ID: 1083328054

View in Genome Browser
Species Human (GRCh38)
Location 11:61883674-61883696
Sequence AGGTGGCCCCAGAACTGACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 159
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 145}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083328054_1083328060 8 Left 1083328054 11:61883674-61883696 CCATGTCAGTTCTGGGGCCACCT 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1083328060 11:61883705-61883727 TGAGGATCTTGGGTCCAGATTGG 0: 1
1: 0
2: 0
3: 9
4: 129
1083328054_1083328055 -10 Left 1083328054 11:61883674-61883696 CCATGTCAGTTCTGGGGCCACCT 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1083328055 11:61883687-61883709 GGGGCCACCTTATTGAGCTGAGG 0: 1
1: 0
2: 1
3: 10
4: 77
1083328054_1083328058 -3 Left 1083328054 11:61883674-61883696 CCATGTCAGTTCTGGGGCCACCT 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1083328058 11:61883694-61883716 CCTTATTGAGCTGAGGATCTTGG 0: 1
1: 1
2: 0
3: 8
4: 135
1083328054_1083328059 -2 Left 1083328054 11:61883674-61883696 CCATGTCAGTTCTGGGGCCACCT 0: 1
1: 0
2: 0
3: 13
4: 145
Right 1083328059 11:61883695-61883717 CTTATTGAGCTGAGGATCTTGGG 0: 1
1: 0
2: 1
3: 3
4: 146

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083328054 Original CRISPR AGGTGGCCCCAGAACTGACA TGG (reversed) Intronic
900164028 1:1237605-1237627 AGGTGGCCGCAGATCTTCCAGGG + Intergenic
900571930 1:3362887-3362909 AGCTGGCCCCAGAACTGTTCGGG + Intronic
900601988 1:3506638-3506660 AGGTGGCCCCAGAGCTAGAAAGG + Intronic
901816913 1:11799546-11799568 AGATGGCCTCAGACCTCACAAGG - Intronic
902109672 1:14067755-14067777 TGGTTGCCCCAGAACTTTCAAGG - Intergenic
903237030 1:21956799-21956821 AGCTGTCCCCTGAACTGACCTGG - Intergenic
903968226 1:27102730-27102752 AGGTGGTCCAGGAACTGAAAGGG + Exonic
909181740 1:72433023-72433045 AGGCTGCCACAGAACTGCCACGG + Intergenic
915745174 1:158150501-158150523 AGGTGGAACCAGAAGAGACAAGG - Intergenic
918151974 1:181805202-181805224 GGATGGCCCCAAAACTGAAAAGG + Intronic
918977887 1:191513878-191513900 AAGTGGGCCCTGAACAGACAGGG + Intergenic
922067005 1:222154124-222154146 GGGTGGCGCCAGGCCTGACACGG - Intergenic
922236958 1:223729128-223729150 AGGTGGCCCCAGAATTGTAATGG + Intronic
923371932 1:233323116-233323138 AGGTGGCACCAGAACTCATTTGG + Intergenic
1063462178 10:6221834-6221856 AGGAGCCCCCAGAACCCACACGG - Intronic
1071564602 10:86665266-86665288 AGGTGTCTCCAGACCTGACCTGG + Intronic
1072436716 10:95420903-95420925 AGGTGTTCCCCGAACTCACAAGG - Intronic
1073986457 10:109215311-109215333 AGATGTTCCCAGAACTGTCATGG + Intergenic
1074130374 10:110568135-110568157 GGGTGGCCCCAGAGCTGGCGGGG + Intronic
1076162553 10:128256455-128256477 AGCTGGCCCCAGAAAAGTCAGGG - Intergenic
1076830394 10:132991546-132991568 CTGTGGCCCCAGGACTGACCAGG + Intergenic
1076872284 10:133199967-133199989 AGGTGGCCCCAGACCCCACAGGG + Intronic
1077309255 11:1881226-1881248 AGGCTGCCCCAGAACTGACGGGG + Intronic
1077341678 11:2029035-2029057 AGGTGGCTCCAGAGCTGGCTGGG - Intergenic
1077415883 11:2424079-2424101 AGGTAGCCCCAGGTCGGACAGGG - Intergenic
1078605250 11:12769370-12769392 AGGTAGTGGCAGAACTGACAAGG + Intronic
