ID: 1083328305

View in Genome Browser
Species Human (GRCh38)
Location 11:61884969-61884991
Sequence CCTGCTTTGGGGGCTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 969
Summary {0: 1, 1: 1, 2: 2, 3: 54, 4: 911}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083328305_1083328321 24 Left 1083328305 11:61884969-61884991 CCCTCCACAGCCCCCAAAGCAGG 0: 1
1: 1
2: 2
3: 54
4: 911
Right 1083328321 11:61885016-61885038 GAAATGAAGGCTCAGCGGGAAGG 0: 1
1: 0
2: 2
3: 27
4: 229
1083328305_1083328320 20 Left 1083328305 11:61884969-61884991 CCCTCCACAGCCCCCAAAGCAGG 0: 1
1: 1
2: 2
3: 54
4: 911
Right 1083328320 11:61885012-61885034 TGAGGAAATGAAGGCTCAGCGGG 0: 1
1: 3
2: 20
3: 143
4: 733
1083328305_1083328315 -3 Left 1083328305 11:61884969-61884991 CCCTCCACAGCCCCCAAAGCAGG 0: 1
1: 1
2: 2
3: 54
4: 911
Right 1083328315 11:61884989-61885011 AGGGGCACGAACCATTTTGCTGG 0: 1
1: 0
2: 0
3: 4
4: 50
1083328305_1083328316 2 Left 1083328305 11:61884969-61884991 CCCTCCACAGCCCCCAAAGCAGG 0: 1
1: 1
2: 2
3: 54
4: 911
Right 1083328316 11:61884994-61885016 CACGAACCATTTTGCTGGTGAGG 0: 1
1: 0
2: 0
3: 6
4: 148
1083328305_1083328319 19 Left 1083328305 11:61884969-61884991 CCCTCCACAGCCCCCAAAGCAGG 0: 1
1: 1
2: 2
3: 54
4: 911
Right 1083328319 11:61885011-61885033 GTGAGGAAATGAAGGCTCAGCGG 0: 2
1: 6
2: 27
3: 231
4: 935
1083328305_1083328318 11 Left 1083328305 11:61884969-61884991 CCCTCCACAGCCCCCAAAGCAGG 0: 1
1: 1
2: 2
3: 54
4: 911
Right 1083328318 11:61885003-61885025 TTTTGCTGGTGAGGAAATGAAGG 0: 2
1: 1
2: 24
3: 199
4: 1317
1083328305_1083328322 25 Left 1083328305 11:61884969-61884991 CCCTCCACAGCCCCCAAAGCAGG 0: 1
1: 1
2: 2
3: 54
4: 911
Right 1083328322 11:61885017-61885039 AAATGAAGGCTCAGCGGGAAGGG 0: 1
1: 0
2: 2
3: 9
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083328305 Original CRISPR CCTGCTTTGGGGGCTGTGGA GGG (reversed) Intronic
900400659 1:2471652-2471674 CCTGCTCTGGGGCCGGTGGAAGG + Intronic
900597788 1:3490396-3490418 CTTCCTTTGAGGGCCGTGGAGGG - Exonic
900646602 1:3711675-3711697 CCTGCCTCGTGGGCTGTGGGTGG - Intronic
901482590 1:9535855-9535877 CCTGCTTGGGAGGCTGAGGCAGG - Intergenic
901553761 1:10015550-10015572 GCTACTTTGGGGGCTGAGGTGGG + Intronic
901657197 1:10776342-10776364 CCAGCTGTGGGGGCTTGGGAAGG - Intronic
902172020 1:14619445-14619467 AGTGCTTTGGGGGCTGAGGTGGG - Intronic
902237740 1:15068486-15068508 GCTCCTTTGGGGCCTCTGGAAGG - Intronic
902295364 1:15463319-15463341 CCTGCCCTGTGGGCTTTGGAGGG - Intronic
902322856 1:15681063-15681085 GCTGCTTTGGAGGCTGAAGAGGG - Intergenic
902404556 1:16175637-16175659 CCTGAGGTGGGGACTGTGGAGGG - Intergenic
902578754 1:17395109-17395131 TCTGCTTTGGGGTCTGGAGAAGG + Intronic
902590525 1:17470951-17470973 GCTGCTCTGGAGGCTGTGGTGGG - Intergenic
902879683 1:19363191-19363213 GCTGCTTGGGAGGCTGGGGAAGG - Intronic
903036055 1:20493286-20493308 CCTGCCTTGGAGCCTGTGGAAGG - Intergenic
903744925 1:25580618-25580640 GCTACTTGGGGGGCTGAGGAGGG - Intergenic
904191296 1:28745925-28745947 GCTACTTTGGAGGCTGAGGAAGG + Intronic
904558640 1:31382057-31382079 CCTGGTGTGGGGCCTGGGGATGG + Intergenic
904714268 1:32455234-32455256 CCTACTTGGGAGGCTGAGGAGGG + Intergenic
904884521 1:33726268-33726290 CCCTCCTTGGGGGCTGGGGAGGG + Intronic
905267709 1:36766121-36766143 CCTGCTCCGTGGGCTGTGGTGGG - Intergenic
905388997 1:37624308-37624330 CCTGTTATGGGGGGTGTGCAGGG + Intronic
905582198 1:39090709-39090731 GTTACTTTGGGGACTGTGGAAGG + Intronic
905774587 1:40660487-40660509 GCTGCTTGGGGGGCTGAGGTGGG - Intronic
905808890 1:40897521-40897543 CATGCTTTGGGGGCTGTTTAAGG + Intergenic
905987624 1:42301305-42301327 GCTGCTTTGGAGGCTGAGGCAGG - Intronic
906287701 1:44598369-44598391 CCTGATTTAGGGGCTCAGGACGG + Intronic
906574841 1:46879175-46879197 GCTGCTTGGGGGGCTGAGGCAGG + Intergenic
906597132 1:47088726-47088748 GCTGCTTGGGGGGCTGAGGCAGG - Intronic
907149394 1:52269239-52269261 CCTACTTTGGAGGCTGAGGCAGG - Intronic
907194871 1:52678315-52678337 CCTACTTGGGGGGCTGAGGCAGG + Intergenic
907362114 1:53926255-53926277 GCTGCTTGGGAGGCTGAGGAAGG - Intronic
907379217 1:54071921-54071943 CCTACTTGGGGGGCTGAGGTGGG - Intronic
908207019 1:61860713-61860735 GCTACTTTGGAGGCTGTGGCAGG + Intronic
908618814 1:65952569-65952591 GCTGCTCTGGTGGCTGAGGAGGG + Intronic
908760758 1:67509707-67509729 GCTACTTTGGGGGCTGAGGCAGG - Intergenic
908775344 1:67634152-67634174 GCTGCTTGGGAGGCTGAGGAGGG + Intergenic
908969900 1:69815551-69815573 GCTGTTTTGGGGACTGTGAAGGG - Intronic
909447224 1:75760446-75760468 GCTACTTTGGGGGCTGAGGCGGG + Intronic
910196999 1:84652309-84652331 GCTACTTTGGAGGCTGAGGAGGG + Intronic
910302628 1:85724163-85724185 GCTACTTTGGAGGCTGAGGAAGG - Intergenic
910635011 1:89398241-89398263 GCTACTTGGGGGGCTGAGGAAGG - Intergenic
910724904 1:90328155-90328177 TCGGCTGTGGTGGCTGTGGAGGG + Intergenic
911791110 1:102015907-102015929 GCTACTTTGTGGGCTGTGGTGGG + Intergenic
912055477 1:105592925-105592947 ACTGAAGTGGGGGCTGTGGATGG - Intergenic
912403872 1:109419860-109419882 GCTACTTTGGGGGCTGAGGCGGG + Intronic
912440669 1:109694915-109694937 CCTACTTGGGAGGCTGAGGAAGG - Intronic
912457763 1:109809132-109809154 ACTGCTTTGTGAGCTCTGGATGG + Intergenic
912529553 1:110310462-110310484 GCTGGTTTGGATGCTGTGGAGGG - Intergenic
912587356 1:110779199-110779221 CATGCTTCTGGGGATGTGGAAGG + Intergenic
912766933 1:112421764-112421786 CATGCTTTTGGGTGTGTGGATGG - Intronic
912824605 1:112894345-112894367 GCTACTTTGGGGGCTGAGGTGGG + Intergenic
914421961 1:147537448-147537470 CCTGATTTGGGGGCTGTACAGGG - Intergenic
914709488 1:150200022-150200044 GCTGCTTGGGAGGCTGTGGCAGG - Intergenic
915467044 1:156104010-156104032 CCTTCAGTGGGGGCTGTGAAGGG - Intronic
915541337 1:156568632-156568654 GCTACTTGGGGGGCTGAGGAAGG - Intronic
915565916 1:156712612-156712634 CCTGCCCTGGGAGCTGGGGAGGG - Intergenic
915603384 1:156936383-156936405 GCTGCTTTGGAGGCTGAGGTGGG + Intronic
915818105 1:158991764-158991786 CCTACTTAGGAGGCTGAGGAGGG + Intergenic
915913452 1:159928257-159928279 CCTGCAGAGGGGGCTGTGGAGGG + Exonic
917323216 1:173805401-173805423 GCTACTTGGGGGGCTGAGGAGGG + Intronic
917786944 1:178469183-178469205 GCTGCTTGGGGGGCTGAGGTGGG + Intronic
917871760 1:179248428-179248450 CCTGCTTGGGAGGCTGAGGTGGG + Intergenic
917939297 1:179902135-179902157 CCTGCTTGGGGGGCTGAGGCAGG - Intronic
918501853 1:185205478-185205500 GCTGCTTGGGGGGCTGAGGCAGG - Intronic
918625845 1:186655125-186655147 GCTGCTTGGGGGGCTGAGGCAGG - Intergenic
918827575 1:189345613-189345635 CCTACTTTGGAGGCTGAGGCTGG - Intergenic
919683649 1:200460325-200460347 GCTGCTTTGGAGGCTGAGGCAGG - Intergenic
919693272 1:200546633-200546655 CCTGTTTTGGGTGCTGTGATGGG - Intergenic
920394475 1:205634151-205634173 CCTACTTGGGAGGCTGAGGAAGG - Intergenic
921691651 1:218157858-218157880 CCTGCTTTTAGAGCTGAGGATGG - Intergenic
921788515 1:219262720-219262742 CCTGCTTTGGTGGAGGTGGCAGG + Intergenic
921866481 1:220092461-220092483 GCTGCTTTGGAGGCTGTGGTGGG - Intergenic
922287152 1:224180634-224180656 GCTACTTGGGGGGCTGAGGAAGG - Intronic
922322441 1:224500559-224500581 GCTGCTTGGGAGGCTGAGGAGGG + Intronic
922537385 1:226391227-226391249 GCTGCATTGGGGGCTGGGCACGG - Intronic
922688503 1:227667153-227667175 GCTACTTGGGGGGCTGAGGAAGG - Intronic
922787125 1:228288445-228288467 CCAGCTTTCTGGGCTGTGGAAGG + Intronic
922848024 1:228705343-228705365 GCTGCTTTGGGGGCTCTTGGGGG + Intergenic
923999932 1:239539394-239539416 TGTGCTCTGAGGGCTGTGGAAGG - Intronic
924377572 1:243429638-243429660 CCTGCTTGGAAGGCTGAGGAGGG - Intronic
924534661 1:244924636-244924658 GCTGCTTTGGAGGCTGAGGCAGG - Intergenic
924624353 1:245687211-245687233 CCTGCTTTGGGGGTGGCGGTGGG - Exonic
924677277 1:246192208-246192230 GCTGCTTGGGAGGCTGAGGAAGG - Intronic
1063411977 10:5843130-5843152 CCTACTTGGGAGGCTGAGGAAGG + Intergenic
1063714749 10:8515599-8515621 CCTGCTTCTGGGGCTGTGCATGG + Intergenic
1064188238 10:13182362-13182384 GCTGCTTGGGAGGCTGAGGATGG + Intronic
1064323149 10:14324770-14324792 CCTGCTTGGGAGGCTGAGGCAGG - Intronic
1065044076 10:21729971-21729993 ATTGCTTTGGGGGCTGGGCACGG + Intronic
1065046956 10:21753671-21753693 GCTGCTTGGGGGGCTGAGGCAGG + Intergenic
1065175512 10:23071446-23071468 GCTGCTTTGGAGGCTGAGGTGGG - Intergenic
1065591373 10:27265634-27265656 GCTGCCTGGGGGGCTGAGGAGGG - Intergenic
1065721967 10:28636045-28636067 GCTGCATTGGAGGCTGTGGATGG + Intergenic
1066355125 10:34676028-34676050 CCTGCCTTGGTGGCTGAGGAGGG - Intronic
1067530610 10:47068983-47069005 GATGCTTTGGGGGCTGATGAAGG + Intergenic
1068038637 10:51793871-51793893 CCTGCTTGGGAGGCTGAGGCAGG - Intronic
1068315302 10:55334417-55334439 CCTACTTGGGGGGCTGAGGCAGG - Intronic
1068337064 10:55647567-55647589 GCTGCTTTGGAGGCTGAGGCAGG + Intergenic
