ID: 1083331742

View in Genome Browser
Species Human (GRCh38)
Location 11:61901667-61901689
Sequence GGGTGTCCTCTAGAAGCTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 258
Summary {0: 1, 1: 0, 2: 5, 3: 54, 4: 198}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083331731_1083331742 11 Left 1083331731 11:61901633-61901655 CCCTGTGCAACAAGGCCCTGTGG 0: 1
1: 0
2: 2
3: 11
4: 155
Right 1083331742 11:61901667-61901689 GGGTGTCCTCTAGAAGCTGAGGG 0: 1
1: 0
2: 5
3: 54
4: 198
1083331740_1083331742 -5 Left 1083331740 11:61901649-61901671 CCTGTGGCAGGGGACTGCGGGTG 0: 1
1: 0
2: 3
3: 14
4: 220
Right 1083331742 11:61901667-61901689 GGGTGTCCTCTAGAAGCTGAGGG 0: 1
1: 0
2: 5
3: 54
4: 198
1083331739_1083331742 -4 Left 1083331739 11:61901648-61901670 CCCTGTGGCAGGGGACTGCGGGT 0: 1
1: 1
2: 3
3: 32
4: 223
Right 1083331742 11:61901667-61901689 GGGTGTCCTCTAGAAGCTGAGGG 0: 1
1: 0
2: 5
3: 54
4: 198
1083331733_1083331742 10 Left 1083331733 11:61901634-61901656 CCTGTGCAACAAGGCCCTGTGGC 0: 1
1: 0
2: 0
3: 15
4: 150
Right 1083331742 11:61901667-61901689 GGGTGTCCTCTAGAAGCTGAGGG 0: 1
1: 0
2: 5
3: 54
4: 198

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083331742 Original CRISPR GGGTGTCCTCTAGAAGCTGA GGG Intronic
902760035 1:18575170-18575192 GGATCTCCTCTAGGAGCTGGAGG + Intergenic
903855945 1:26337587-26337609 GGCTGTCCTCTGGCTGCTGAAGG + Exonic
904877580 1:33668250-33668272 GTGTGTACTATAGGAGCTGAGGG + Intronic
904972143 1:34427500-34427522 GGGTGACCTCAGGAAGCTCAGGG - Intergenic
906726416 1:48047713-48047735 GGGTGTCCACTAGGAGATGAGGG + Intergenic
910194944 1:84630633-84630655 AGGTGACCTCTAGGATCTGAGGG + Exonic
910218449 1:84865419-84865441 GGGTGTCCTCCGGCGGCTGATGG + Exonic
915473532 1:156139407-156139429 GGGCTTCCTCTAGAAGCCAAGGG + Exonic
916142654 1:161712713-161712735 AGGTGTCCTCAAAAAGCTGAAGG + Intronic
916867910 1:168880354-168880376 GGGCGGTCTCTAGGAGCTGAGGG + Intergenic
1063772735 10:9222503-9222525 GGGTGGCCTGTAGGGGCTGAGGG + Intergenic
1065435396 10:25699860-25699882 GGGTGTGCTCCGCAAGCTGAGGG + Intergenic
1069423902 10:68272811-68272833 GGGTGGTCTCTAAAAGCTGAGGG - Intergenic
1070001214 10:72378879-72378901 TGGTGTCATCTAGAATCTGAGGG + Intronic
1073674198 10:105626913-105626935 GGGTGGCCTCGAGTTGCTGAGGG - Intergenic
1074925541 10:118066128-118066150 GGGTGGCCTCTACAACCTGAGGG + Intergenic
1076204510 10:128585998-128586020 GGGTGGCCTCTGGGACCTGAGGG + Intergenic
1076827509 10:132976756-132976778 GGGTGGCCTCTAGGAGCTGAAGG - Intergenic
1076982403 11:211678-211700 GGGTCTCCTCAGGATGCTGAGGG - Intronic
1077097210 11:804145-804167 GGGTGGCCTCCAGCAGCTGAGGG + Exonic
