 AGGGCCCACCCTCTTCCCCAGGG - Exonic
1162397151 19:10423894-10423916 AGGGTCCTCCCCCATTCCCAGGG + Intronic
1163323949 19:16591227-16591249 AGGGCCCACCCTCCTTCCCCAGG - Intronic
1165369898 19:35398580-35398602 CTGCCCCTGCCTCATTCCCACGG + Intergenic
1165468079 19:35986911-35986933 AGCGCCCGGCCTGATTAACAAGG + Intergenic
1166644440 19:44520540-44520562 AGGGCCCGGTGTCATTCCGCTGG + Exonic
1167080598 19:47274346-47274368 ACGGCCCCGCCCCATGCCCATGG - Intergenic
1168136647 19:54356326-54356348 AGGTCCAGGAGTCATTCCCAGGG + Intronic
1168139285 19:54374505-54374527 TGGGGCCGGACTCATACCCAGGG - Intergenic
1168146385 19:54421790-54421812 GGGGCCAGGCCTCAGCCCCAGGG - Intronic
1168169802 19:54577677-54577699 AGGGCCCCTCCTTATTCTCAGGG - Intronic
924985913 2:269781-269803 GGGGCCCTGCCTCATTCCTGGGG + Intronic
925922020 2:8644818-8644840 AGGGCCTGGCCCCATTGCCAAGG + Intergenic
925983254 2:9193844-9193866 AGAGCGTGGGCTCATTCCCAAGG + Intergenic
926041824 2:9679708-9679730 AGGACCCTGCCTCATTTCCTGGG + Intergenic
926170632 2:10550632-10550654 AGGGCCCGGCCACACCCCCTGGG + Intergenic
926628809 2:15118537-15118559 AGTGCCAGGCCTCAGTCTCAAGG + Intergenic
927863099 2:26572718-26572740 TGGGGCCGGCCTCCTCCCCACGG + Intronic
929460713 2:42100817-42100839 AGGGGCCGGCCTCTCTCTCAGGG + Intergenic
931759823 2:65406833-65406855 AGGGCCCTGCCTCACTCTCAAGG - Intronic
937707267 2:124935620-124935642 AGGGCCCTGTCCCATTCCCCAGG - Intergenic
942346262 2:175005470-175005492 AGGGTGCGCCCTCATTCCCGCGG + Intergenic
946225620 2:218262748-218262770 GGTGCCCAGCCCCATTCCCAAGG + Exonic
947796055 2:232894703-232894725 AGGGCCCTTCTTCATCCCCAGGG - Intronic
948481299 2:238252131-238252153 AGGCCCCGCCCTCAATCCCAAGG - Intronic
948605379 2:239131569-239131591 AGAGCCAGGGCTCTTTCCCAGGG - Intronic
948635302 2:239330688-239330710 AAGGCCAGGCCTCATGACCAGGG - Intronic
1171391286 20:24803102-24803124 AGGGCCAGGCCTCCTTGCCATGG - Intergenic
1172121904 20:32603432-32603454 GGGGCCTGAGCTCATTCCCAAGG - Intronic
1173348446 20:42222544-42222566 AGGGTCCCACCTCATACCCAGGG + Intronic
1175415324 20:58797098-58797120 AGGGCCCACCCTCATTCCCGAGG + Intergenic
1176033384 20:63024653-63024675 CGGGCCAGGCCTCATTGTCAAGG + Intergenic
1176058483 20:63161312-63161334 AGGGCCCGGCCTCCTGCCTGAGG + Intergenic
1176179089 20:63741234-63741256 GGAGCCAGGCCTCATGCCCAGGG + Intronic
1179475348 21:41639712-41639734 AGTGCCCTGCCCCATTCACAGGG - Intergenic
1182583298 22:31328140-31328162 AGCCCCTGGCCTCATCCCCAAGG + Intronic
1184453588 22:44597030-44597052 AGGGCACAGCCTCCTACCCAGGG + Intergenic
1184727218 22:46354179-46354201 AGGGCATGGCCTCAGTGCCAAGG + Intronic
1185383039 22:50518857-50518879 GGGGCGAGGCCTCACTCCCATGG - Intronic
950124550 3:10503439-10503461 AGGGCCAGCCCGTATTCCCAGGG - Intronic
957231136 3:77517008-77517030 AGAACCAGTCCTCATTCCCATGG + Intronic
957550514 3:81697710-81697732 AGGGTCCTGCCTCATACCCTGGG - Intronic
962866824 3:139454010-139454032 AGGTACCTGCCTCATTCCAAAGG + Intronic
967858801 3:194136835-194136857 AGGGCCCGGCCTTATTCGCTGGG + Intronic
968441275 4:625710-625732 AGGCCGCGGCCACATTCTCAGGG - Exonic
969514989 4:7642163-7642185 AGGACCTGGCCTCCTTGCCAAGG + Intronic
