ID: 1083323893

View in Genome Browser
Species Human (GRCh38)
Location 11:61863640-61863662
Sequence AGGGCCCGGCCTCATTCCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 167
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 148}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083323893 Original CRISPR AGGGCCCGGCCTCATTCCCA GGG (reversed) Intronic