1077208098 11:1353654-1353676 GGGTGTGATCTAGATCCTGAAGG - Intergenic
1077297570 11:1833231-1833253 GAGTGTCCCCCAGGAGCTGAGGG + Intronic
1080217705 11:29864598-29864620 TGGTGGCCTCTAAAATCTGAGGG - Intergenic
1080594768 11:33761811-33761833 GGGTGGCCTCCAGGAGCTGAGGG - Intronic
1081019600 11:37929024-37929046 AGTTGGCCTCTAGAATCTGAGGG - Intergenic
1081128440 11:39347574-39347596 GGGTAGCCTCTAGGAGCTGAAGG + Intergenic
1081352656 11:42073365-42073387 GGATGGCCTCTAGTTGCTGAGGG - Intergenic
1081527156 11:43935001-43935023 GGGTGTCCTGGGGAAGCAGATGG - Intronic
1083331742 11:61901667-61901689 GGGTGTCCTCTAGAAGCTGAGGG + Intronic
1084551934 11:69849249-69849271 GGGTGGCCTCCAAAAGCTGGAGG + Intergenic
1084740721 11:71137822-71137844 GGGTGTCTTCTAGGAGTTGATGG - Intronic
1086395805 11:86413765-86413787 GGGTGTCCCATGGAACCTGAGGG + Intronic
1088850642 11:113700505-113700527 GGGTGGGATCTTGAAGCTGAAGG - Intronic
1089589682 11:119532438-119532460 GAGTGTCTTGTAGAAGCTAAAGG - Intergenic
1089982359 11:122782812-122782834 GGCTTTCCTCTAGGAGCTGCGGG - Intronic
1090772203 11:129931141-129931163 GGGTTTCCTGTGGCAGCTGAGGG + Exonic
1091124281 11:133082184-133082206 GGGGCTCCTCTAGAGGCTGGAGG - Intronic
1091203208 11:133798550-133798572 GGGTGGCCTCTAGGCCCTGAGGG - Intergenic
1091991632 12:4960528-4960550 GGGTGTCTTTTAGAGGCAGAAGG - Intergenic
1092944547 12:13440579-13440601 GCGTGGCCTCTGTAAGCTGAGGG + Intergenic
1095905022 12:47368768-47368790 GGGTGTGCTATAGAAGCTGGAGG + Intergenic
1100244805 12:92746572-92746594 ATGTTTCCCCTAGAAGCTGATGG + Intronic
1102662326 12:114540104-114540126 GGACATCCTCTAGGAGCTGACGG + Intergenic
1102665402 12:114568202-114568224 GGACATCCTCTAGGAGCTGACGG - Intergenic
1103870740 12:124089753-124089775 GAGTGAGCACTAGAAGCTGAAGG - Intronic
1104549557 12:129743881-129743903 GTGTGTCTTCTGGAAGCTCAAGG - Intronic
1104574587 12:129955393-129955415 GGGTGTGCTTTGGCAGCTGAAGG - Intergenic
1104866972 12:131961491-131961513 GGGTGTCCTCTCGAAGCCCAGGG - Exonic
1104885521 12:132104859-132104881 GGGCGTCCTCTCGAAGCCCAGGG - Exonic
1106372072 13:29144633-29144655 GGGTAGCCTCTAGGAACTGAGGG - Intronic
1109684214 13:65791937-65791959 GTGTGGCCTCTAAGAGCTGAAGG - Intergenic
1109745706 13:66621353-66621375 GTGTGACCTCTAAGAGCTGAAGG + Intronic
1110372427 13:74754911-74754933 GTGTGGCCTCCAGGAGCTGAGGG + Intergenic
1113040592 13:106100494-106100516 GGCTGTGATCCAGAAGCTGAGGG + Intergenic
1114417696 14:22555315-22555337 GAGAGTCCTCTAGAATCTTAGGG - Intergenic
1118391638 14:65300629-65300651 GTGTTTCCTCTAGAAGGTGAGGG + Intergenic
1119837306 14:77761828-77761850 GAGTGACCCCTAGGAGCTGAGGG - Intronic
1121583741 14:95048895-95048917 GGGCAGCCTCTAGAAGCTGGAGG - Intergenic