1068458977 10:57301456-57301478 GCTGCTTGGGAGGCTGTGGCAGG - Intergenic
1068687565 10:59884950-59884972 GCTGCTTGGGAGGCTGAGGAAGG + Intronic
1068824782 10:61423624-61423646 CCTGCTTGGGAGGCTGAGGTGGG + Intronic
1069420555 10:68242810-68242832 CCTACTTGGGAGGCTGAGGAAGG - Intergenic
1069562749 10:69442153-69442175 CCTTCTGTGGGGGCAGTGGTGGG + Intergenic
1069738593 10:70673382-70673404 GCTACGTTGGGGGCAGTGGAAGG - Intronic
1069860638 10:71468999-71469021 CCTGCTTTGGGGCTCTTGGAGGG - Intronic
1070461125 10:76671607-76671629 CCTGCTTTGTGGACTCTGGAAGG + Intergenic
1070621703 10:78017333-78017355 GCTACTTTGGGGGCTGAGGTGGG + Intronic
1070740583 10:78900540-78900562 ACAGCTTTGGGGGCTGTGCAGGG + Intergenic
1071534184 10:86414121-86414143 ACTTCTTTGGAGGCTGAGGAAGG - Intergenic
1071992164 10:91110354-91110376 GCTACTTGGGGGGCTGAGGAAGG - Intergenic
1072274439 10:93809174-93809196 GCTGCTTGGGAGGCTGAGGAAGG - Intergenic
1072952535 10:99860291-99860313 CCTGCTTGGGAGGCTGAGGCAGG - Intergenic
1073297139 10:102447673-102447695 CCTGCTTGGGAGGCTGAGGCAGG + Intergenic
1073307259 10:102512954-102512976 GCTGCTTGGGGGGCTGAGGTGGG + Intronic
1073520907 10:104128262-104128284 TCTGGTTTTGGGGCTTTGGAAGG - Intergenic
1074964016 10:118472992-118473014 CCTCCTTGGGGGGCTGGAGAGGG + Intergenic
1075171741 10:120121789-120121811 CCTACTTTGGAGGCTGAGGCAGG + Intergenic
1075438023 10:122459704-122459726 ACTGCTTTGCGGGAGGTGGAGGG - Intergenic
1075658350 10:124176123-124176145 CCACCTGTGGGGGCTGTTGAGGG - Intergenic
1076182875 10:128424211-128424233 GCTGCTTGGGGGGCTGAGGCAGG + Intergenic
1076657175 10:132032402-132032424 GCTGCTTGGGAGGCTGAGGAAGG - Intergenic
1076767722 10:132645779-132645801 CAGGCTGTGGGGGCGGTGGAGGG + Intronic
1077092664 11:786773-786795 GCTGCAGTGGGGGCTGCGGAAGG + Intergenic
1077333149 11:1992167-1992189 CCGCCTTTCCGGGCTGTGGAGGG - Intergenic
1077437374 11:2549409-2549431 CCTGCTTTGGGGGCAGTTTGAGG + Intronic
1077490088 11:2857093-2857115 CCCAGGTTGGGGGCTGTGGATGG + Intergenic
1077578879 11:3404438-3404460 TGTGCTCTGGGGGCTGTGGCAGG + Intergenic
1077578893 11:3404487-3404509 TGTGCTCTGGGGGCTGTGGCAGG + Intergenic
1078055923 11:8008830-8008852 CCTACTTTGTTGGCTGTGGTTGG + Intergenic
1078549376 11:12269792-12269814 CCTGGCTTGTGGGCAGTGGAGGG + Intergenic
1080244331 11:30162906-30162928 CCTGCTTTGGGGCAGGTGAAGGG - Intergenic
1080361264 11:31516605-31516627 GCTACTTGGGGAGCTGTGGAAGG - Intronic
1080706296 11:34698020-34698042 GCTGCTTTGGAGGCTGAGGCAGG - Intergenic
1081189881 11:40090685-40090707 GCTGCTTGGGAGGCTGAGGAGGG - Intergenic
1081988268 11:47323292-47323314 GCTACTTTGGGGGCTGAGGCAGG + Intronic
1082220356 11:49627938-49627960 GCTGCTTGGGGGGCTGAGGCAGG - Intergenic
1083039879 11:59675747-59675769 CCTGCTTTGGGGTAGGTGAAAGG - Intergenic
1083323318 11:61860794-61860816 CCTACTTTGGAGGCTGAGGTAGG + Intronic
1083328305 11:61884969-61884991 CCTGCTTTGGGGGCTGTGGAGGG - Intronic
1083384557 11:62297954-62297976 GCTACTTTGGGGGCTGAGGGAGG - Intronic
1083491429 11:63017346-63017368 CCTGCTCTAGGGGCTAGGGAGGG + Intergenic
1083550922 11:63589787-63589809 CCTGCCTTTAGGGCTGGGGAGGG + Intronic
1083791547 11:64989320-64989342 CCAGCTCGAGGGGCTGTGGAGGG + Exonic
1083801262 11:65047773-65047795 CCTGTTGTTGGGGCTGGGGAGGG - Intronic
1083930599 11:65841620-65841642 GCTGCTTGGGGGGCTGAGGCAGG + Intronic
1084235915 11:67788006-67788028 TGTGCTCTGGGGGCTGTGGCAGG + Intergenic
1084296452 11:68215689-68215711 TCGGCTTTGGGGGCTCTGGAGGG - Intergenic
1084471233 11:69360454-69360476 CATGCTGTGGGGGCTCAGGATGG + Intronic
1085395586 11:76205656-76205678 CCTGCTCAGGGGGCTGGGGGTGG - Intronic
1085424974 11:76396424-76396446 GCTACTTCGGGGGCTGTGGTGGG - Intronic
1085595497 11:77805220-77805242 CATGCTTTGGAGGCTGAGGTGGG + Intronic
1086674604 11:89589912-89589934 ACTGCTTGGGGGGCTGAGGCAGG + Intergenic
1088250913 11:107859975-107859997 CCTGCTTTGGGGGTTGGGGTGGG + Intronic
1088700405 11:112406622-112406644 CCTGCTTTGGGGAACCTGGATGG - Intergenic
1088867748 11:113864946-113864968 CCTACTTGGGAGGCTGAGGAGGG - Intronic
1089178744 11:116566510-116566532 CCTGCTTTGAGGTCCGTGGTGGG - Intergenic
1089348313 11:117806083-117806105 CCTGCCTTGGGTACTGAGGATGG - Intronic
1089626114 11:119752139-119752161 TCTGCTTTGGGGACAATGGATGG - Intergenic
1089797643 11:120995067-120995089 GCTACTTGGGGGGCTGTGGTGGG + Intergenic
1090025332 11:123162788-123162810 GCTGCTTGGGGGGCTGAGGCAGG + Intronic
1090159642 11:124479056-124479078 CCTACTTTGGAGGCTGAGGCAGG + Intergenic
1090379278 11:126314076-126314098 CCTTCTTTGGGGTGTGGGGATGG + Intronic
1090404199 11:126467369-126467391 CCTGCTTGGGTGGCAGTGGCTGG + Intronic
1090921180 11:131207155-131207177 CCTACATGGGGTGCTGTGGAGGG - Intergenic
1091077816 11:132637392-132637414 CCTGCTGTTGAGGCTGTTGAAGG + Intronic
1202816131 11_KI270721v1_random:47346-47368 CCGCCTTTCCGGGCTGTGGAGGG - Intergenic
1091391012 12:125957-125979 CCTGCTTTGGGGGCTGTCGAGGG + Intronic
1091510593 12:1120238-1120260 TGTGCTTTGGGGGCTGAGGCAGG - Intronic
1092077311 12:5684466-5684488 CCTTCTCTGGGGGCAGTGGGAGG + Intronic
1092125474 12:6072276-6072298 CCTGCCTGGGGGACTGGGGAGGG - Intronic
1092145882 12:6214456-6214478 GCTACTTGGGGGGCTGAGGAAGG - Intronic
1092156015 12:6281878-6281900 CCTACTCTGGGGGCTGAGGCGGG + Intergenic
1092222876 12:6727223-6727245 CCTGCTTGGGAGGCTGAGGCAGG + Intronic
1092406806 12:8227319-8227341 TGTGCTCTGGGGGCTGTGGCAGG + Intronic
1093423314 12:18999648-18999670 GCTACTTTGGGGGCTGAGGCAGG - Intergenic
1093536234 12:20227022-20227044 GCTGCTTGGGAGGCTGAGGAGGG + Intergenic
1094016280 12:25867931-25867953 GCTACTTGGGGGGCTGAGGAGGG - Intergenic
1094031897 12:26021752-26021774 ACTGCTCTGGGGGCTGGGTAGGG - Intronic
1094187265 12:27658022-27658044 CCTACTTGGGAGGCTGAGGAGGG + Intronic
1094279896 12:28724600-28724622 TCTGCTTTAGGGACTGGGGATGG + Intergenic
1094663192 12:32491821-32491843 TTTGCTCTGGGGGCAGTGGAAGG + Intronic
1094673523 12:32594917-32594939 GCTGCTTGGGGGGCTGAGGCAGG + Intronic
1094876189 12:34645501-34645523 CCAGTTTTGGGGTCTGGGGAGGG + Intergenic
1095945782 12:47752435-47752457 CCTGCTCATGGGCCTGTGGAAGG - Intronic
1096253943 12:50051551-50051573 TCTGTTTTGGGGGCTCTGGCTGG - Intergenic
1096599576 12:52720012-52720034 GCTACTTGGGGGGCTGAGGAGGG - Intergenic
1096733742 12:53635979-53636001 GCTACTTTGGGGGCTGAGGTGGG + Intronic
1096805906 12:54141025-54141047 CCTGCTCTGGCCTCTGTGGAGGG - Intergenic
1096829568 12:54303919-54303941 CCTCCTTTGAGGGCTGTAAAGGG - Intronic
1097870827 12:64600937-64600959 CCTGTTTTGGGCACTATGGAAGG - Intergenic
1099229884 12:80010922-80010944 GCTACTTGGGGGGCTGAGGAAGG - Intergenic
1100556827 12:95702967-95702989 CCTGCTTAGGAGGCTGAGGCAGG - Intronic
1100988554 12:100228114-100228136 CCTGCTTGGGAGGCTGAGGCAGG + Intronic
1100999463 12:100343266-100343288 CCTGTTGTGGGGGCGGGGGAGGG + Intergenic
1101632649 12:106510731-106510753 CCTGCCATGAGGGCTGAGGAAGG - Intronic
1102354429 12:112221061-112221083 CCTGCTTGGGAGGCTGAGGTGGG - Intronic
1102356256 12:112238612-112238634 CCTACTTGGGAGGCTGTGGTCGG + Intronic
1102448768 12:113024852-113024874 GCTGCTTTGGAGGCTGAGGCAGG - Intergenic
1102537840 12:113594474-113594496 GCTACTTGGGGGGCTGAGGAAGG + Intergenic
1102644520 12:114395578-114395600 CCTTCTTTGAGGGGTGTGGGTGG - Intronic
1102798974 12:115715088-115715110 GCTGCTTGGGGGGCTGAGGTGGG - Intergenic
1102929464 12:116851310-116851332 GCTGCTTGGGAGGCTGAGGAGGG - Exonic
1102932955 12:116876542-116876564 CCTGCCTTGGGAGCAGGGGAAGG - Intronic
1103109256 12:118260790-118260812 CCTGCTTGGGAGGCTGAGGCAGG - Intronic
1103171685 12:118825762-118825784 CCAGCTTGGGGGGCTGAGGTAGG + Intergenic
1103180028 12:118902759-118902781 ACTGCTCTGGAGGCTGAGGAAGG - Intergenic
1103196034 12:119044512-119044534 CTTGCTGTGGGGGCTCTGGGAGG - Intronic
1103401603 12:120646961-120646983 CCTGCTTTGGGGGCAGGTGCAGG - Intronic
1103622875 12:122199693-122199715 GCTACTTTGGGGGCTGAGGTAGG - Intronic
1103687937 12:122746990-122747012 CCTACTTTGGAGGCTGAGGCTGG + Intergenic
1103739998 12:123084566-123084588 CATGCTCTGGGGGCAGCGGAGGG - Intronic
1103791410 12:123474461-123474483 GCTGCTTGGGAGGCTGTGGCAGG - Intronic
1103984640 12:124759194-124759216 TCTGATTTGGGGGATGGGGAAGG - Intergenic
1103988650 12:124783952-124783974 GCTGATTTGGGGGCTGCGGCAGG + Intronic
1104065799 12:125304717-125304739 ACTACTTGGGGGGCTGAGGAGGG + Intronic
1104690842 12:130825146-130825168 GCTGCTTGGGAGGCTGTGGTGGG - Intronic
1104723618 12:131061056-131061078 CCTGCAGTGGGGGCTGGGGGAGG - Intronic
1104976757 12:132555619-132555641 CCTCCTCTGGGGCCTCTGGAGGG - Intronic
1105011171 12:132757870-132757892 ACTACTTGGGGGGCTGAGGAAGG + Intronic
1105211598 13:18260431-18260453 GCTGCTTGGGAGGCTGTGGCAGG - Intergenic
1106107797 13:26749354-26749376 CCCGCCTTGTGGGCTCTGGAAGG - Intergenic