1078921542 11:15835533-15835555 AGATAGACCCAGAACTCACATGG - Intergenic
1083233104 11:61335575-61335597 AGGTTGCCCTAGAAAGGACATGG - Intronic
1083328054 11:61883674-61883696 AGGTGGCCCCAGAACTGACATGG - Intronic
1084162458 11:67357144-67357166 AGGTGACCACTGAACTGGCAAGG + Intronic
1085032194 11:73279522-73279544 AGGTAGACCTAGATCTGACATGG + Intronic
1088397994 11:109389832-109389854 AGGTGGCCACAGAAATCACTTGG + Intergenic
1089067210 11:115670895-115670917 AGGGAGCCCTAGAGCTGACAAGG - Intergenic
1089133456 11:116230685-116230707 AGGTAGTCCCAGAGCTGAAAGGG - Intergenic
1202824664 11_KI270721v1_random:84224-84246 AGGTGGCTCCAGAGCTGGCTGGG - Intergenic
1094375961 12:29787592-29787614 AGCTGGCCCAACACCTGACAGGG + Intergenic
1096370018 12:51061497-51061519 AGGTAGCACCAGAAGTGAGATGG + Exonic
1104166035 12:126230435-126230457 AGGTGAACACAGAACTGAGAGGG + Intergenic
1109153521 13:58874515-58874537 AGGTTTCCCCAGAACTGTCATGG + Intergenic
1116691504 14:48112461-48112483 AGGTGGCTCCAAAACTTACATGG - Intergenic
1116864696 14:50022206-50022228 AGCTGGCCCCAGATCTATCAAGG - Intergenic
1117845854 14:59911349-59911371 AGGTAGCCCCAGAATTCACAGGG - Intergenic
1122592544 14:102865221-102865243 AGGTGGCCACAGGACTGAACTGG - Intronic
1124118994 15:26872407-26872429 AGGGAGCCCAAGAAGTGACAGGG - Intronic
1127973322 15:63979103-63979125 AGGAGGCCCCAGAGCAGTCAGGG + Intronic
1129799349 15:78401892-78401914 AGGTGGTCCCAGTACAGAAAAGG + Intergenic
1130787433 15:87115322-87115344 TCGTGGCCCTAGAACTGAGATGG - Intergenic
1131881736 15:96869263-96869285 AGGTGAGCCTAGTACTGACATGG + Intergenic
1132295829 15:100733573-100733595 AGGTGGCCATAGAACTAACAAGG + Intergenic
1141293709 16:82746409-82746431 AGGTGTCCCCATTACTGGCAGGG + Intronic
1141947814 16:87322604-87322626 AGGTAGCCCCAGAACTGCAGGGG + Intronic
1143139478 17:4733195-4733217 AGATGGACCCAGAGCTGAGAGGG + Exonic
1143764687 17:9129823-9129845 TGGTGGTCCCAGACCTGGCAAGG + Intronic
1144621141 17:16819213-16819235 TGGTGCACCCAGAACTGGCAGGG - Intergenic
1150124858 17:62629080-62629102 AGGTGGGCCCAGAATTGCCCCGG - Intronic
1150566215 17:66343349-66343371 ATATGGCCCCAGAATAGACAAGG - Intronic
1155699696 18:28728435-28728457 AGAAGGCTCCAGAACTGCCAGGG - Intergenic
1156481039 18:37436583-37436605 AGGTGGCCCCAGCACTTCCCTGG + Intronic
1158870528 18:61683075-61683097 AAGTGACCCCCAAACTGACAAGG - Intergenic
1160591370 18:79946611-79946633 AGGGTGCCCCATAACTGACCAGG + Intronic
1161588247 19:5117197-5117219 AGAGGGCCCCAGAACTGTCCTGG - Intronic
1161932533 19:7350244-7350266 AGGTGGCCCCAGAACCAGGAGGG + Intronic
1162533261 19:11247944-11247966 AGGTGGCCACATAGGTGACAGGG + Intronic
1163385113 19:16995154-16995176 AGGTGGCTCCAACACTGGCATGG + Intronic
927380216 2:22470963-22470985 AGTTGGGCCCAGGACTGGCATGG - Intergenic
931427447 2:62184142-62184164 AGGTGGCACTAAAACTAACATGG - Intergenic
932657882 2:73626138-73626160 AGGTGGCTCTAAAACTCACAAGG - Intergenic
935271852 2:101441459-101441481 AGGTGGCCCAAGACATCACATGG - Intronic
937204748 2:120228297-120228319 AGGTGACACCTGAACTGAGAAGG - Intergenic
937320680 2:120958894-120958916 ATGTGCTCCCAGACCTGACAGGG - Intronic
