ID: 1083327413

View in Genome Browser
Species Human (GRCh38)
Location 11:61879817-61879839
Sequence GTGCCTGGCTAAACCAGATC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 76}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083327410_1083327413 -6 Left 1083327410 11:61879800-61879822 CCTCGGGATCCAAACGGGTGCCT 0: 1
1: 0
2: 0
3: 3
4: 33
Right 1083327413 11:61879817-61879839 GTGCCTGGCTAAACCAGATCTGG 0: 1
1: 0
2: 2
3: 8
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083327413 Original CRISPR GTGCCTGGCTAAACCAGATC TGG Intronic
901266109 1:7912059-7912081 GAGCCTGTCAAACCCAGATCAGG - Intergenic
901523294 1:9802306-9802328 GGGCCTGGCTAAATTATATCAGG + Intronic
905792506 1:40797757-40797779 GGGCCTGGCTCAACCTGACCCGG + Intronic
907267828 1:53273575-53273597 GTCCCTGGCTACTCCAAATCTGG + Intronic
912378568 1:109233334-109233356 GTGGCTGGCTATACCATATTAGG + Intronic
913519617 1:119632268-119632290 GTGCCTGGCCAAGCCAGCTGAGG - Intronic
913970104 1:143408446-143408468 ATGCCTGGCTAACCCAGATGCGG + Intergenic
914064478 1:144234043-144234065 ATGCCTGGCTAACCCAGATGCGG + Intergenic
914114672 1:144732311-144732333 ATGCCTGGCTAACCCAGATGCGG - Intergenic
918148560 1:181779308-181779330 GGGCCTGGCAAAGCCAGACCAGG - Intronic
923102276 1:230826177-230826199 GTGCCTGGCAGCACCAGAGCAGG - Intergenic
1065579240 10:27154861-27154883 TTGCCTGACTGAAACAGATCAGG - Intronic
1068243843 10:54339624-54339646 TTGCCTGGCCAAACTTGATCAGG + Intronic
1068954220 10:62806516-62806538 CTGCCTGAGTAAACCAGATGTGG - Exonic
1072240696 10:93493068-93493090 GTGGCTGGCAAAATCAGATGTGG + Intergenic
1073161312 10:101398900-101398922 TTGCCTGGCTAACCGAAATCTGG + Intronic
1078955752 11:16192906-16192928 TTGCCTGCCTTATCCAGATCTGG - Intronic
1081467915 11:43341356-43341378 GTGAATGGCTAAACAAGATGTGG + Intronic
1083327413 11:61879817-61879839 GTGCCTGGCTAAACCAGATCTGG + Intronic
1087505479 11:99015137-99015159 GTGCCAGGCTGAACCTGATATGG + Intergenic
1089002548 11:115064072-115064094 CTGGCTGGCTGAGCCAGATCAGG - Intergenic
1090003446 11:122980944-122980966 GTGCCTGGAAAAAAGAGATCTGG + Intronic
1110278422 13:73664195-73664217 GGACCTGGGTAAACCATATCTGG - Intergenic
1112097981 13:96156363-96156385 CTGCCTCACTAAACCATATCTGG - Intronic
1114184681 14:20391503-20391525 TTGCCTGGGAAAACCAGCTCTGG + Intronic
1117051535 14:51865256-51865278 GTGCCTGTCTTTACTAGATCTGG + Intronic
1118784751 14:69037019-69037041 GGGGCTGGCTAACCTAGATCAGG + Intergenic
1126468652 15:48983762-48983784 GTCCCTGGCTAAGCCAACTCTGG + Intergenic
1131047874 15:89327410-89327432 GAGGCTTGCTAAACCAGCTCAGG - Intronic
1135972896 16:27085147-27085169 GTGCCTGGCTAATGCAGGTGAGG - Intergenic
1141159173 16:81617696-81617718 GTGCCTGGCTGGGCCAGAGCTGG - Intronic
1150656750 17:67044515-67044537 GTGCCTGGCTGAGCCAGAGTGGG - Intergenic
1155209036 18:23585526-23585548 GTGACTCGTTAAACCAAATCAGG - Intronic
1159668202 18:71189994-71190016 GTGCCTGGGTGAACCAGACCTGG + Intergenic
1161724096 19:5918483-5918505 GTGGCTGGCTCACCGAGATCAGG + Exonic
1163604313 19:18265775-18265797 GTGCCTGGCTCAACCACATCCGG - Exonic
1166483756 19:43195456-43195478 GTGCCTCCCTAAAACAGAGCAGG - Intronic
928327372 2:30330159-30330181 GGACATGGCTAAACCATATCAGG + Intergenic
928855848 2:35801676-35801698 GCGCCTTGCTAAGCCAGAGCTGG - Intergenic
931999625 2:67872734-67872756 GTCTCTTGCTAAACCAGATTTGG + Intergenic