978227333 4:106353032-106353054 AGGGTCCTGCCCCATACCCAGGG - Intergenic
979832263 4:125316942-125316964 AGCGCCCCGCCTCATTGCCGCGG - Exonic
981216581 4:142176649-142176671 AGGCCCTGTCCTCATCCCCAAGG - Intronic
984778528 4:183504694-183504716 GGGCCCCGGCCTTATTCGCAGGG + Intergenic
985558814 5:571121-571143 AGGCCCCGGCCTCCTGCCCCAGG - Intergenic
985725228 5:1512589-1512611 AGGGCACAGCCTCATTCCAAAGG - Intronic
986241695 5:5965598-5965620 GGTGCCAGGCCTCATTCTCATGG + Intergenic
986743898 5:10727524-10727546 AGGGCCCGACTTCATTCTGAGGG + Intronic
987390995 5:17375427-17375449 GGGGTCCAGCCTCATTTCCAAGG + Intergenic
988344575 5:30020938-30020960 AAGGGCTGGTCTCATTCCCACGG - Intergenic
991408856 5:66327503-66327525 AGGGCCCTGCCTTATGCCAAAGG + Intergenic
994688606 5:102988343-102988365 AGGGCCCAGAATCCTTCCCAAGG - Intronic
995794566 5:115927938-115927960 AGGCCCAGGCCACATTCACAGGG - Intergenic
999119425 5:149197893-149197915 ATGCCCAGGCCTCAGTCCCATGG + Intronic
999156959 5:149464908-149464930 AGGGCGGGGGCTGATTCCCAGGG - Intergenic
999232369 5:150069346-150069368 AGGGCCGGGCATCATCCCCCGGG + Intronic
1000105139 5:158052454-158052476 AGGGACCCTCCCCATTCCCAAGG - Intergenic
1002415572 5:179119316-179119338 CGGGCCCGGCCCTATGCCCAAGG + Intronic
1002501267 5:179649230-179649252 AGGGCCAGTGCTCAGTCCCAGGG - Intergenic
1003369876 6:5513822-5513844 AGGGCCCTGCCAGGTTCCCAGGG + Intronic
1003930513 6:10919900-10919922 AAGGGCCGGTCTCACTCCCACGG + Intronic
1005375268 6:25175455-25175477 AGGGCCTCGCCTCATACCCTGGG + Intergenic
1006398777 6:33803798-33803820 AGTGCCCGCGCTGATTCCCAGGG - Intronic
1015999435 6:139028670-139028692 AGGGGCCGCCCACACTCCCAGGG - Exonic
1017644509 6:156526638-156526660 AAGGCCTGGCCACCTTCCCAGGG - Intergenic
1017739368 6:157393294-157393316 TGGGCCCCACCTCATTCCCATGG - Intronic
1018096347 6:160390352-160390374 AGGCACTGGCCTCATTCCCCAGG + Intronic
1018200096 6:161386647-161386669 AAGCCACGGCCCCATTCCCATGG + Intronic
1019271273 7:150377-150399 AGGGCCCGGAGTCCTCCCCAGGG + Intergenic
1019451660 7:1101766-1101788 AGGGGCCGGCCGCAGGCCCAGGG + Intronic
1024629659 7:51236614-51236636 AGTGCCCAGGCTCTTTCCCAAGG - Intronic
1035689009 8:1547616-1547638 AGCGCCCAGCCGCCTTCCCAGGG + Intronic
1038613718 8:29074608-29074630 AGAGACCGGCACCATTCCCAGGG + Intronic
1048542564 8:135355698-135355720 GGGGTCCTGCCTCATACCCAGGG + Intergenic
1053291144 9:36880313-36880335 AGAGCCGGGCCTCAGGCCCAGGG + Intronic
1053538854 9:38952638-38952660 GGAGCCCTGCCCCATTCCCAGGG - Intergenic
1054627286 9:67411281-67411303 GGAGCCCTGCCCCATTCCCAGGG + Intergenic
1054959751 9:70954789-70954811 AGGGCCCGGCCTTCTCCCCGAGG - Intronic
1059331861 9:113540656-113540678 GGGGCCTGGCCCCATTCTCAGGG + Intronic
1060549173 9:124477087-124477109 AGGCCCCGGCCTGATGCCCTAGG + Intronic
1061420690 9:130471627-130471649 AGGGCTCGGCCCCAGCCCCACGG - Intronic
1062614026 9:137387971-137387993 AGGGCCCAGCCTCCTGGCCAGGG - Intronic
1062702913 9:137917448-137917470 AGGGCCTGCCCTCAGGCCCAGGG - Intronic
1194872307 X:99147141-99147163 TAGGCCCAGCCTCAGTCCCATGG - Intergenic
1194881210 X:99253896-99253918 TGGGCCAGGCCTCAGGCCCAGGG - Intergenic
1201568013 Y:15386360-15386382 AGGGCCTGGCTTCATTCCTTGGG - Intergenic