1106152019 13:27113679-27113701 CCTGTTTTAGGGGCTGTAAAAGG - Intronic
1107361224 13:39619412-39619434 CCTGCTTTGGTGGAGGTGGCAGG - Intergenic
1108386469 13:49903895-49903917 CCTGCTCTGGAGGCTGAGGCAGG - Intergenic
1108621236 13:52185913-52185935 GCTACTTTGGGGGCTGAGGCGGG - Intergenic
1109089146 13:58016787-58016809 CCTATATTGGGGGCTCTGGAGGG + Intergenic
1109305860 13:60640826-60640848 GCTGCTTGGGGGGCTGAGGCAGG - Intergenic
1110012679 13:70357430-70357452 GCTGCTTTGGGGGCTGAGGCAGG + Intergenic
1110066105 13:71107327-71107349 GCTGCTTGGGGGGCTGAGGTGGG + Intergenic
1110152963 13:72276894-72276916 CCTGCTCTGGAGGCTGAGGCAGG + Intergenic
1111772803 13:92621296-92621318 CCAGATATGGGGGCTGAGGATGG - Intronic
1112096081 13:96133532-96133554 CCTACTCTGGCGGCTGTGGCAGG - Intronic
1113469591 13:110534943-110534965 CCTGCTTGGGAGGCTGAGGTGGG - Intronic
1113508225 13:110831635-110831657 CCTCCATGGGGGGCTGTGGGGGG - Intergenic
1113569481 13:111343555-111343577 CCTGCTTTGGGGGCCCTTGGAGG + Intronic
1113675317 13:112202869-112202891 CCTGCAGTGGAGGCTGTGGGAGG - Intergenic
1113809251 13:113128094-113128116 GGCACTTTGGGGGCTGTGGAGGG - Intronic
1113955872 13:114099680-114099702 GCTGCTGTGGGGGCTGTGGGGGG - Intronic
1113955882 13:114099703-114099725 GCTGCTGTGGGGGCTGTGGGGGG - Intronic
1114263636 14:21057931-21057953 GCTGCTTCTGGGGCTGTGGGTGG + Exonic
1114316609 14:21515439-21515461 GCTGCTTTGGAGGCTGAGGTGGG + Intergenic
1114451762 14:22831222-22831244 CCTACTTGGGGGGCTGAGGTGGG - Intronic
1114694266 14:24612107-24612129 CCTGCTCTGGTGGAGGTGGAAGG + Intergenic
1114952283 14:27770254-27770276 CCAGCTTGGGAGGCTGAGGAAGG + Intergenic
1115344550 14:32328394-32328416 CCAGCTTTTGGGGTTGGGGAGGG + Intergenic
1115631040 14:35245531-35245553 GCTACTTGGGGGGCTGAGGAAGG + Intronic
1115634104 14:35274534-35274556 GCTACTTTGGGGGCTGAGGTAGG + Intronic
1115645301 14:35365200-35365222 CCTTCTTAGAGGGATGTGGAGGG + Intergenic
1116861141 14:49996579-49996601 CCTGCTCTGGAGGCTGAGGTGGG - Intronic
1116994241 14:51305618-51305640 GCTGCTTGGGAGGCTGTGGCAGG + Intergenic
1118193764 14:63605569-63605591 GCTGCTTCGGGGGCTGAGGCAGG - Intronic
1118228455 14:63925963-63925985 CCTGTTTGGGGGGCTGAGGTGGG - Intronic
1118409992 14:65469066-65469088 CCTGCTTGGGAAGCTGTGGCAGG + Intronic
1118744809 14:68766177-68766199 GCTGCTTGGGAGGCTGAGGAAGG + Intergenic
1118784222 14:69032629-69032651 GCTACTTGGGGGGCTGTGGCAGG - Intergenic
1119249985 14:73143875-73143897 CCTGCTTGGGAGGCTGAGGTGGG + Intronic
1119270910 14:73303466-73303488 GCTGCTCTGGAGGCTGTGGCAGG + Intronic
1119596721 14:75941750-75941772 CCAGCTTAGGAGGCTGAGGAGGG - Intronic
1120304182 14:82746855-82746877 GCTGCTTGGGAGGCTGTGGCAGG + Intergenic
1120736729 14:88061299-88061321 CCTACTTTGGAGGCTGAGGCAGG + Intergenic
1121054567 14:90842050-90842072 CCTGCTTGGGAGGCTGAGGCAGG + Intergenic
1121257974 14:92545219-92545241 CCTACTTTGGAGGCTGAGGCAGG - Intronic
1121425148 14:93845354-93845376 CATGCTTTGGGGAGTGTGGAGGG + Intergenic
1121774795 14:96583559-96583581 CATGCTTTGGGAGCTGGGGCTGG + Intergenic
1121855259 14:97263595-97263617 GCTGCTCTGGAGGCTGAGGAAGG - Intergenic
1122139341 14:99653000-99653022 CATGCTTTGGGGCCTGGAGAAGG + Intronic
1122161607 14:99788495-99788517 GCTGCTTGGGAGGCTGAGGAGGG + Intronic
1122343051 14:101041189-101041211 ACTGCTTCAGGGGCTATGGAAGG + Intergenic
1122366290 14:101196826-101196848 CCTGCTTTGGGCCCCCTGGAAGG - Intergenic
1122572788 14:102718898-102718920 CCTACTTAGGGGGCTGAGGTGGG - Intronic
1122800881 14:104228967-104228989 CCCCTTTGGGGGGCTGTGGAGGG + Intergenic
1122838284 14:104442157-104442179 CCTGCTGTGGCGGCTGGGGCTGG - Intergenic
1122983852 14:105203323-105203345 CCAGCTGTGGGGGCTGGGAAGGG + Intergenic
1123423385 15:20148763-20148785 CCGGCTTTGGGGGCTCTGAGTGG + Intergenic
1123532606 15:21155284-21155306 CCGGCTTTGGGGGCTCTGAGTGG + Intergenic
1123652991 15:22491530-22491552 CCTACTTTGGAGGCTGAGGCAGG + Intergenic
1124343060 15:28902237-28902259 CATGCCCTGGGTGCTGTGGAGGG + Intronic
1124513802 15:30349392-30349414 GCTGCTTTGGAGGCTGAGGCAGG + Intergenic
1124729119 15:32181373-32181395 GCTGCTTTGGAGGCTGAGGCAGG - Intergenic
1124911025 15:33920885-33920907 GCTGCTTGGGGGGCTGAGGCAGG - Intronic
1124940535 15:34213516-34213538 CTTCCTTTGCAGGCTGTGGAAGG + Intergenic
1125049634 15:35282281-35282303 CCTGCTTGGGAGGCTGAGGCAGG - Intronic
1126058458 15:44755226-44755248 CATGCTCTGGGCACTGTGGATGG - Exonic
1126383438 15:48070787-48070809 ACTCCTTTGAGGGCTGGGGATGG - Intergenic
1126460799 15:48913272-48913294 GCTGCTGTGGGGGATGTGGGTGG + Intronic
1126754229 15:51909591-51909613 CCTTTTTTGGGGGGTGGGGAGGG - Exonic
1127798614 15:62458655-62458677 GCTGCTTTGGAGGCTGAGGTGGG + Intronic
1127987625 15:64086503-64086525 ACTGCTGTGGGTGTTGTGGAGGG - Intronic
1128027161 15:64447821-64447843 GCTACTTTGGGGGCTGAGGTGGG - Intronic
1128058685 15:64719489-64719511 GCTGCTTGGGGGGCTGAGGCAGG + Intergenic
1128637910 15:69314890-69314912 CCTGCTTTGGGGGAGCTGAAGGG + Intronic
1129348127 15:74937653-74937675 CCTGCTGTGGGCGCCGAGGAGGG - Intronic
1129459104 15:75691060-75691082 GCTACTTTGGAGGCTGTGGCAGG + Intronic
1129594164 15:76946638-76946660 GCTGCTTTGGAGGCTGAGGCAGG + Intronic
1129670780 15:77606573-77606595 CCAGCTCTGGGTGCTGCGGAGGG + Intergenic
1129788723 15:78326476-78326498 CTTGCTTTGTGTACTGTGGAGGG - Intergenic
1129808374 15:78483894-78483916 ACTACTTTGGGGGCTGAGGCAGG - Intronic
1129885763 15:79036039-79036061 GCTGCTTGGGGAGCAGTGGATGG - Intronic
1130571726 15:85051970-85051992 CCTGCTGTGGGGTGTGGGGAGGG - Intronic
1130941887 15:88517335-88517357 CCTACTCTGGGGGCTGAGGTGGG - Intronic
1131483297 15:92800243-92800265 CCTACTTGGGAGGCTGAGGAGGG - Intronic
1131556812 15:93406755-93406777 GCTGCTCTGGAGGCTGTGGCGGG + Intergenic
1132352368 15:101147974-101147996 CCTACTTGGGGGGCTGAGGTGGG + Intergenic
1132408611 15:101560298-101560320 CCTGTGCTGGGGGCTGTGGGAGG + Intergenic
1132659013 16:1053371-1053393 CCTGCTCTGGGGGATGTGGGAGG + Intergenic
1132769691 16:1554513-1554535 CAGGCTCTGGCGGCTGTGGAGGG - Intronic
1132772342 16:1570865-1570887 CCTGCTTGGGAGGCTGAGGTGGG - Intronic
1132847031 16:2005425-2005447 GCTGCTTCGGGAGCTGTGGTGGG - Intronic
1132874243 16:2128814-2128836 GCTACTTTGGGGGCTGAGGCAGG - Intronic
1132896709 16:2232654-2232676 CCAGCTTTGGGGGATGAGGCGGG + Intronic
1132988454 16:2780283-2780305 CCTGCTTTGGGGCACGTGAAAGG - Intergenic
1133135214 16:3706390-3706412 CCTGCTTGGGAGGCTGAGGTGGG - Intronic
1133252754 16:4494765-4494787 GCTGCTTTGGGGGCTGAAGCAGG + Intronic
1133290695 16:4718741-4718763 ACTGCTTTGGGGGATGGGGCAGG - Intronic
1133953415 16:10418369-10418391 CCAGTTTTGGGGCCTGTTGATGG + Intronic
1134128604 16:11633028-11633050 CCTACTTTGGGGCCTGGGAAAGG + Intronic
1134194254 16:12146675-12146697 CCTGCATCTGTGGCTGTGGAAGG + Intronic
1134206776 16:12244495-12244517 GCTGCTCTGGAGGCTGTGGCAGG + Intronic
1134337049 16:13309997-13310019 CCTACTTTGAGGGCTGAGGCAGG - Intergenic
1134553188 16:15147636-15147658 GCTACTTTGGGGGCTGAGGCAGG - Intergenic
1135222302 16:20623651-20623673 CCTGCATGGGAGACTGTGGAGGG - Intronic
1135313397 16:21422861-21422883 CCTGCATGGGAGACTGTGGAGGG - Intronic
1135366321 16:21855139-21855161 CCTGCATGGGAGACTGTGGAGGG - Intronic
1135445494 16:22516025-22516047 CCTGCATGGGAGACTGTGGAGGG + Intronic
1135589944 16:23697866-23697888 GCTGCTTGGGGGGCTGAGGCAGG - Intronic
1135611609 16:23872407-23872429 CCTACTCGGGGGGCTGTGGTGGG + Intronic
1135843499 16:25897338-25897360 GCTGCTTGGGAGGCTGAGGAGGG + Intronic
1136108125 16:28045561-28045583 GCTACTTGGGGGGCTGTGGCAGG + Intronic
1136120158 16:28127715-28127737 CTTCCTTTGGGGGCTGTCGCAGG - Intronic
1136152544 16:28360581-28360603 CCTGCATGGGAGACTGTGGAGGG - Intronic
1136189388 16:28606654-28606676 CCTGCTGTGGGGGCTGCCCAGGG + Intronic
1136194205 16:28640601-28640623 CCTGCATGGGAGACTGTGGAGGG + Intronic
1136210538 16:28754700-28754722 CCTGCATGGGAGACTGTGGAGGG + Intronic
1136323508 16:29503366-29503388 CCTGCATGGGAGACTGTGGAGGG - Intronic
1136359928 16:29772431-29772453 CCTACTTGGGAGGCTGTGGCAGG + Intergenic
1136438193 16:30243335-30243357 CCTGCATGGGAGACTGTGGAGGG - Intronic
1136851391 16:33615196-33615218 GCTGCTTGGGGGGCTGAGGCCGG + Intergenic
1137943646 16:52713429-52713451 CCAGCCTTAGGGGCTGGGGATGG + Intergenic
1138089641 16:54163643-54163665 CCTACTTGGGAGGCTGAGGAAGG + Intergenic
1138124420 16:54427067-54427089 CCTGCTTTGGGGGATATTAAGGG + Intergenic
1138382753 16:56614931-56614953 GCTACTTTGGGGGCTGAGGTGGG - Intergenic
1138488006 16:57359105-57359127 CCTGGGTTGGGGGTTGTGGTGGG + Intronic
1138674547 16:58641594-58641616 GCTGCTTTGGAGGCTGAGGCAGG - Intergenic
1138715252 16:59013960-59013982 GCTACTTTGGAGGCTGTGGCGGG - Intergenic
1139607402 16:68029556-68029578 CCTACTTGGGGGGCTGAGGCAGG - Intronic