937770798 2:125718813-125718835 AGTTGCCCCCAGAGTTGACATGG - Intergenic
937882415 2:126878292-126878314 ACGTGGCCCCAGACCTGGCCTGG - Intergenic
938404792 2:131025421-131025443 ATGTGTCCCCAGAACTGACCTGG - Intronic
939254107 2:139720457-139720479 AGGTGGCTCCAGGAATGGCATGG - Intergenic
940122104 2:150278327-150278349 AAGGGACCCCAGACCTGACATGG + Intergenic
940855675 2:158726903-158726925 AGTTGGACCCAGGACTCACATGG + Intergenic
943599596 2:189899114-189899136 GGGTAGCTCTAGAACTGACATGG - Intronic
944466876 2:200010809-200010831 AGGTGGCCCCTGCACTTTCACGG + Intergenic
946884175 2:224206580-224206602 AGGAGGCCCCAGACATGGCAAGG - Intergenic
1172210941 20:33198102-33198124 AAGTGGCCACAGAACTCATATGG - Intergenic
1172716732 20:36969876-36969898 AGGTAGCCCCATACATGACATGG + Intergenic
1173523398 20:43715280-43715302 AGATGGCCACAGCACTCACAGGG - Exonic
1173876325 20:46374494-46374516 ATGTGGCACCAGGACTGAGAAGG + Intronic
1173954064 20:47017140-47017162 AGGGGGCACCAGAACAGAGAAGG - Intronic
1175162707 20:57020823-57020845 AGGTGGCTCCAGGAGTGGCAAGG - Intergenic
1175864859 20:62169984-62170006 AGGCGGCCCCAGCACTGCCCAGG - Intronic
1176026042 20:62986167-62986189 AGGTGTCCTCAGGCCTGACAAGG - Intergenic
1176092868 20:63326648-63326670 AGGGGCCCCCTGACCTGACAAGG - Intronic
1177507892 21:22041137-22041159 AGGAGGCCCCTCAACTGCCATGG - Intergenic
1179988071 21:44932189-44932211 TGGTGGCCCCGGAGCTGGCAGGG - Intergenic
1180786416 22:18550154-18550176 GGGGGACCCCAGAACTGCCACGG + Intergenic
1181131696 22:20735873-20735895 GGGGGACCCCAGAACTGCCATGG + Intronic
1181243337 22:21489707-21489729 GGGGGACCCCAGAACTGCCACGG + Intergenic
1182989670 22:34755043-34755065 AGGTGGCCCCAGGCATCACATGG + Intergenic
949670552 3:6395170-6395192 TGATGGCCCCAGGACTGAAACGG - Intergenic
950868696 3:16210749-16210771 AGGTAGCACCAGGCCTGACACGG - Intronic
953107302 3:39896304-39896326 GGGTGGGCCCAGAGCAGACAGGG - Intronic
960569633 3:119173090-119173112 AGGTGGCCCAAAGACTGATAAGG - Intronic
961619205 3:128210223-128210245 AGGGGGTCCCAGAAATGACTTGG + Intronic
966623068 3:181986599-181986621 GCGTGGCTGCAGAACTGACATGG + Intergenic
967884098 3:194321746-194321768 AGGTGGTACAAAAACTGACAAGG + Intergenic
967932884 3:194703093-194703115 AGACGGCCCCAGAACAGCCACGG - Intergenic
968233278 3:197016549-197016571 GAGTAGACCCAGAACTGACAGGG - Intronic
968751353 4:2390901-2390923 AGGAGGACCCCGAACAGACAGGG - Intronic
969055237 4:4397508-4397530 CAGTGGCCCCAGACCTGAGAGGG + Intronic
969602686 4:8186300-8186322 AGTTCTCCCCAGAACTGTCAAGG + Intronic
971512516 4:27444790-27444812 AGGGGACTCCAGAAGTGACAGGG - Intergenic
976635360 4:87281807-87281829 GGGTGTTCCCAGAACTGTCATGG - Intergenic
982665092 4:158251674-158251696 GGGTGGTCCCAGAACTGTCATGG - Intronic
983784199 4:171711834-171711856 AGGGGGCCCCAGAGCTCCCATGG + Intergenic
983855703 4:172641359-172641381 AGTTGGGCCCAGAACTGGCAGGG - Intronic
985317168 4:188670469-188670491 ATGTGGCCCCAGATGTGATATGG - Intergenic
985540451 5:485098-485120 AGTTGGCCCCAGAGGAGACACGG + Intronic
988585508 5:32504303-32504325 AGGTGTTCCCGGAACTGTCATGG - Intergenic