1121633728 14:95439775-95439797 GTGTGTCCTTTAGAGGCTGGTGG - Exonic
1121954069 14:98198256-98198278 GGGTGTCCTTAGGAAGCTGGAGG - Intergenic
1122951826 14:105049273-105049295 GGCTGTCCTCTGGAAGCCTAGGG + Intergenic
1125357042 15:38827278-38827300 GGCTTTTCACTAGAAGCTGAAGG + Intergenic
1125919048 15:43514164-43514186 TGGTGTCCTCAAGGAGCTTAGGG + Intronic
1127190956 15:56529991-56530013 GGGCAGCCTCTAGGAGCTGAGGG - Intergenic
1127299004 15:57634348-57634370 GGGTGACCTTTAGCAGGTGACGG + Intronic
1127791848 15:62405301-62405323 GGGTTTCCTATAGAGGGTGAAGG + Intronic
1128895902 15:71373601-71373623 AGCTGTCTTTTAGAAGCTGAAGG - Intronic
1130128065 15:81110900-81110922 AGGGGTCTGCTAGAAGCTGAAGG + Intronic
1130243222 15:82217934-82217956 AGGTGGCCTCTAGGAGCTGAGGG + Intronic
1130457227 15:84123356-84123378 AGGTGGCCTCTAGGAGGTGAGGG - Intergenic
1131424898 15:92337842-92337864 AGGTGGCCCCTAGATGCTGAAGG - Intergenic
1131957831 15:97756742-97756764 TGATGTCCTCTGGGAGCTGAGGG - Intergenic
1132462110 16:60635-60657 GGGTGACTTGTAGAAGCGGAGGG - Intronic
1136983995 16:35083131-35083153 GGGTGTCCTCTAGAGGCATTTGG + Intergenic
1137558732 16:49489616-49489638 GGGAGTCTTCTAGAAGATGATGG + Exonic
1137690948 16:50427148-50427170 AGGTGACCTCTAGGAGCTCAAGG - Intergenic
1140113640 16:72023570-72023592 GGGTGGCCCCCAGAAGGTGAGGG - Exonic
1140424141 16:74846325-74846347 TGGTGTCCTCTGGGTGCTGAAGG - Intergenic
1140431356 16:74906819-74906841 TGGTGTCCTCTGGGTGCTGAAGG + Intronic
1140809226 16:78561154-78561176 GGGTTGCCTCTGGGAGCTGAGGG - Intronic
1141034237 16:80614043-80614065 GGGTGTCCTTAAGGAGCTAAAGG - Intronic
1142018440 16:87765244-87765266 GGGTATCCCGTAGCAGCTGATGG - Intronic
1142030140 16:87834517-87834539 GGGTGTCTTCCAGAAGGAGACGG + Exonic
1143352037 17:6295858-6295880 GGGTGTCCCTGAGAAGCTCATGG + Intergenic
1143674426 17:8421495-8421517 TGGTGGCCTCTAGAAGCTGGAGG + Intronic
1149915066 17:60600777-60600799 GGGTTTCATCAAGAAGCAGAAGG + Exonic
1152303575 17:79508857-79508879 GTGTGCCCTGTAGAAGCCGAGGG - Intronic
1153681970 18:7509437-7509459 GTGCAGCCTCTAGAAGCTGAAGG + Intergenic
1157063965 18:44325383-44325405 GGCTTTCCTCTACAAGCGGAAGG - Intergenic
1157697639 18:49735748-49735770 GTGTGCCCTTTAGGAGCTGAGGG + Intergenic
1157717245 18:49896437-49896459 GGGTCTCCACTGGAGGCTGAGGG + Intronic
1157933661 18:51850756-51850778 GGGTGGTCTCTAGAAGCTAAAGG + Intergenic
1159868178 18:73730464-73730486 AGGTGTCCTCTAGGATTTGAAGG + Intergenic
1160132052 18:76234191-76234213 GGGTGTCCTTCAAAAGCTGGAGG - Intergenic
1160290540 18:77589427-77589449 GGTTGTCCTCCAGGAGCTGAGGG + Intergenic
1160440789 18:78890618-78890640 GGGTGGCCTCAAGGAGCTAAGGG - Intergenic