1139857747 16:69993965-69993987 CCTGCATGGGAGACTGTGGAGGG - Intergenic
1140307957 16:73821294-73821316 CCTGCTTTGAGGAATGTGGTCGG + Intergenic
1140465620 16:75179678-75179700 CCTACTTTGGAGGCTGAGGCAGG + Intergenic
1140467220 16:75192190-75192212 GCTACTTTGGGGGCTGAGGCAGG - Intergenic
1141342343 16:83214466-83214488 CCTACTTAGGGGGCTGAGGTGGG + Intronic
1141454877 16:84134498-84134520 CCAGCTTGGGTGGCTGAGGAAGG + Intronic
1142117517 16:88367525-88367547 ACAGCTTTGAGGGCTTTGGAAGG + Intergenic
1142270993 16:89089144-89089166 TCTGCTTCAGGGGCTGGGGATGG + Intronic
1142365979 16:89649951-89649973 CCTGCTTGGGGGGCTGGGCTGGG - Intronic
1203112994 16_KI270728v1_random:1463659-1463681 GCTGCTTGGGGGGCTGAGGCCGG + Intergenic
1142866874 17:2796550-2796572 TCTCCTTTGGGGGCTTCGGATGG + Exonic
1143027392 17:3949014-3949036 CCTGCTTGGGAGGCTGAGGCAGG + Intronic
1143208585 17:5165467-5165489 GCTGCTTGGGAGGCTGAGGATGG + Intronic
1143244218 17:5469034-5469056 CATGCCTTGGGGGCTTGGGAAGG + Exonic
1143554360 17:7651425-7651447 CGTGCTTTTGGGTGTGTGGAGGG + Exonic
1143598221 17:7928455-7928477 CCTGGGTTGGGGGCTTTGGGAGG - Intronic
1143873575 17:9975241-9975263 GCTGCTTGGGAGGCTGTGGCAGG + Intronic
1144124211 17:12186469-12186491 CCAGCTTTGGGGGTTGAGGCAGG - Intergenic
1144361186 17:14495131-14495153 GCTGCTAGGGGGGCTGAGGAAGG - Intergenic
1144848198 17:18230891-18230913 CCTACTCTGGGGAGTGTGGATGG + Intronic
1144882106 17:18435664-18435686 GCAGCTTAGGGGGCTGAGGAGGG - Intergenic
1145150127 17:20508722-20508744 GCAGCTTAGGGGGCTGAGGAGGG + Intergenic
1145721025 17:27072887-27072909 GCTGCTTTGGAGGCTGAGGTGGG + Intergenic
1145804707 17:27718270-27718292 CCTGCTGTGGGGTGTGGGGAGGG - Intergenic
1146436223 17:32851113-32851135 TCTGATTTGGGAGCTGTTGAAGG - Intronic
1146768123 17:35542545-35542567 GCTACTTTGGGGGCTGAGGTGGG - Intergenic
1147252844 17:39163874-39163896 CCTACTCTGGAGGCTGAGGAAGG - Intronic
1147288144 17:39419517-39419539 CCTACTTGGGAGGCTGAGGAAGG - Intronic
1147602738 17:41756009-41756031 CCTGGTGTGGGGTCTGGGGAGGG - Intronic
1147729452 17:42589019-42589041 CCTCCTTGGGGGGCTGAGGCAGG + Intronic
1147968882 17:44209055-44209077 GCTACTCTGGAGGCTGTGGAAGG + Intronic
1147988233 17:44318620-44318642 CTTGCCCTGGGGGCTGAGGAAGG - Exonic
1148177020 17:45575471-45575493 CCTGCTTGGGAGGCTGAGGTGGG - Intergenic
1148263558 17:46205963-46205985 GCTGCTTGGGGGGCTGAGGAGGG + Intronic
1148370127 17:47093028-47093050 GCTGCTTGGGGGGCTGAGGAGGG + Intergenic
1148375642 17:47143082-47143104 GCTGCTTGGGAGGCTGTGGTGGG - Intronic
1148435694 17:47682763-47682785 CCTGGTTTGGGGGAGGAGGAGGG + Exonic
1148808794 17:50277805-50277827 CATGCCTTGGGGGGTGTGGGAGG + Intronic
1149000667 17:51753953-51753975 GCTACTTGGGAGGCTGTGGAGGG - Intronic
1149416664 17:56467003-56467025 GCTGCTTGGGGGGCTGAGGCGGG + Intronic
1149982279 17:61320562-61320584 CCTGCTTGGGAGGCTGAGGCAGG + Intronic
1150295253 17:64003950-64003972 CCTGCCTTGGAGGCTCTGCAGGG + Exonic
1150666759 17:67147431-67147453 CCTGCTTTGGGGCAGGTGAAAGG - Intronic
1150799149 17:68265040-68265062 GCTACTTTGGAGGCTGAGGAAGG + Intronic
1151243857 17:72779311-72779333 GCTGCTTGGGAGGCTGAGGAAGG + Intronic
1151506196 17:74529016-74529038 ACTGCTTGGGGGGCTGAGGTGGG + Intronic
1152044974 17:77929740-77929762 CCAGCTTTGGGGTCTGGAGAAGG - Intergenic
1152080370 17:78183577-78183599 CCTGCTCAGGGGGCTGAGGTGGG + Intronic
1152083629 17:78204326-78204348 CCTGCTTGGGAGGCTGAGGCAGG + Intronic
1152140795 17:78535195-78535217 CCTGCTTTGGGGACAGTGGGAGG + Intronic
1152340516 17:79721594-79721616 CCTGGTGTGGGGGCTGGGGTGGG - Intergenic
1152433901 17:80263757-80263779 CCTGCTATGGGGGCTGCAGGAGG - Exonic
1152713702 17:81888056-81888078 CCTGGTTGGGGGGCGGTGGCTGG - Exonic
1153130797 18:1853704-1853726 CCAGCTTTGGGGGGAGGGGATGG + Intergenic
1153200449 18:2642521-2642543 TCTTCTTTGGGGGCTGAGGCAGG - Intergenic
1153549548 18:6247309-6247331 CCTGCTTTGCAGGCGGTGTATGG - Intronic
1153594111 18:6706478-6706500 GCTACTTAGGGGGCTGAGGAAGG - Intergenic
1153759675 18:8318406-8318428 CCTACTTTGGGGACTGAGGCAGG - Intronic
1153956767 18:10102841-10102863 ACTGCTTTGGAGGCTGAGGCAGG + Intergenic
1154119191 18:11637218-11637240 CCTGCATGGGAGACTGTGGAGGG - Intergenic
1154402614 18:14056009-14056031 CATGCTAGGCGGGCTGTGGAAGG - Intergenic
1154992832 18:21612460-21612482 GCAGCTCTGGGGGCTGTGAAGGG + Intronic
1155169228 18:23254912-23254934 CATGCTGTGGGGGCTGTGTATGG + Intronic
1155267509 18:24107868-24107890 CCTACTTGGGAGGCTGTGGTGGG - Intronic
1155681735 18:28494908-28494930 CCTGCTTTGGGCCCTGTGATTGG - Intergenic
1155861818 18:30910979-30911001 CCTGCTTGGGAGGCTGAGGCAGG - Intergenic
1157041071 18:44039666-44039688 ACTGGTTTGGGGGCTTTTGAAGG - Intergenic
1157406381 18:47425374-47425396 GCTGCATTGGAGGCTGTTGATGG + Intergenic
1157443173 18:47725573-47725595 CCTGCTTTGGCTGCAGTGAAGGG - Intergenic
1157775200 18:50389037-50389059 CCTGTTTTGGGGGCAGTGTTTGG + Intronic
1158345333 18:56510678-56510700 GCTGCTCTGGAGGCTGAGGAAGG - Intergenic
1158507926 18:58063155-58063177 GCTGCTTGGGAGGCTGTGGTAGG - Intronic
1158727216 18:59984459-59984481 CCTGCTTTTGGGGCGGGGGGGGG - Intergenic
1158829811 18:61264419-61264441 CCTGTTCTGGGGGATGTGGCCGG - Intergenic
1159349809 18:67258089-67258111 CCTGTTTTGCAGGCTGGGGAGGG + Intergenic
1159731963 18:72038545-72038567 CCTGCTGTGGGGTCGGGGGAGGG + Intergenic
1160014093 18:75127624-75127646 CCTAGGTTGGTGGCTGTGGACGG - Intergenic
1160082084 18:75737343-75737365 TCTGCTTTGGTGGCTTTGCAGGG - Intergenic
1160166157 18:76514311-76514333 CCAGCTTTGGAGGCTGAGGCAGG + Intergenic
1160538788 18:79609531-79609553 ACTGCTCTGGGGGCTGTGTAGGG - Intergenic
1160679003 19:404618-404640 CCTGCCCTGAGGGGTGTGGAGGG + Intergenic
1160679062 19:404748-404770 CCTGCCCTGAGGGGTGTGGAGGG + Intergenic
1160679077 19:404781-404803 CCTGCCCTGAGGGGTGTGGAGGG + Intergenic
1160679167 19:404975-404997 CCTGCCCTGAGGGGTGTGGAGGG + Intergenic
1160757402 19:764944-764966 CCTGCTTTGGGGGGTGTCTGAGG - Intergenic
1160917968 19:1506745-1506767 CCAGCGTTGGGGTCTGTGCAGGG + Exonic
1160974362 19:1785379-1785401 CCTGCTTTGGGGGCATTGCCAGG - Intronic
1161044524 19:2128126-2128148 CCTGCAGTGGGGGCCGGGGAGGG + Intronic
1161195473 19:2983971-2983993 CCTGCAGTGGGGGCTGGGCAGGG - Intronic
1161231559 19:3177301-3177323 CCTGCTCTGGCGTCTGAGGAGGG - Intronic
1161290286 19:3490500-3490522 CCTGTTGTGGGTGCAGTGGAAGG - Intergenic
1161358277 19:3831810-3831832 CCTGCTGTGGGGGCTGAGCGTGG + Exonic
1161563405 19:4986135-4986157 CCTGCCGTGGGGGCTGTGATGGG + Intronic
1161720367 19:5898923-5898945 CCAGGTCTGGGGGCTGTGGCAGG + Intronic
1161824325 19:6552078-6552100 CGTGCTTTGGGGGCGGGGGCAGG - Intergenic
1161978338 19:7618204-7618226 CCTGCTGTGGGGGCTGAGCTGGG + Exonic
1162136742 19:8560008-8560030 CCTGGTTTGGGGGATGTAGATGG + Intronic
1162180710 19:8867002-8867024 GCTGGCTTGGGAGCTGTGGAAGG + Exonic
1162227584 19:9236396-9236418 GCTGCTTTGGAGGCTGAGGCAGG + Intergenic
1162339732 19:10085418-10085440 CTTGCTTTGGGGGCTCTGCACGG + Intergenic
1162647023 19:12057317-12057339 GCTACTTGGGGGGCTGAGGAAGG + Intergenic
1162809865 19:13157359-13157381 CCTGCTTGGGAGGCTGAGGTAGG - Intergenic
1162987440 19:14280032-14280054 CCTGCTTGGGAGGCTGAGGTGGG - Intergenic
1163317824 19:16553623-16553645 ACTGCTGTGGGGGCCGGGGAAGG + Exonic
1163886478 19:19970174-19970196 GCTGCTTGGGAGGCTGAGGAAGG + Intergenic
1164530166 19:29042447-29042469 GCTACTTTGGGGGCTGAGGTGGG + Intergenic
1164633491 19:29776594-29776616 CCTGCTTGGGAGGCTGAGGCAGG + Intergenic
1164900465 19:31917000-31917022 CCAGCTCTGGGGGCTGAGGCAGG - Intergenic
1165029848 19:32989991-32990013 CCTGCTTGGGAGGCTGAGGCAGG + Intronic
1165083398 19:33324938-33324960 GCTGCTTTGGAGGCTGAGGTGGG + Intergenic
1165400033 19:35593266-35593288 CCTGCTCAGGGGGCTGAGGCAGG + Intergenic
1165775030 19:38399276-38399298 CCTGATTTGGGGGCAATGAAGGG - Intergenic
1165976974 19:39684774-39684796 CCTACTTGGGGGGCTGAGGCAGG - Intergenic
1166190591 19:41174078-41174100 CCTACTTGGGAGGCTGAGGAGGG - Intergenic
1166533690 19:43558221-43558243 GCTACTTGAGGGGCTGTGGAAGG + Intronic
1166557099 19:43707519-43707541 GCTACTTTGGAGGCTGTGGTAGG - Intergenic
1166712421 19:44945807-44945829 GCTGGGTTGGGGGCTGTGGAGGG - Intronic
1167044029 19:47039568-47039590 CCGGGGTTGGGGGCTGTGGCGGG + Intronic
1167088878 19:47329646-47329668 ACTACTTTGGGGGCTGAGGTGGG + Intergenic
1167578045 19:50327099-50327121 CGGGCTGTGGGGGCTTTGGATGG + Intronic
1168103196 19:54152117-54152139 CCCTGTTTGGGGGCCGTGGAGGG - Intronic
1168123725 19:54271260-54271282 CCTTCTTTTGGGGCTGATGACGG - Intronic
1202655459 1_KI270708v1_random:16454-16476 CCAGCTTTGGAGGCTGAGGCAGG + Intergenic
925808017 2:7671725-7671747 CCTTCTTTGGGGGCCAGGGAAGG + Intergenic