995843504 5:116467856-116467878 AGATGGCCCTAGAAATGACACGG + Intronic
997278791 5:132623907-132623929 AGGTGGTCCCAGAATTGCCTAGG + Intronic
997588646 5:135059659-135059681 AGGTGGGGACAAAACTGACATGG + Intronic
1003749455 6:9040164-9040186 ATGTGGACACAGAATTGACATGG - Intergenic
1005182829 6:23125958-23125980 ATGGGGCCCCAGAGCTGACACGG - Intergenic
1005818878 6:29580468-29580490 GGCTGGCCCCAGAGCTGGCATGG - Intronic
1005994155 6:30921638-30921660 AGGTAGCAGCGGAACTGACAGGG + Exonic
1006084854 6:31588445-31588467 AGGTGGGAGCAGAACTCACAGGG + Intronic
1006642298 6:35495718-35495740 AGGTGGCCCCAGCACTGGGGTGG + Intronic
1007720986 6:43885389-43885411 AGGAGTCCCCAGAGCCGACAAGG - Intergenic
1010746683 6:79570636-79570658 AGGTGGTCCCAGTTCTGGCAGGG - Intergenic
1012551471 6:100467677-100467699 GGGTTGCCCCAGAAGTGGCAGGG - Intergenic
1017892359 6:158649414-158649436 TGGTGGCCCCAGTACTGGCTCGG + Intergenic
1018797244 6:167196109-167196131 AAGTGGCCCCGGAGGTGACAGGG - Intronic
1018819053 6:167358655-167358677 AAGTGGCCCCGGAGGTGACAGGG + Intronic
1018887832 6:167956435-167956457 AGGTAGGCCCTGGACTGACAGGG - Intronic
1019925591 7:4190265-4190287 CTGTGGCCGCAGAAATGACAGGG - Intronic
1020751488 7:12146917-12146939 AGGTGTTCCCAGAAGTGAAATGG - Intergenic
1023731455 7:43195896-43195918 AGGTATTCCCAGAACTGTCACGG + Intronic
1023907416 7:44532241-44532263 AGGTAGTCCCAGAGCAGACAAGG + Intronic
1024307319 7:47939730-47939752 AGATGGCTCCAGCACAGACAAGG - Intronic
1027908229 7:84213866-84213888 AGGTTGCCCCAGCACTATCATGG + Intronic
1032274861 7:130445445-130445467 AGGTGGCTCCAGAACTGCCTAGG - Intergenic
1035244926 7:157556020-157556042 AGGTGACCCCAGAACTGGACTGG + Intronic
1039180839 8:34864279-34864301 GGGTGTTCCCAGAACTGTCATGG + Intergenic
1040287766 8:46109199-46109221 AGAAGGCCCCAGAACTGCCTCGG - Intergenic
1041690306 8:60680148-60680170 AGGTGGCCCCCGAGGTGACCCGG + Intronic
1044504963 8:93006660-93006682 CGGTCTCCCCAGCACTGACAGGG - Intronic
1045294469 8:100861449-100861471 AGGAAGTCACAGAACTGACAAGG - Intergenic
1049022343 8:139966131-139966153 AGGTGGGGGCAGAACAGACAAGG + Intronic
1049408184 8:142460877-142460899 GGGTGACCCCAGCACTGCCAGGG + Intronic
1050169483 9:2800423-2800445 AGGGGGCCCCAGATATGAGAGGG + Intronic
1050269212 9:3924330-3924352 ATGGGGCCCCAGAAGTGAAAGGG - Intronic
1052817122 9:33110337-33110359 ATGTGGCCCAAGAACTGCTAGGG + Intronic
1055349519 9:75371980-75372002 AGATGGCACCAGGACTGACTTGG - Intergenic
1055616163 9:78075133-78075155 AGATGCTCCCACAACTGACATGG - Intergenic
1055660378 9:78497445-78497467 ACGTAGCCTCAGAACTGAGAAGG - Intergenic
1060196093 9:121624253-121624275 TGGTGTCCCCAGGACTGACCAGG + Intronic
1060523880 9:124309546-124309568 AGCTGGCTCTAGATCTGACAGGG + Intronic
1060776332 9:126377414-126377436 AGGTGGCCTCAGTGCTGAAATGG + Intronic
1062210275 9:135359863-135359885 ACTGGGCCCCAGAACTGAAAGGG + Intergenic
1062320016 9:135986286-135986308 AGGGGGCCCCAGGGCAGACAGGG - Intergenic
1062365502 9:136206627-136206649 AGGTGGCCCCAGGAGTCATATGG - Exonic
1187066286 X:15841960-15841982 AGGTGGCCTCAGACCAGTCATGG + Intronic
1198427596 X:136535601-136535623 AGGTTGGCCCAGAACTACCATGG - Intronic