ID: 1083327137

View in Genome Browser
Species Human (GRCh38)
Location 11:61878540-61878562
Sequence ACGGGCGCCACCGTCACGTC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 59
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 55}

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083327122_1083327137 18 Left 1083327122 11:61878499-61878521 CCTCCCCACCCACCTCGACGGAT 0: 1
1: 0
2: 0
3: 10
4: 130
Right 1083327137 11:61878540-61878562 ACGGGCGCCACCGTCACGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 55
1083327128_1083327137 6 Left 1083327128 11:61878511-61878533 CCTCGACGGATGACTCCCCCAGG 0: 1
1: 0
2: 0
3: 2
4: 61
Right 1083327137 11:61878540-61878562 ACGGGCGCCACCGTCACGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 55
1083327127_1083327137 9 Left 1083327127 11:61878508-61878530 CCACCTCGACGGATGACTCCCCC 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1083327137 11:61878540-61878562 ACGGGCGCCACCGTCACGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 55
1083327123_1083327137 15 Left 1083327123 11:61878502-61878524 CCCCACCCACCTCGACGGATGAC 0: 1
1: 0
2: 0
3: 5
4: 65
Right 1083327137 11:61878540-61878562 ACGGGCGCCACCGTCACGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 55
1083327121_1083327137 19 Left 1083327121 11:61878498-61878520 CCCTCCCCACCCACCTCGACGGA 0: 1
1: 0
2: 0
3: 21
4: 170
Right 1083327137 11:61878540-61878562 ACGGGCGCCACCGTCACGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 55
1083327134_1083327137 -10 Left 1083327134 11:61878527-61878549 CCCCAGGAGGAAGACGGGCGCCA 0: 1
1: 0
2: 2
3: 7
4: 109
Right 1083327137 11:61878540-61878562 ACGGGCGCCACCGTCACGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 55
1083327133_1083327137 -9 Left 1083327133 11:61878526-61878548 CCCCCAGGAGGAAGACGGGCGCC 0: 1
1: 0
2: 1
3: 15
4: 140
Right 1083327137 11:61878540-61878562 ACGGGCGCCACCGTCACGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 55
1083327119_1083327137 25 Left 1083327119 11:61878492-61878514 CCACGTCCCTCCCCACCCACCTC 0: 1
1: 4
2: 15
3: 179
4: 2050
Right 1083327137 11:61878540-61878562 ACGGGCGCCACCGTCACGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 55
1083327126_1083327137 10 Left 1083327126 11:61878507-61878529 CCCACCTCGACGGATGACTCCCC 0: 1
1: 0
2: 0
3: 1
4: 32
Right 1083327137 11:61878540-61878562 ACGGGCGCCACCGTCACGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 55
1083327125_1083327137 13 Left 1083327125 11:61878504-61878526 CCACCCACCTCGACGGATGACTC 0: 1
1: 0
2: 1
3: 5
4: 41
Right 1083327137 11:61878540-61878562 ACGGGCGCCACCGTCACGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 55
1083327124_1083327137 14 Left 1083327124 11:61878503-61878525 CCCACCCACCTCGACGGATGACT 0: 1
1: 0
2: 0
3: 5
4: 38
Right 1083327137 11:61878540-61878562 ACGGGCGCCACCGTCACGTCTGG 0: 1
1: 0
2: 0
3: 3
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083327137 Original CRISPR ACGGGCGCCACCGTCACGTC TGG Exonic
900538214 1:3189385-3189407 ATGGGTGCCAGCGTCACGCCAGG + Intronic
901265186 1:7904760-7904782 ACAGGCGCCACCACCACGCCCGG - Intergenic
901469074 1:9443142-9443164 ACAGGCACCACCATCACGCCTGG - Intergenic
912576172 1:110674637-110674659 CCGGGCACCACGGTCATGTCGGG + Exonic
1075647205 10:124104455-124104477 ACAGGCTCCACCAGCACGTCGGG + Intergenic
1075993241 10:126855858-126855880 ACAGGCGCCACCACCACGCCGGG - Intergenic
1079794107 11:24777134-24777156 ACAGGCGCCACCACCACGCCTGG + Intronic
1083327137 11:61878540-61878562 ACGGGCGCCACCGTCACGTCTGG + Exonic