925948655 2:8890629-8890651 GCTGCTTTGGAGGCTGAGGTGGG - Intronic
926332378 2:11836289-11836311 CATTTTTTGGGGGCTGAGGAAGG - Intergenic
926685665 2:15695836-15695858 CCAGCTTTAGGGGCTGTCCAAGG - Intronic
926757054 2:16244737-16244759 CCTGCTTTGGGGCCTGGGCCAGG + Intergenic
927125459 2:20009111-20009133 GCTGCTTAGGGGGCTGAGGCAGG + Intronic
927189352 2:20506508-20506530 GCTGCTTTGGTGGCTGTCTAGGG + Intergenic
928102207 2:28445684-28445706 CCAGCGTTGGTTGCTGTGGAAGG - Intergenic
928147259 2:28790167-28790189 CTTGCTTGGGAGGCTGTGGCAGG + Intronic
928175752 2:29033316-29033338 GCTGCTTTCAGGGCTCTGGAAGG + Intronic
928353293 2:30583502-30583524 ACTGCATTGGGGGTTGTGGTGGG - Intronic
928955813 2:36866184-36866206 GCTGCTTAGGGGGCTGAGGTGGG - Intronic
929065416 2:37968326-37968348 CCAGCTTGGGGGGCTGAGGCAGG + Intronic
929277742 2:40043872-40043894 CCTGCCTTGGGGGCGGGGCAGGG + Intergenic
929313516 2:40451903-40451925 CCTGGTTTGGGGAGTGTGAATGG + Intronic
929597635 2:43186381-43186403 CTTGCTTTGGGGGCCAGGGAGGG + Intergenic
929807417 2:45159302-45159324 GCTGCTTAGGAGGCTGAGGAGGG - Intergenic
929967374 2:46545201-46545223 CCTTCATTGGAGGATGTGGAGGG + Intronic
929971213 2:46578642-46578664 GCTACTTGGGGGGCTGAGGAAGG + Intronic
931213323 2:60218137-60218159 CCTGCTTGGGAGGCTGAGGCAGG - Intergenic
931414786 2:62070917-62070939 CCTGCTTGGGAGGCTGAGGCAGG + Intronic
932339886 2:70956712-70956734 CCTGCTTGGGAGGCTGAGGCAGG - Intronic
932414116 2:71563625-71563647 CCCGCTCTTGGGGCTGAGGAAGG + Intronic
932454462 2:71838839-71838861 CTTGCTTTGGGGGTGGAGGAGGG + Intergenic
932485474 2:72081916-72081938 CCTGCTATGGGGGCTGAGTTGGG - Intergenic
932713134 2:74082375-74082397 ATTGCTCTGGGGTCTGTGGACGG + Intronic
933090007 2:78107584-78107606 CCGGCAATGGGGGCTTTGGAGGG + Intergenic
933698321 2:85236670-85236692 CATGCTCTGGGGGCTGTGTTGGG + Intronic
934471388 2:94542840-94542862 AGTGCTTTGCGGGCTGTGGTAGG - Intergenic
934538098 2:95153099-95153121 CCTGCTGGGTGGGCTTTGGAGGG + Intronic
934708024 2:96498251-96498273 CCTGCTCTGAGGGTTGAGGAAGG - Exonic
935473899 2:103494336-103494358 CCAGCTTGAGGGGCTGTGGGAGG + Intergenic
936351073 2:111713051-111713073 CCTGCCATGGAGGCTGTGCAGGG + Intergenic
936473766 2:112822190-112822212 CCTCCTCTGGGGGCTCTGCAAGG + Intergenic
937032107 2:118749597-118749619 CCTGGAATAGGGGCTGTGGATGG - Intergenic
937061607 2:118984149-118984171 CCTGATTGTGGGGCTGGGGAGGG - Intronic
937445004 2:121950107-121950129 CCTGCTGTGGGAGCTGCCGATGG + Intergenic
938088152 2:128415123-128415145 CCTTCTTTGGAGGCTGAGGCAGG + Intergenic
938339663 2:130527058-130527080 CCTGCTGTGAGGGGTGGGGAGGG + Intronic
938350173 2:130593692-130593714 CCTGCTGTGAGGGGTGGGGAGGG - Intronic
938646010 2:133330783-133330805 CCTACTTGGGAGGCTGAGGAAGG + Intronic
938972011 2:136441604-136441626 CCTGATCTGGTGGCTTTGGAGGG - Intergenic
939219398 2:139282025-139282047 CCTGCTTTGGTGGAGGTGGCAGG - Intergenic
939492363 2:142892022-142892044 CCTAATTGGGGGGCTGAGGAGGG - Intronic
940207464 2:151219728-151219750 GCTACTTGGGGGGCTGAGGAGGG - Intergenic
940343437 2:152604705-152604727 GCTACTTGGGAGGCTGTGGAAGG - Intronic
942307089 2:174619193-174619215 CATGCTTTGGAGGCTGAGGTGGG - Intronic
942445220 2:176073015-176073037 CCTGGGATGGGGGCTCTGGAGGG - Intergenic
942518628 2:176779615-176779637 GCTGTTTTGGAGGATGTGGAGGG - Intergenic
942551439 2:177123817-177123839 GCTGCTTGGGTGGCTGAGGAAGG - Intergenic
943150076 2:184100393-184100415 CCTACTTGGGAGGCTGTGGCAGG - Intergenic
943364542 2:186957031-186957053 GCTACTTTGGGGGCTGAGGCAGG - Intergenic
943828847 2:192432049-192432071 TCTGCTTTGGAGGCTGGGGTGGG - Intergenic
944081419 2:195792783-195792805 CCTGATGTGGGGGCAGGGGAGGG + Intronic
944180742 2:196890043-196890065 GCTACTTGGGGGGCTGGGGAAGG - Intronic
944598147 2:201281200-201281222 CCTGCTTGGGAGGCTGAGGCAGG + Intronic
944636935 2:201683638-201683660 GCTGCTTTGGAGGCTGAGGCAGG + Intronic
945349332 2:208758999-208759021 CCTGCTTGGGAGGCTGAGGTGGG - Intronic
946237335 2:218332262-218332284 GCTGCGCTGGGGGCAGTGGAAGG + Intronic
946333444 2:219022897-219022919 CCAGCTTTGGGGACCATGGATGG + Intronic
946379601 2:219336922-219336944 CCTACTTAGGAGGCTGAGGAAGG + Intergenic
946711058 2:222505821-222505843 GCTACTTGGGGGGCTGAGGAAGG + Intronic
947444597 2:230154462-230154484 CCTGTTTTGGGGGTTGGGGTAGG + Intergenic
947601886 2:231456599-231456621 CCTGGTTAGGGTGCTGTGGTTGG - Intronic
947675598 2:231976515-231976537 GCTACTTGGGGGGCTGTGGTGGG + Intronic
947783455 2:232792249-232792271 CCTAGTTTGGGGGCTTTGGGTGG - Intronic
947850542 2:233284257-233284279 GCTGCTTGGGAGGCTGAGGAAGG - Intronic
948502488 2:238405596-238405618 GCTGCTTGGGAGGCTGAGGAAGG + Intergenic
948757331 2:240167312-240167334 CCTGCCTTGGGGTCAGGGGATGG - Intergenic
948947446 2:241228286-241228308 CATGCTGTGAGGGCTGAGGACGG - Exonic
949020162 2:241736432-241736454 CCTCCTCTGGAGGCTTTGGAGGG - Intronic
1168791120 20:576754-576776 GCTACTTGGGGGGCTGAGGAAGG - Intergenic
1168912857 20:1463789-1463811 TCTGCTGTGGGTGCTGTGGGAGG + Intronic
1169430039 20:5528263-5528285 GCTGCTCTGGAGGCTGAGGAAGG + Intergenic
1169599882 20:7246020-7246042 CCTACTTTGGAGGCTGAGGCAGG - Intergenic
1169820743 20:9707229-9707251 GCTGCTTTGGAGGCTGAGGTGGG - Intronic
1170126458 20:12969580-12969602 CCCTCTTTGGGGTCTGTGGGTGG + Intergenic
1170361530 20:15551754-15551776 GCTGCTTTGGAGGCTGAGGCAGG + Intronic
1170780793 20:19423714-19423736 CCTACTGTGGGGGCTGGGCAGGG - Intronic
1170935777 20:20807864-20807886 GCTACTTTGGAGGCTGTGGCGGG - Intergenic
1171247653 20:23625612-23625634 CCTACTTTGAGGGGAGTGGAGGG - Intergenic
1171291605 20:23985804-23985826 CATGGCTTGGGGGCTGTGCAGGG + Intronic
1171875745 20:30574043-30574065 CCTACTTTGGAGGCTGAGGTGGG + Intergenic
1172020859 20:31913046-31913068 GCTACTTTGGGGGCTGAGGTGGG + Intronic
1172250814 20:33477836-33477858 TCTGCACTGGAGGCTGTGGAAGG + Intergenic
1172413419 20:34743246-34743268 GCTGCTGTGGTGGCTGTGGTGGG + Exonic
1172710785 20:36921645-36921667 CCTACTTGGGAGGCTGAGGAAGG - Intronic
1172866455 20:38102970-38102992 AGTGCTTTGGGGGCTGAGGAGGG + Intronic
1172902523 20:38345385-38345407 GCTACTTAGGGGGCTGTGGTGGG + Intergenic
1173160759 20:40650730-40650752 CGTGCTTATGGGGCTGAGGAGGG - Intergenic
1173176924 20:40771658-40771680 CTTGCTTTGAGGGCTTTGTAGGG - Intergenic
1173769285 20:45644452-45644474 GCTGCTTGGGGGGCTGAGGTGGG - Intergenic
1174542157 20:51297993-51298015 CCTACTTGGGAGGCTGTGGCAGG + Intergenic
1174570788 20:51499629-51499651 GCTGCTTTGGAGGCTGAGGCAGG + Intronic
1174905525 20:54546546-54546568 CCTGCTGTGGGGTCAGGGGAGGG - Intronic
1175129586 20:56779405-56779427 CAGGTTTTGGGGGATGTGGAGGG + Intergenic
1175333744 20:58181642-58181664 CCTACCTTGGAGGCTTTGGAAGG - Intergenic
1175340085 20:58223065-58223087 CTTGTTTTGGCGGCTGTGGAAGG - Exonic
1175708260 20:61197475-61197497 GCAGCTTTCGGGGGTGTGGATGG + Intergenic
1176051036 20:63119916-63119938 GCTGGCTTGGGTGCTGTGGAGGG - Intergenic
1176417834 21:6488896-6488918 CCTACTTGGGAGGCTGAGGAAGG - Intergenic
1177494767 21:21873986-21874008 GCTGCTTTGGAGGCTGAGGCAGG + Intergenic
1177830430 21:26133124-26133146 GCTACTTAGGAGGCTGTGGAGGG + Intronic
1177903887 21:26951565-26951587 GCTGCTTGGGGGGCTGAGGCAGG + Intronic
1178474575 21:32926246-32926268 CCTGCTTTGTGGTCTGTTGGTGG - Intergenic
1178481944 21:32987137-32987159 CCTGCTGAGGAGGCTGGGGAGGG + Intergenic
1179408691 21:41145520-41145542 GCTGCCTGGGGGGCTGTGGTGGG - Intergenic
1179417147 21:41208080-41208102 CCTCCTTAGGTGGCTGTGTATGG - Intronic
1179531128 21:42020355-42020377 CCTGGTGTGAGGGCTGAGGATGG + Intergenic
1179675851 21:42981669-42981691 GCTACTTTGGGGGCTGTGGCGGG - Intronic
1179678436 21:43000769-43000791 GCTGTTTAGGGGGCTGTGGTGGG + Intronic
1179693328 21:43097227-43097249 CCTACTTGGGAGGCTGAGGAAGG - Intronic
1180636562 22:17266780-17266802 CTTGATCTGGGGGCTGGGGAAGG + Intergenic
1181300431 22:21876290-21876312 CCTACTTTGGAGGCTGAGGCTGG - Intergenic
1181400343 22:22647131-22647153 CATGGCTTGGGGGCTGTGCAGGG - Exonic
1181560802 22:23698473-23698495 GCTGCTTGGGAGGCTGAGGAAGG - Intronic
1181584008 22:23842996-23843018 CCAGGCTTGGGGGCTGAGGATGG - Intergenic
1181591350 22:23887145-23887167 CCTACTTGGGGGGCTGAGGTGGG - Intronic
1181649022 22:24248660-24248682 CGTGGCTTGGGGGCTGTGCAGGG + Intergenic
1181676480 22:24457199-24457221 GCTGCTTGGGAGGCTGAGGAAGG - Intergenic
1181702322 22:24628229-24628251 CATGGCTTGGGGGCTGTGCAGGG - Intronic
1181735804 22:24880645-24880667 CCTGCATTAGGCACTGTGGATGG - Intronic
1181799774 22:25337669-25337691 GCTGCTTGGGAGGCTGAGGAGGG + Intergenic
1181821703 22:25481203-25481225 CCTGCTTGGGAGGCTGAGGCAGG - Intergenic
1182071088 22:27464125-27464147 CCTGCCTGGGGGACTGTGGAGGG + Intergenic
1182231391 22:28839936-28839958 GCTACTTGGGGGGCTGAGGATGG + Intergenic