1160661904 19:305206-305228 GGGTCTCCAGGAGAAGCTGAGGG - Intergenic
1161370310 19:3907720-3907742 GGGTGTCGTCTAGAAGCAGGTGG - Exonic
1162134642 19:8547946-8547968 GGGTGTCCCCTAGTTGCTAAGGG + Intronic
1163533072 19:17862001-17862023 GGGTGTGCTTTAGAGGCAGAGGG + Intronic
1164716220 19:30392223-30392245 GGGTCTCCTCTAGAATTTGCAGG + Intronic
1164966414 19:32488834-32488856 GGGTGGCCTCTAGGAGCTAATGG - Intergenic
1165838329 19:38772582-38772604 CTTTGTCCTGTAGAAGCTGAGGG - Intronic
1165841230 19:38790115-38790137 CTTTGTCCTGTAGAAGCTGAGGG + Intronic
1167506923 19:49875874-49875896 GGACCTCCTCTAGAAGCTGAAGG - Intronic
926050617 2:9742148-9742170 GGGTGTCTCCCAGAATCTGAGGG + Intergenic
926983366 2:18595131-18595153 GAGTGGCCTCTAGGAGCTGAGGG - Intergenic
927442451 2:23128853-23128875 GGGTGGCCTCCAGGAGCTGAGGG - Intergenic
927906449 2:26861975-26861997 TGGTGGCTTCTAGGAGCTGAGGG + Intronic
928439691 2:31281976-31281998 AGGAGTCCTCTAGAAGGTGAGGG + Intergenic
930220134 2:48738097-48738119 CTATGTCCTCAAGAAGCTGATGG - Intronic
931559618 2:63545733-63545755 GTGTATTCTCTAGAGGCTGAAGG + Intronic
931603117 2:64023920-64023942 AGGTGGCCTCTAAAATCTGAGGG - Intergenic
937951344 2:127390198-127390220 AGGTGACCTCTAGGAACTGAAGG - Intergenic
938846390 2:135213950-135213972 GAGAGGCCTCTAGGAGCTGATGG + Intronic
939528698 2:143329416-143329438 GGGTGGCCTCTGGGAGGTGAGGG + Intronic
939698198 2:145355062-145355084 GTGTGTCCTTAAGAAACTGAGGG + Intergenic
941394785 2:164961181-164961203 GGGAGGCCTCTGGAAGCTTAAGG + Intergenic
941467025 2:165840073-165840095 GGGTGGCCTCTAGGAGCTGAGGG + Intergenic
941846515 2:170139857-170139879 TGGTTTCCTCTAGAGGCTGTAGG - Intergenic
943114238 2:183646496-183646518 TAGTGGCCTCTAGGAGCTGAGGG + Intergenic
943177117 2:184490756-184490778 GGGAGGCCTGTAGAAACTGAGGG + Intergenic
943270112 2:185789938-185789960 GGATGTCCTCAAGTAGCTGAAGG - Exonic
943840197 2:192571024-192571046 GGGTGTCCTTTAGTAGCTTTTGG - Intergenic
944935707 2:204565141-204565163 GGGTGGCCTCCAGGAGCTGAAGG - Intronic
946301495 2:218827129-218827151 GGGAGCCCTCTTGAAGCTGCTGG - Intronic
946997413 2:225410654-225410676 GGGTGTTCTGTAAAAGCTAATGG - Intronic
947523159 2:230863906-230863928 GACTGTCCTCAAGAAGCGGACGG + Intergenic
947869986 2:233429674-233429696 GGGTGTCCTCTGGAGGGAGAGGG + Intronic
948163779 2:235845477-235845499 GGGTGTCCTCAGGAAGCCCAGGG - Intronic
1170036794 20:11998106-11998128 GAGGGCCCTGTAGAAGCTGAGGG + Intergenic
1170603804 20:17861098-17861120 TGGTGGCTTCTAGGAGCTGAGGG - Intergenic
1175011852 20:55745528-55745550 GGGTGGCCTCTAGGAGCTGTGGG + Intergenic
1175092846 20:56519205-56519227 GGGTTTCCTTCAGAAGCAGAAGG + Intronic