934174795 2:89569355-89569377 ATGCCTGACTAACCCAGATGGGG + Intergenic
934285112 2:91643707-91643729 ATGCCTGACTAACCCAGATGGGG + Intergenic
939829498 2:147054715-147054737 GTGAATGTCTAAACCACATCTGG - Intergenic
943603493 2:189949377-189949399 GTGCCTGGCTAATAGAGATGAGG - Intronic
1168953318 20:1817382-1817404 CTGCCTGGCTGACCCAGAGCGGG - Intergenic
1171012166 20:21514705-21514727 GTGGTTGCCTAAACAAGATCCGG + Intergenic
1172650644 20:36499408-36499430 GTGCCCGGCTTAACCTGGTCCGG + Intronic
1173254474 20:41384295-41384317 GTGCCTGGCTAAACAAACTGTGG + Intergenic
1174439797 20:50541564-50541586 GAGCCTGGGCAAACCAGACCCGG + Intronic
1178040011 21:28629822-28629844 GTGGCTGCATAAACCAGATCAGG + Intergenic
1181814569 22:25428579-25428601 GTGAATGGCTAAACGAGATCGGG - Intergenic
1182700050 22:32229388-32229410 CTGCCTTGCTAAACCAGAGAGGG + Intronic
952704650 3:36365168-36365190 TTCCCTGGCTGAACCACATCTGG + Intergenic
963354989 3:144200201-144200223 GGGCCTGACTAAACCAGATCAGG - Intergenic
964076952 3:152703456-152703478 GTGACTTGCTCAACCACATCTGG - Intergenic
964978645 3:162650070-162650092 GAGCCTGGCCTAACCCGATCAGG - Intergenic
975506096 4:75139828-75139850 GTGCCTGGATACACAAGATAAGG + Intergenic
975910865 4:79265453-79265475 GCCCCTGGCTCAACCTGATCTGG + Intronic
975984517 4:80190122-80190144 CTGCCCTGCTAAACGAGATCAGG + Intronic
985478983 5:95487-95509 CTGCCCGGGTAAACGAGATCTGG - Intergenic
988981066 5:36569830-36569852 CTGCCTGGCTCAACCAGCTATGG - Intergenic
990369494 5:55102867-55102889 GTGCCTGGCTAAACATTATAAGG - Intronic
993903838 5:93602553-93602575 GCGCCTGGCTCAACCCGGTCTGG + Intergenic
1001185473 5:169567421-169567443 GTGCTTGGTTTAACCAGATTTGG - Intergenic
1001199450 5:169702775-169702797 TTGCCTGAATAAACCAGCTCAGG - Intronic
1013534484 6:111051464-111051486 GAGCCTGGCCAAACCACACCTGG - Intergenic
1017427909 6:154341564-154341586 TTGCCAGGCTAAATCAGTTCCGG + Intronic
1034015618 7:147582185-147582207 GTGCCAGTGTAAACCAGTTCAGG - Intronic
1034295836 7:149971761-149971783 GTGCCTGTAGAAACCAGATCAGG - Intergenic
1034810217 7:154125143-154125165 GTGCCTGTAGAAACCAGATCAGG + Intronic
1038094837 8:24296691-24296713 TTGACTAGCAAAACCAGATCAGG - Intronic
1042169135 8:65975408-65975430 GTGCCTGCTTAAACCACAACTGG - Intergenic
1045192710 8:99898499-99898521 GTGCCTTCTTAAACCACATCCGG - Intergenic
1053183003 9:35990420-35990442 ATGCTTGGTTAAACCAGGTCAGG + Intergenic
1056027681 9:82516341-82516363 GAGCCTGGCTAAACGGGATTGGG - Intergenic
1059340939 9:113597201-113597223 GGCCCTGGCCAAGCCAGATCTGG + Exonic
1186572861 X:10734566-10734588 GTGAATGGCTAAACCAGTTGTGG + Intronic
1189554591 X:42128747-42128769 GTTCATGGCTAAACCAAAACTGG + Intergenic
1191884339 X:65873781-65873803 GTGCCTTGGCTAACCAGATCTGG + Intergenic
1195978407 X:110552744-110552766 TTGCCTGGCTACTCCAAATCTGG + Intergenic
1200208399 X:154333900-154333922 GTTCCTGACTAATCCAGAACTGG - Intergenic
1201781046 Y:17723284-17723306 GTGCCTGGCTCACCCATAGCAGG - Intergenic
1201820507 Y:18182706-18182728 GTGCCTGGCTCACCCATAGCAGG + Intergenic
1202168020 Y:22013334-22013356 GTGCCTGACTAAGCCATATGTGG - Intergenic
1202223341 Y:22573034-22573056 GTGCCTGACTAAGCCATATGTGG + Intergenic
1202319774 Y:23622626-23622648 GTGCCTGACTAAGCCATATGTGG - Intergenic
1202550994 Y:26047430-26047452 GTGCCTGACTAAGCCATATGTGG + Intergenic