1182497898 22:30723523-30723545 GCTGCTTTGGAGGCTGAGGCAGG - Intronic
1182679187 22:32065053-32065075 CCTACTTAGGAGGCTGAGGAGGG - Intronic
1182750959 22:32641916-32641938 CCATCTTTGGAGGCTGGGGAGGG - Intronic
1182759282 22:32708930-32708952 GCTGCTTTGGGGGCTGTGCACGG + Intronic
1182926047 22:34126276-34126298 CCTGCTTGGGAGGCTGAGGCAGG + Intergenic
1182971217 22:34580076-34580098 GCTGCTTTGGAGGCTGAGGCAGG - Intergenic
1184001041 22:41673710-41673732 GCTACTTTGGGGGCTGAGGCAGG + Intergenic
1184072815 22:42156509-42156531 CCTCCTTAGGGGGCTGTGGGAGG - Intergenic
1184431473 22:44443620-44443642 TCTGTTCTTGGGGCTGTGGAAGG + Intergenic
1184696917 22:46144922-46144944 CCTACTCTGGGGGCTGAGGCAGG - Intergenic
1184728298 22:46358598-46358620 CCAGCCTTGGGTGCTGGGGAGGG - Intergenic
1185121018 22:48970130-48970152 GCTGTTGTGGGGGCTGTGGGAGG + Intergenic
1185194532 22:49460844-49460866 CCTGGACTCGGGGCTGTGGAAGG - Intronic
1185343832 22:50302890-50302912 CCTGCTTTGGAGGAGATGGAGGG - Intronic
949947728 3:9203524-9203546 TCTCCTTTGAGGGCTGTAGAGGG - Intronic
950251195 3:11467010-11467032 GCTGCTTTGGAGGCTGAGGCAGG + Intronic
950319979 3:12042626-12042648 CCTGAATTGGGGGATGGGGAGGG - Intronic
951026301 3:17834221-17834243 GCTGCTTGGGAGGCTGAGGAGGG - Intronic
952014736 3:28942804-28942826 CTTGCTTTGGGCTCTTTGGATGG + Intergenic
952443137 3:33353774-33353796 CCTGCTTGGGAGGCTGAGGCGGG + Intronic
952776566 3:37052129-37052151 CCTACTTGGGGGGCTGAGGCAGG + Intergenic
952963604 3:38607858-38607880 GCTGGTTGGGGGGCTGTAGAAGG + Intronic
953006422 3:38983362-38983384 CAGGCTTTGGGAGCTGAGGAAGG + Intergenic
953241818 3:41156128-41156150 CCTGCTTTGTGGAATGTGGATGG - Intergenic
953723503 3:45377275-45377297 CCTACTTGGGAGGCTGTGGCAGG - Intergenic
954108178 3:48420184-48420206 AGGGCTTTGGGGGCTGTGGGTGG + Exonic
954174457 3:48833145-48833167 GCTACTTGGGGGGCTGAGGAAGG - Intronic
954182573 3:48893137-48893159 GCTGCTTGGGGGGCTGAGGTGGG - Intronic
954193586 3:48982644-48982666 CCTGCCTTTGGGAGTGTGGAGGG + Intronic
954214168 3:49115263-49115285 GCTGCTTCGGGCGCTGTGGAAGG - Exonic
955281670 3:57600136-57600158 GCTACTTTGGGGGCTGAGGTGGG - Intergenic
955304492 3:57816253-57816275 GCTGCTTGGGGGGCTGAGGCAGG - Intronic
955764250 3:62324279-62324301 GCTGCTTGGGAGGCTGTGGCAGG + Intronic
956248288 3:67208869-67208891 CCTGCTTGGGAGGCTGAGGCAGG + Intergenic
956315001 3:67925289-67925311 GCTTCTTTGGAGGCTGAGGAGGG + Intergenic
956442614 3:69295112-69295134 CCTACTTTGGGGGTTGTTGGAGG - Intronic
956448624 3:69350817-69350839 CCTGCCTTGGGGTGTGGGGAGGG + Intronic
956979270 3:74616680-74616702 GCTGCTTGGGAGGCTGTGGCAGG + Intergenic
957051867 3:75417755-75417777 TGTGCTCTGGGGGCTGTGGCAGG + Intergenic
957550529 3:81697786-81697808 CCTGCTTTGGAGCAGGTGGAAGG + Intronic
957645750 3:82922909-82922931 CCAGCGTTGAGGGGTGTGGATGG + Intergenic
958845216 3:99258043-99258065 CCTACTTGGGGGGCTGAGGCAGG + Intergenic
958866628 3:99508424-99508446 CTTGATTTGGGGGCTGGGCAGGG - Intergenic
960136204 3:114108153-114108175 CCTGCTTGGGTGGCTGAGGCGGG + Intergenic
960923618 3:122774261-122774283 CCTGATTTGGGGTATGGGGAAGG + Intronic
961042206 3:123685479-123685501 GCTGCTTTGGAGGCTGAGGTGGG + Intronic
961453110 3:127011395-127011417 CCTGCCTTGGGGGCTGTTGCAGG + Intronic
961832981 3:129633925-129633947 CCCGCCCTGGGGGCTGTGGTGGG + Intergenic
961885475 3:130093987-130094009 TGTGCTCTGGGGGCTGTGGCAGG + Intronic
962198924 3:133385519-133385541 CCTCCTTTGGAGGCTGAGGGAGG - Intronic
962531307 3:136283391-136283413 CCTTCTGTGGAGGGTGTGGAGGG + Intronic
962780442 3:138710075-138710097 GCTACTTGGGGGGCTGAGGAGGG + Intronic
963149134 3:142025850-142025872 GCTACTTGGGGGGCTGAGGAAGG + Intronic
963350660 3:144147483-144147505 GCTACTTTGGGGGCTGAGGCAGG - Intergenic
963440689 3:145335676-145335698 CCTACTTGGGAGGCTGAGGAAGG - Intergenic
963444683 3:145388932-145388954 GCTGCTTGGGAGGCTGAGGAAGG + Intergenic
964318349 3:155467460-155467482 GCTACTTTGGAGGCTGAGGAAGG + Intronic
964348318 3:155777550-155777572 CCTACTTGGGGGGCTGAGGCCGG - Intronic
964499709 3:157335284-157335306 GCTACTTTGGGGGCTGCGGTGGG + Intronic
964604938 3:158550370-158550392 CCTACTTTGGAGGCTGAGGCAGG + Intergenic
966214360 3:177486900-177486922 CCTACTTGGGGGGCTGAGGCAGG - Intergenic
966395248 3:179495363-179495385 CCTACTTGGGGGGCTGAGGTGGG + Intergenic
966589356 3:181663661-181663683 CCTTCTTTCTGGGCTGAGGAAGG - Intergenic
966593300 3:181704248-181704270 CCATCTTTGAGGGCTGAGGAGGG + Intergenic
966740410 3:183227632-183227654 TCTGCTTTGGGGACCATGGATGG + Intronic
967811406 3:193764099-193764121 CCTGCTTTGGGGCCTTTGTACGG + Intergenic
968080443 3:195842886-195842908 GCTGCTTGGGGGGCTGAGGCAGG - Intergenic
968887150 4:3341153-3341175 CCGTCTTTAGGGGCTGTGGGCGG + Intronic
969138932 4:5052181-5052203 CCTGCACTTGGGGGTGTGGAAGG + Intronic
969175281 4:5394090-5394112 CCTGCTTTGCAGTCTGTGCATGG + Intronic
969375775 4:6762181-6762203 CCAGCTTTGGGGGCTGGGCCAGG + Intergenic
969577781 4:8046545-8046567 GCTGCAGTGGGGGCTGTGGTCGG - Intronic
969855409 4:9995153-9995175 TCTGCTGTGGGGTCTGTAGATGG - Intronic
970048254 4:11881015-11881037 GCTGCTTGGGAGGCTGTGGCAGG - Intergenic
971277454 4:25211493-25211515 CCTGCCTTGGGGCATGTGAAAGG + Intronic
971286192 4:25292126-25292148 GCTACTTTGGGGGCTGAGGAAGG - Intergenic
971290722 4:25336596-25336618 GCTGCTGGGGAGGCTGTGGAAGG - Intronic
971888603 4:32486177-32486199 GCTGTTTTGGGGACTGTGCAGGG - Intergenic
973810347 4:54563589-54563611 GCTGCTTTGGAGGCTGAGGCAGG - Intergenic
974014255 4:56634572-56634594 CCTGCTTCTGGGGCTGTTGCAGG - Intergenic
974297810 4:60025416-60025438 CCTACTTCGGAGGCTGAGGAAGG - Intergenic
974824589 4:67111538-67111560 CCTCCTCTGGAGGCTCTGGAGGG - Intergenic
975893882 4:79062764-79062786 CAAACTTTGGGGGCTGTGTAAGG - Intergenic
975900104 4:79141339-79141361 CCTGAGGTGGGTGCTGTGGATGG + Intergenic
976126654 4:81840329-81840351 GCTACTTTGGAGGCTGTGGTGGG - Intronic
977073178 4:92418722-92418744 CCTTTTTAGGGGGGTGTGGAAGG - Intronic
977209744 4:94205641-94205663 GCTACTTTGGGGGCTGAGGCAGG - Intergenic
977554427 4:98474457-98474479 GCTACTTGGGGGGCTGAGGAGGG - Intronic
977582578 4:98741838-98741860 GCTGCTTGGGAGGCTGAGGAGGG + Intergenic
978259077 4:106730651-106730673 CCTGCTTTTGGTGCTGTACAAGG + Intergenic
978508451 4:109487051-109487073 GCTGCTTTGGAGGCTGAGGCAGG + Intronic
978784996 4:112599608-112599630 GCTACTTGGGAGGCTGTGGAGGG + Intronic
979495828 4:121381036-121381058 CCCGCTTGGGGAGCGGTGGAGGG + Exonic
980469151 4:133228346-133228368 GCTGCTTAGGGGGCTGAGGCCGG + Intergenic
982147203 4:152407814-152407836 GCTACTTTGGGGGCTGAGGTTGG - Intronic
983395350 4:167186863-167186885 CCTGCTTGGGAGGCTGAGGCAGG + Intronic
983795953 4:171863867-171863889 ACTACTTTGGGGGCTGAGGCAGG - Intronic
983920837 4:173342726-173342748 GCTGCTTGGGAGGCTGAGGAAGG - Intergenic
985108399 4:186521265-186521287 CCTACTTGGGGGGCTGAGGCAGG + Intronic
985400407 4:189587946-189587968 CCTGCTTGGGAGGCTGAGGTGGG - Intergenic
985439462 4:189969677-189969699 CCTGCTGTGGGGTCAGGGGAGGG + Intergenic
985469833 5:33374-33396 CCTGGTGTGGGGGGTGGGGAAGG - Intergenic
985697289 5:1347804-1347826 CCTGCTGTGAGGGCTGTGGGCGG + Intergenic
985811951 5:2096820-2096842 TCTCCTCTGGGGGCTGTGGGAGG - Intergenic
986279936 5:6314546-6314568 CCTCCTCTGGAGGCTTTGGAGGG + Intergenic
986896029 5:12369710-12369732 CCTTGTTTGGGGGTTGTGGGAGG + Intergenic
986948819 5:13057503-13057525 GCTGCTTTGGAGGCTGAGGTGGG - Intergenic
987465557 5:18268009-18268031 CCTAAGTTGGGGGGTGTGGAAGG - Intergenic
988052155 5:26044267-26044289 GCTACTTGGGGGGCTGAGGAGGG + Intergenic
988570161 5:32357375-32357397 GCTGCTTTGGAGGCTGAGGCAGG - Intronic
988573128 5:32391843-32391865 TCTGCTTGGGGGGCTGAGGTGGG - Intronic
988575137 5:32415175-32415197 CCTGCTTTGGGGGCTGAAGTAGG + Exonic
988599697 5:32628202-32628224 CCTGCTTGGTCGGCTGTGTAAGG + Intergenic
988691478 5:33576847-33576869 CCTTCTTTGGAGGCTGTGGTAGG + Exonic
988895885 5:35674525-35674547 CCTGTTTTGGGGTCGGGGGAGGG - Intronic
990450894 5:55930702-55930724 GTTGCTTTGGGGGCTGAGGCAGG + Intergenic
990584140 5:57193500-57193522 CCTGCTTGCGGGGCTGAGGTGGG + Intronic
990589828 5:57250652-57250674 GCTGCTTGGGAGGCTGTGGCAGG - Intronic
990593972 5:57294698-57294720 CCTGATTTAAGGGATGTGGAAGG - Intergenic
990595781 5:57310983-57311005 GCTACTTGGGGGGCTGAGGAGGG + Intergenic
991329757 5:65481636-65481658 CCTTTTTTGGGGGGTGGGGAGGG - Exonic
991432061 5:66558801-66558823 CCCGCTTTGTGGTCTTTGGAGGG - Intergenic
992066030 5:73110069-73110091 GCTACTTTGGAGGCTGTGGTGGG - Intergenic
992257125 5:74932429-74932451 CCTGCTTGGGAGGCTGAGGCAGG - Intergenic
992444791 5:76823922-76823944 GCTGCTTGGGAGGCTGTGGCAGG - Intronic
992539148 5:77744645-77744667 GCTGCTTGGGGGGCTGAGGCAGG - Intronic