1083788333 11:64967262-64967284 ACAGGCGCCACCACCACGCCCGG - Intronic
1084909197 11:72373816-72373838 ACTGGCGCCACCACCACGCCCGG - Intronic
1085556173 11:77424125-77424147 ATGGGTACCACCGTCACTTCTGG + Intronic
1085558883 11:77451739-77451761 ACAGGCGCCACCACCACGCCCGG + Intronic
1087193781 11:95284354-95284376 ACAGGGGCCACCTTCACATCCGG + Intergenic
1089441222 11:118518934-118518956 ACGGGCGCCGCCACCACGCCTGG - Intronic
1101181005 12:102217932-102217954 ACGGGCGCCGCCACCACGCCCGG - Intergenic
1101266067 12:103088958-103088980 ACAGGCGCCACCACCACGCCCGG - Intergenic
1103544709 12:121691819-121691841 ACAGGCGCCACCATCACGCCTGG + Intergenic
1104294231 12:127497172-127497194 ACAAGCGCCACCCTCACCTCTGG + Intergenic
1104667755 12:130659426-130659448 ACAGGCGCCACCACCACGCCTGG - Intronic
1106874667 13:34058730-34058752 ACAGGCGCCGCCACCACGTCCGG + Intergenic
1125344328 15:38703730-38703752 ACAGGCGCCACCACCACGCCTGG + Intergenic
1125509029 15:40282999-40283021 GCGGGCGCCACCGTCGCTGCGGG - Intronic
1125594727 15:40877270-40877292 ACAGGCGCCACCACCACGCCCGG - Intergenic
1142177461 16:88651658-88651680 AGGGACGGCCCCGTCACGTCCGG + Intergenic
1142928618 17:3262840-3262862 ACAGGCGCCACCACCACGCCAGG + Intergenic
1148685163 17:49496763-49496785 CCGGGCGCCCCCGTCTCGTTAGG - Intronic
1148879789 17:50717193-50717215 ACAGGCGCCACCACCACGCCTGG + Intergenic
1151336417 17:73442481-73442503 ACAGGTGCCACCACCACGTCCGG + Intronic
1162998734 19:14352675-14352697 ACGGCCACCACAGTCAGGTCTGG - Intergenic
1165316573 19:35059908-35059930 GCGGGCGCCAATGGCACGTCGGG + Exonic
1167116465 19:47491907-47491929 ACGTGCTCCTCCCTCACGTCTGG - Intronic
1168577437 19:57525041-57525063 ACAGGCGCCACCACCACGCCCGG + Intergenic
928143492 2:28751461-28751483 AAGGGCGCAACCACCACGTCTGG + Intergenic
933755957 2:85638678-85638700 ACAGGCGCCACCACCACGCCCGG + Intronic
937891247 2:126940565-126940587 AAGGGCCCCACCATCAAGTCTGG - Intergenic
1174250903 20:49218872-49218894 ACAGGCGCCACCACCACGCCCGG - Intergenic
1180610216 22:17091534-17091556 ACAGGCGCCACCACCACGCCTGG - Intronic
1182728502 22:32468302-32468324 ACAGGCGCCACCACCACGCCTGG + Intergenic
957197617 3:77090493-77090515 ACAGGCGCCACCACCACGCCCGG + Intronic
963927778 3:150969466-150969488 ACAGGCGCCCCCGCCACGCCCGG + Intronic
965583669 3:170295701-170295723 ACAGGCGCCACCATCACGCTCGG - Intronic
967838770 3:193986575-193986597 ACGGGCACCACCACCACGCCTGG - Intergenic
969171818 4:5370015-5370037 ACAGGCGCCACCATCACGCCCGG + Intronic
975381024 4:73700905-73700927 ACGGGGGCCACCACAACGTCTGG + Intergenic
980633142 4:135464336-135464358 ACAGGTGCCACCACCACGTCAGG - Intergenic
984218567 4:176944855-176944877 ACAGGCGCCACCACCACGCCTGG + Intergenic
1012764578 6:103350529-103350551 ACAGGCGCCACCACCACGTCCGG + Intergenic
1013525288 6:110968436-110968458 ACGGGCGCCCCCACCACGCCTGG - Intergenic
1021402011 7:20220093-20220115 ACGGCCACCACAGTCACATCCGG - Intergenic
1026543507 7:71301143-71301165 ACAGGCGGCACCATCACGTGTGG - Intronic
1026860669 7:73785909-73785931 ACAGGCGCCACCATTACGCCTGG + Intergenic
1034306944 7:150050960-150050982 ACAGGCGCCACCATCACACCTGG - Intergenic
1034799906 7:154049727-154049749 ACAGGCGCCACCATCACACCTGG + Intronic
1035793027 8:2325412-2325434 ACAGGCGCCACCGCCTCGCCAGG - Intergenic
1035799777 8:2396293-2396315 ACAGGCGCCACCGCCTCGCCAGG + Intergenic
1037494459 8:19425197-19425219 ACAGGCGCCACCACCACGCCTGG - Intronic
1056156172 9:83839799-83839821 ACAGGCGCCACCATCAGGCCCGG - Intronic
1061693664 9:132355150-132355172 CCGGGCGCTGGCGTCACGTCCGG + Intergenic
1190312252 X:49124812-49124834 ACAGGCGCCACCACCACGCCCGG - Intergenic