993546493 5:89219303-89219325 ACTACTTTGGAGGCTGTGGCAGG - Intergenic
995010315 5:107249991-107250013 GCTCCTTTGGGGGCTGCAGATGG - Intergenic
995239584 5:109870715-109870737 GCTGCTTTGGAGGCTGAGGCAGG + Intergenic
995448354 5:112272244-112272266 CCTGCTTGGGAGGCTGAGGCAGG - Intronic
995876961 5:116800641-116800663 GCTGCTTGGGAGGCTGAGGAAGG - Intergenic
996141281 5:119912894-119912916 CCTGCTTTGGTGGAGGTGGCAGG + Intergenic
996286857 5:121804304-121804326 GCTGCTTGGGGGGCTGAGGTAGG - Intergenic
996629280 5:125607987-125608009 CCTGATTAGGTGGCTTTGGAGGG - Intergenic
996771704 5:127093323-127093345 GCTGCTTAGGGGGCTGAGGCAGG - Intergenic
997079969 5:130726668-130726690 CCTGCCTTGGGGCCGGTGAAAGG - Intergenic
997145406 5:131427989-131428011 CCTACTTGGGAGGCTGAGGAGGG + Intronic
997269625 5:132525899-132525921 GCTGCTTGGGAGGCTGAGGAAGG + Intergenic
997361323 5:133296926-133296948 CCTGCCTTGGGGGCTGGGGCTGG + Intronic
997447854 5:133954665-133954687 ACTGTTTTGCAGGCTGTGGAGGG - Intergenic
997518140 5:134505280-134505302 GCTACTTTGGGGGCTGAGGCAGG + Intergenic
997610132 5:135209974-135209996 CCTGGTTGGGGAGGTGTGGATGG - Intronic
997826578 5:137111961-137111983 CCTTATTTGGGGCCTGTGCAGGG + Intronic
998618460 5:143767754-143767776 CCTGATTTAGAGGATGTGGATGG + Intergenic
999053688 5:148550954-148550976 CCTGAGCTGGGGGCTGTGGCAGG - Intronic
999075597 5:148792705-148792727 TCTGCTTTGGGGCCTGCTGAGGG - Intergenic
999465318 5:151798236-151798258 CCTGCTTGGGAGGCTGAGGTAGG + Intronic
999779768 5:154839882-154839904 CCTGCCTTGAGTGCTGTGGTTGG - Intronic
1000335953 5:160241645-160241667 GCTACTTGGGGGGCTGTGGTGGG + Intergenic
1000637658 5:163662135-163662157 CCTGCTTGGGAGGCTGAGGTAGG + Intergenic
1000806328 5:165797737-165797759 CCTACTTTGGAGGCTGAGGCAGG - Intergenic
1001048415 5:168394095-168394117 CATGCTGTAGGGGCTGGGGAAGG + Intronic
1001178150 5:169492097-169492119 GCTGCTTTGGAGGCTGAGGCAGG + Intergenic
1001507486 5:172291379-172291401 GCTACTTGGGGGGCTGTGGCAGG - Intergenic
1002077455 5:176717444-176717466 CCTCCTTTGTAAGCTGTGGAGGG - Intergenic
1002413160 5:179100255-179100277 GCTACTTTGGAGGCTGGGGAGGG + Intergenic
1002545332 5:179939103-179939125 GCTGCTTGGGGGGCTGAGGCAGG + Intronic
1002632935 5:180592917-180592939 CCTGCTTGGGAGGCTGAGGTGGG - Intergenic
1002911216 6:1492303-1492325 GCTACTTGGGAGGCTGTGGAGGG - Intergenic
1003193780 6:3897060-3897082 CCTACTTTGGAGGCTGAGGCAGG - Intergenic
1004070033 6:12289417-12289439 CCTGGCTTGGGGGCCGAGGAGGG - Intergenic
1004119690 6:12808868-12808890 CTTTCTTTGGGGGCGGTGGGTGG + Intronic
1006000958 6:30964775-30964797 GCTGTGTTGGGAGCTGTGGAAGG - Intergenic
1006058754 6:31404214-31404236 GCTGCTGTGGGGACTGTGGGGGG + Intronic
1006067319 6:31471470-31471492 ACAGCTTTGGGGGCTTAGGAAGG + Intergenic
1006071239 6:31499099-31499121 GCTGCTGTGGGGACTGTGGGGGG + Intronic
1006076770 6:31538265-31538287 CCTGCTTGGGAGGCTGAGGCAGG - Intronic
1006511882 6:34525959-34525981 CCAGCTCTGGGGGCTGGGGCTGG + Intronic
1006718362 6:36134502-36134524 CCTACTTGGGGGGCTGAGGCGGG - Intronic
1006761321 6:36464428-36464450 GCTGCTCAGGAGGCTGTGGAAGG - Intronic
1006771190 6:36554265-36554287 GCTACTTTGGGGGCTGAGGTGGG + Intergenic
1006809790 6:36812482-36812504 CCTGCTTAGTGGACTGTGGTAGG - Intronic
1006992139 6:38224099-38224121 GCTACTTTGGGGGCTGAGGTGGG + Intronic
1007179005 6:39915196-39915218 CCTGCTCCAGGTGCTGTGGAGGG - Intronic
1007926746 6:45655876-45655898 TCTGCTTTGGGGTTTGGGGAGGG - Intronic
1009601854 6:65811516-65811538 GCTGCTCTGGAGGCTGAGGAAGG - Intergenic
1009686216 6:66960917-66960939 GCTACTTTGGAGGCTGAGGAAGG + Intergenic
1010144034 6:72645272-72645294 GCTACTTGGGAGGCTGTGGAGGG + Intronic
1010243476 6:73639932-73639954 CCTACTTGGGAGGCTGAGGAAGG + Intronic
1010797806 6:80137977-80137999 CCTGCTTTGGAGGCTGAAGCAGG + Intronic
1010964698 6:82191082-82191104 ACTGGTTTGGGGGCTTTTGAAGG + Exonic
1011073910 6:83417490-83417512 CCTGCTTAGGAGGCTGAGGCAGG - Intronic
1011412200 6:87077464-87077486 CCTGCTTGGGAGGCTGAGGTGGG + Intergenic
1012181224 6:96155559-96155581 GCTGCTTGGGAGGCTGAGGAAGG + Intronic
1013513420 6:110864069-110864091 CCTACTTGGGGGGCTGAGGCAGG - Intronic
1013986341 6:116198617-116198639 CCTGCTTGGGAGGCTGAGGCAGG + Intronic
1014007014 6:116430651-116430673 GCTACTTGGGGGGCTGAGGAAGG - Intronic
1014745322 6:125193562-125193584 ACTGCTGTGGGTGCTGAGGAAGG + Intronic
1014791838 6:125681477-125681499 GCTGCTCTGGAGGCTGAGGAAGG - Intergenic
1015586176 6:134778928-134778950 GCTGCTTAGGGGGCTGAGGTGGG - Intergenic
1015593323 6:134843230-134843252 CCTGCCTTGGGGCCAGTGGAAGG - Intergenic
1016050394 6:139524476-139524498 GCTGCTTTGGAGGCTGAGGCAGG - Intergenic
1016772913 6:147872215-147872237 CCTGCTTGGGAGGCTGAGGTGGG - Intergenic
1017459442 6:154635347-154635369 CCTGCTTGGGAGGCTGAGGCAGG - Intergenic
1017872097 6:158495162-158495184 GCTACTTTGGGGGCTGAGGCAGG - Intronic
1018677512 6:166235851-166235873 CCAGCCTGGGTGGCTGTGGAAGG + Intergenic
1018762576 6:166904635-166904657 CCTGTGTTGGGAGCTGTGGCGGG - Intronic
1019126641 6:169845224-169845246 GCTGCTTTGGGGGCAGAAGAGGG - Intergenic
1019255220 7:45540-45562 CCTGCCTTTGGGGCTGTGAAGGG - Intergenic
1019286973 7:228520-228542 ACTGCCATGGGGGCTGTGGAGGG + Exonic
1019558324 7:1643490-1643512 CGTGCTTTGGGAGGTGAGGAGGG - Intergenic
1019563054 7:1667384-1667406 GCAGCTTCGGGGGTTGTGGAGGG + Intergenic
1019574047 7:1727718-1727740 CCTGCTTGGGAGGCTGAGGCAGG - Intronic
1020151446 7:5684894-5684916 CCTGCATGGGGGGCTGGGGGTGG + Intronic
1020186277 7:5961782-5961804 GCTACTTGGGGGGCTGTGGTGGG - Intronic
1020212617 7:6167475-6167497 CCTGCTCTGGAGTCTCTGGAGGG - Intronic
1020296637 7:6762992-6763014 GCTACTTGGGGGGCTGTGGTGGG + Intronic
1020603395 7:10304996-10305018 GCTGCTTTGGGGTCTGAGGCAGG + Intergenic
1021749605 7:23782358-23782380 GCTGCTTTGGAGGCTGAGGCAGG + Intronic
1021849944 7:24797529-24797551 GGTGCTTTGGGGCCTGGGGAGGG + Exonic
1022034275 7:26519007-26519029 CCAGCTTTGTGGGGTGGGGAGGG - Intergenic
1022199362 7:28101630-28101652 GCTACTTGGGAGGCTGTGGAGGG + Intronic
1022256737 7:28665765-28665787 GCTGCTTGGGAGGCTGTGGTGGG + Intronic
1022309836 7:29186458-29186480 GCTGCTTGGGAGGCTGAGGAGGG + Exonic
1022579720 7:31539294-31539316 GCTACTTGGGGGGCTGTGGTGGG - Intronic
1023403274 7:39806283-39806305 GCTGCTTGGGGGGCTGAGGCAGG - Intergenic
1023526462 7:41108407-41108429 CCTGATTTGGGGGCTGTGTGTGG + Intergenic
1023832920 7:44050547-44050569 CCTGCGTTGGGAGCTGCGGTGGG + Intronic
1024674892 7:51629641-51629663 TCTTCTTTGGGGACTGGGGAGGG - Intergenic
1024857512 7:53798653-53798675 CCTGTTTTGTGGGATGTGGGGGG - Intergenic
1025636182 7:63321453-63321475 GCTGCTTGGGTGGCTGAGGAAGG + Intergenic
1025646514 7:63426723-63426745 GCTGCTTGGGTGGCTGAGGAAGG - Intergenic
1025815693 7:64909019-64909041 GCTACTTTGGGGGCTGAGGTAGG - Intronic
1025914803 7:65857032-65857054 GCTGCTTGGGAGGCTGAGGAAGG + Intergenic
1026014116 7:66659338-66659360 GCTGCTTGGGAGGCTGTGGCAGG + Intronic
1026255280 7:68705879-68705901 GCTGCTTGGGGGGCTGAGGCAGG + Intergenic
1026341964 7:69442213-69442235 GCTGCTTGGGGGGCTGGGGTGGG - Intergenic
1026349072 7:69499909-69499931 GCTACTTTGGGGGCTGAGGCAGG - Intergenic
1026573549 7:71553213-71553235 GCTACTTTGGGGGCTGAGGTGGG + Intronic
1026701144 7:72646481-72646503 GCTGCTTGGGGGGCTGAGGCAGG - Intronic
1026892694 7:73991843-73991865 GCTCCTTTGTGGGCTCTGGAAGG - Intergenic
1026972066 7:74474499-74474521 CATGCCTGGGGGGCTGTGCAGGG + Intronic
1027520487 7:79200497-79200519 CCTACTTGGGGGGCTGAGGTGGG + Intronic
1027850411 7:83444780-83444802 GCTGCTCTGGGGGCTGAGGCAGG - Intronic
1028047582 7:86142218-86142240 ATTGCTTTGGGGTCTGTTGATGG - Intergenic
1028404018 7:90456828-90456850 ACTGCTTGGGGGGCTGAGGAGGG - Intronic
1029431257 7:100532207-100532229 GCTACTTGGGGGGCTGAGGAGGG + Intergenic
1029488009 7:100854796-100854818 CCTGCTAGGGAGGGTGTGGAAGG + Intronic
1029938977 7:104459526-104459548 TCTGCTATGGGGGATGTGGAAGG + Intronic
1030054049 7:105566164-105566186 CCTGCTTGGGAGGCTGAGGCAGG + Intronic
1030314341 7:108098501-108098523 CCTGCCTTAGGGTCTGTGGCCGG - Exonic
1030495758 7:110297893-110297915 CCTGCTTTGGGGGAGATGGATGG - Intergenic
1030681746 7:112441342-112441364 GCGGCTTTGGAGGCTGTGGTGGG + Intronic
1031563359 7:123264789-123264811 CCTGTTGTGGGGGCAGGGGAGGG - Intergenic
1032009713 7:128336858-128336880 CCTGCTTGGGAGGCTGAGGCAGG - Intronic
1032106492 7:129035499-129035521 GCTACTTTGGAGGCTGTGGTGGG + Intronic
1032228783 7:130055739-130055761 GCTGCTTTGGAGGCTGAGGCAGG + Intergenic
1032361019 7:131255001-131255023 CCAGCTCTGGAGGCTGAGGAAGG - Intronic
1032596682 7:133247999-133248021 GCTGCTCTGGGGGCTGAGGCAGG - Intergenic
1033243373 7:139699481-139699503 GCTGGGTTGGAGGCTGTGGATGG - Intronic
1033254602 7:139789354-139789376 GCTACTTTGGGGGCTGAGGCAGG - Intronic
1034260345 7:149751508-149751530 CCTGCTCAGCGGGCTGGGGAGGG - Intergenic
1034264824 7:149775890-149775912 CCAGTTCTGGGGGCTGTGGGGGG - Intergenic
1034427681 7:151023267-151023289 GCTGCTCTGGGGGCTGGGGCAGG - Intronic
1035108925 7:156464284-156464306 TCTGCTCTGAGGGATGTGGAAGG - Intergenic
1035336938 7:158135709-158135731 CCTGCTGTCTGAGCTGTGGAGGG - Intronic
1036134080 8:6142808-6142830 CCTACTTGGGAGGCTGAGGAGGG + Intergenic
1036203719 8:6790418-6790440 CCTGCTTGGGAGGCTGAGGTGGG + Intergenic
1036645901 8:10611381-10611403 CCTGAATTGGGGCCTGGGGACGG + Exonic
1036670956 8:10787336-10787358 GCTCCTTGGGGGGCTGTGGTGGG - Intronic
1037487683 8:19364022-19364044 CCTGCTCTGTGGGCTGATGAGGG + Intronic
1037504223 8:19514719-19514741 GCTGCTTGGGAGGCTGAGGAAGG + Intronic
1038413106 8:27373568-27373590 GCTGCTTGGGGGGCTGAGGCAGG + Intronic
1038555279 8:28508001-28508023 CCTACTTTGGAGGCTGAGGTAGG - Intronic
1038621147 8:29144367-29144389 GCTGCTTGGGGGGCTGAGGCAGG - Intronic
1038629038 8:29223222-29223244 GCTGCTTTGGGGGCTGAGGCGGG + Intronic
1039534450 8:38295448-38295470 GCTACTTTGGGGGCTGAGGTGGG + Intronic
1039551217 8:38444498-38444520 GCTGCTTGGGGGGCTGAGGTGGG - Intronic
1041141155 8:54820634-54820656 CATGCTGTAGGGGATGTGGAGGG + Intergenic
1041311218 8:56518884-56518906 TCTGCTCTGGAGCCTGTGGAGGG + Intergenic
1041517746 8:58720001-58720023 GCTGCTTTGGGGGCTGAGGTAGG + Intergenic
1041865569 8:62569662-62569684 GCTGCTTTGGAGGCTGAGGCAGG + Intronic
1041927079 8:63248262-63248284 GCTGCTGTGGGGGATGGGGATGG + Intergenic
1041930716 8:63283460-63283482 ACTACTTTGGGGGCTGAGGTGGG + Intergenic
1042255677 8:66800871-66800893 GCTACTTTGGAGGCTGTGGTAGG + Intronic
1043429608 8:80182324-80182346 GCTGCTTGGGAGGCTGAGGAGGG + Intronic
1043931949 8:86101346-86101368 GCTGCTTGGGAGGCTGTGGCAGG + Intronic
1044033062 8:87262040-87262062 GCTACTTTGAGGGCTGAGGAAGG + Intronic
1044586989 8:93877334-93877356 CATGCTTTGGGGGAGGTAGAAGG - Intronic
1044722732 8:95166575-95166597 GCTACTTTGGGGGCTGAGGCAGG + Intergenic
1045569181 8:103352130-103352152 GCTACTTTGGGGGCTGAGGCAGG - Intergenic
1045612629 8:103864018-103864040 GCTGCTCTGGGGGCTGAGGCAGG - Intronic
1046644375 8:116768910-116768932 CATGCTTTGGGGGCCGAGGTGGG - Intronic
1046954094 8:120045801-120045823 CCTGGGATGGGGGCTGTGGTGGG - Intronic
1047043195 8:121021783-121021805 CCTGTTGTGGGGGCTGGGGAGGG - Intergenic
1047078619 8:121434364-121434386 GCTACTTTGGGGGCTGAGGCAGG - Intergenic
1047190589 8:122675535-122675557 CCTGCTTTGGCTGCTGGGGTGGG - Intergenic
1047315825 8:123731982-123732004 CCAGCTTGGGGGGCAGGGGATGG + Intronic
1047801965 8:128319273-128319295 CTTGCCTAGGGGGCTGGGGAGGG + Intergenic
1048236649 8:132697504-132697526 GCTGCTTGGGAGGCTGAGGAAGG + Intronic
1049709496 8:144057264-144057286 CCTGCTTTGGGGGAGCTGGTGGG - Exonic
1049805561 8:144537221-144537243 CCTGCTTCTGGGGCTGTGCTAGG + Intronic
1050529796 9:6578649-6578671 GCTACTTTGGGGGCTGAGGTGGG - Intronic
1050763064 9:9097518-9097540 GCTGCTTGGGAGGCTGAGGAAGG - Intronic
1050959258 9:11706368-11706390 CCAGCTTTGGAGGCCGAGGAGGG + Intergenic
1051067384 9:13121146-13121168 CCTGCTTTAGGCCCTGTTGATGG + Intronic
1051416750 9:16849468-16849490 GCTACTTTGGGGGCTGAGGCAGG - Intronic
1051601295 9:18877615-18877637 CCTGCTCTGGTGGCAGTAGAAGG + Intronic
1053237619 9:36469864-36469886 GCTACTTGGGAGGCTGTGGAGGG + Intronic
1053505283 9:38637883-38637905 GCTACTTGGGGGGCTGAGGAGGG - Intergenic
1056066325 9:82939355-82939377 GCTACTTGGGGGGCTGAGGAAGG - Intergenic
1056809519 9:89753520-89753542 CATGCGTTGGGGGCTGTCTAGGG + Intergenic
1056971213 9:91205338-91205360 GCTGCTTGGGAGGCTGAGGAAGG + Intergenic
1057223273 9:93269120-93269142 CTTGCTTTGGGGGGTGGGGTGGG + Intronic
1057376359 9:94526818-94526840 CCTGCTTGGGAGGCTGAGGTGGG + Intergenic
1057463436 9:95288987-95289009 GCTGCTTGGGAGGCTGAGGAGGG + Intronic
1057568339 9:96184521-96184543 CCAGCATTGGGGGCTGTGTGAGG + Intergenic
1058088826 9:100781134-100781156 CCTGCTGTGGGGTCAGGGGAGGG + Intergenic
1058868966 9:109186297-109186319 GCTACTTTGGGGGCTGAGGCAGG - Intronic
1059189187 9:112307340-112307362 GCTACTTTGGGGGCTGAGGTGGG + Intronic
1059229559 9:112706358-112706380 GCTGCTTTGGAGGCTGAGGCAGG - Intronic
1059362488 9:113755877-113755899 GCTGCTTGGGAGGCTGAGGAGGG + Intergenic
1059733516 9:117079242-117079264 GCTTCTTGGGGGGCTGGGGAAGG + Intronic
1060042224 9:120309622-120309644 CCTGCTTAGGAGGCTGAGGCAGG - Intergenic
1060119386 9:120973865-120973887 CCTGCTTTGGAGGCTGAGGCAGG + Intronic
1060156113 9:121320945-121320967 CCTGATTTGGGGTCTGTGTCTGG + Intronic
1060408050 9:123382347-123382369 CCTGCCTTGGGGCCGGGGGATGG + Exonic
1060614736 9:125002592-125002614 GCTGCTTGGGAGGCTGAGGAAGG - Intronic
1060736385 9:126069008-126069030 CCAGCTTTGGGGGCAGCGGTAGG + Intergenic
1060773624 9:126351598-126351620 GCTACTTTGGGGGCTGAGGCAGG - Intronic
1061358370 9:130123613-130123635 CCTACTTGGGGGGCTGAGGCAGG - Intronic
1061488034 9:130930138-130930160 CCTTCTTGGGGGGCTGGGCAAGG + Intronic
1061845339 9:133385082-133385104 CCTACCTAGTGGGCTGTGGATGG - Intronic
1062196610 9:135277643-135277665 CCTGCGTTGGCGGCTCAGGAGGG - Intergenic
1062203526 9:135321759-135321781 CCTCCTTTGGGGGCTGCAGCAGG - Intergenic
1062298738 9:135851364-135851386 GCTGCTTAGGTGACTGTGGAGGG - Intronic
1062456543 9:136642174-136642196 GCTGCTTGGGGGGCTGAGGCAGG - Intergenic
1062505640 9:136874174-136874196 CCTGCTTGGGAGGCTGAGGTGGG - Intronic
1062689250 9:137833002-137833024 TTGGCTTTGGGGGCTGTGGCTGG + Intronic
1185431202 X:13113-13135 CCTACTCTGGAGGCTGAGGAGGG - Intergenic
1185440469 X:225510-225532 CCTACTCTGGAGGCTGAGGAGGG - Intergenic
1185522304 X:750052-750074 GCTGCTTTGGAGGCTGAGGTGGG - Intergenic
1185751899 X:2618046-2618068 CCTGCTTGGGAGGCTGAGGCAGG + Intergenic
1185758661 X:2672681-2672703 GCTGCTTGGGAGGCTGAGGAAGG + Intergenic
1186031644 X:5375474-5375496 GCTGCTTTGGAGGCTGAGGTGGG - Intergenic
1186059956 X:5694195-5694217 CCTGCTTTAGGGGATGGGGCAGG - Intergenic
1186167404 X:6841163-6841185 GCTGCTTGGGAGGCTGAGGAAGG + Intergenic
1186474174 X:9844396-9844418 CCTGCTTGGGAGGCTGAGGCAGG + Intronic
1186612392 X:11150675-11150697 CTTGCTTTGGGAGCTGAGGCAGG + Intronic
1186929152 X:14369544-14369566 CCTACTTGGGAGGCTGAGGAAGG + Intergenic
1187832638 X:23398459-23398481 CTTGCTTTTGGGGATGGGGAAGG + Exonic
1187970645 X:24654639-24654661 GCTGCTCTGGGGGCTGAGGCAGG + Intronic
1188499241 X:30807399-30807421 CCTGCTTGGGAGGCTGAGGTGGG + Intergenic
1189222165 X:39381835-39381857 CCTGCCTTGAGGCCTATGGAAGG - Intergenic
1189278774 X:39806251-39806273 GCTACTTGGGGGGCTGAGGAGGG + Intergenic
1190378342 X:49813275-49813297 GCTACTCTGGGGGCTGAGGAGGG + Intergenic
1190730577 X:53223110-53223132 CCTGCTTTGGGGCATCAGGAAGG - Intronic
1190872443 X:54435584-54435606 CCAGCCCTGGGGGCTGTGGCAGG - Intergenic
1191878308 X:65819174-65819196 CCTGCTTGGGGGGCTGGGGTTGG - Intergenic
1193404304 X:81082918-81082940 CCTGCTCTGGTGGAAGTGGAAGG - Intergenic
1193649860 X:84117881-84117903 CCTGTTTTGGGGGCAGTGGAGGG - Intronic
1193790430 X:85809425-85809447 CCTACTTGGGGGGCTGAGGCAGG + Intergenic
1194094537 X:89620896-89620918 CCTGTTGTGGGGGCGGGGGAGGG + Intergenic
1194876223 X:99191653-99191675 CAGGCTGTGGGGGATGTGGAAGG - Intergenic
1195398704 X:104438843-104438865 GCTGCTTGGGGGGCTGAGGCAGG - Intergenic
1195590232 X:106616082-106616104 CCTGGATTGGGGGTTGTGGGGGG + Intronic
1196727414 X:118908829-118908851 CCTGCTCTGGAGGCTGAGGCAGG - Intergenic
1196858738 X:120007745-120007767 CTTGTAATGGGGGCTGTGGAAGG - Intergenic
1196983245 X:121238963-121238985 CCCGTTTTGGGGACTATGGAAGG + Intergenic
1197210702 X:123825957-123825979 CCTACTTGGGAGGCTGAGGAAGG + Intergenic
1197292915 X:124682147-124682169 GCAGCTTTGGGGGATGTTGATGG - Intronic
1197421037 X:126237542-126237564 CATGCTTGGGGGGCTGGGGTGGG + Intergenic
1198108271 X:133481113-133481135 GCTGCTTGGGAGGCTGAGGAAGG + Intergenic
1198249516 X:134866699-134866721 GCTACTTTGGGGGCTGAGGTGGG - Intergenic
1199282882 X:146022569-146022591 CCTGCTTTGGTGGAGGTGGCAGG - Intergenic
1200094556 X:153651029-153651051 GCTACTTTGGGGGGTGGGGAAGG + Exonic
1200154656 X:153969113-153969135 TCTGCCTTGGGGGGTGGGGAAGG + Intronic
1200447172 Y:3277075-3277097 CCTGTTGTGGGGGCGGGGGAGGG + Intergenic
1201312576 Y:12610175-12610197 CCTGCTTGGGAGGCTGAGGTGGG + Intergenic
1201639294 Y:16161590-16161612 CCTCCCTTGGAGCCTGTGGAGGG + Intergenic
1201663519 Y:16423737-16423759 CCTCCCTTGGAGCCTGTGGAGGG - Intergenic
1202170194 Y:22035316-22035338 CCAGTTTTGGGGCCTGTCGATGG - Intergenic
1202221172 Y:22551057-22551079 CCAGTTTTGGGGCCTGTCGATGG + Intergenic
1202321941 Y:23644605-23644627 CCAGTTTTGGGGCCTGTCGATGG - Intergenic
1202548826 Y:26025451-26025473 CCAGTTTTGGGGCCTGTCGATGG + Intergenic