1175190000 20:57205034-57205056 AGGTGTCATCTTGAAGCAGAGGG + Intronic
1177176881 21:17709031-17709053 GAGTGGCTTCTAGGAGCTGAAGG - Intergenic
1178755392 21:35344771-35344793 GGGTGGCCTCTACAGGCTGAGGG - Intronic
1178978623 21:37242468-37242490 TGGTGTGCTCAGGAAGCTGAGGG + Intronic
1179241599 21:39597774-39597796 AGGCGGCCTCCAGAAGCTGAGGG + Exonic
1179546505 21:42115688-42115710 CTGTGTCCTCTGGAATCTGATGG + Intronic
1180663147 22:17486562-17486584 GGGTGGCCTTGAGGAGCTGAGGG + Intronic
1182890979 22:33818628-33818650 GGCTGCCCTCAAGAAGCAGAAGG - Intronic
1184019368 22:41810200-41810222 GGGAGTCCTCCAGCACCTGAGGG - Exonic
1184794741 22:46725409-46725431 GACGGTCCTCTAGAAGCAGAAGG + Intronic
1184940301 22:47760100-47760122 GGGTATCCTTGAGAAGCTGTAGG + Intergenic
950423104 3:12910265-12910287 GCATGTCCTATAGAAGCTGCAGG + Intronic
954578163 3:51688192-51688214 GGGTATCTTCTGGAAGCTGCAGG + Intronic
954801912 3:53192094-53192116 GGGTGACTTCTACAAGCAGAGGG - Exonic
956108172 3:65843623-65843645 AGGGGTCCTCTAGAATCTGGGGG - Intronic
956772919 3:72541754-72541776 TGGTATCCTCTAGGAGCTGAGGG - Intergenic
957582433 3:82091719-82091741 GGATAACCTCTAGAAGCTGAGGG + Intergenic
957951055 3:87127214-87127236 GTGTGCCTTCTAGATGCTGAGGG - Intergenic
959096740 3:101964702-101964724 GGGAGTTCTCTAGAGGCTGCGGG + Intergenic
959319657 3:104855411-104855433 GGGTGACCTCCAGAAGGTGAGGG + Intergenic
960626074 3:119683537-119683559 AGGAGGCCTCTAGGAGCTGAGGG - Intergenic
960989726 3:123302557-123302579 GGGTCTGCTACAGAAGCTGAGGG + Intronic
962305903 3:134285808-134285830 GGGTTTCCTCAAAAAACTGAAGG + Intergenic
964598975 3:158473906-158473928 TAATGTCCTCTAGAAGCTCACGG - Intronic
966051434 3:175620916-175620938 GGGTCCCCTCTTGAAGCTGAGGG - Intronic
968037922 3:195563864-195563886 GGGTGTACTGAAGATGCTGAAGG + Intergenic
969093005 4:4710178-4710200 TAGGGTCTTCTAGAAGCTGACGG + Intergenic
969976361 4:11106050-11106072 GAGTGGCCTCTGGAATCTGACGG + Intergenic
970052101 4:11926072-11926094 GGGTGGCCCCTAGGAACTGATGG - Intergenic
970677016 4:18462804-18462826 GGGTGTCTTCCAGGACCTGAGGG - Intergenic
971694723 4:29885722-29885744 ATGTGACCTCTAGAAGCTGGAGG + Intergenic
972054113 4:34778727-34778749 GGGTGGCTTCTAGGACCTGAGGG - Intergenic
973730025 4:53814344-53814366 AGTTGTCCTTTAGAAGCAGAGGG + Intronic
976225626 4:82793915-82793937 GGGGGTCCTCAACAACCTGAGGG + Intronic
976348091 4:84028440-84028462 GGGTGTACCCAAGAAGCTGGAGG + Intergenic
980714887 4:136615808-136615830 GGCTGTCCTCAAGAAGCTACAGG + Intergenic
981249103 4:142577819-142577841 AGATGACCTCTAGCAGCTGAGGG - Intronic
981265414 4:142777397-142777419 GGGTGGCCTCTAGTAGCTGAGGG + Intronic
982507613 4:156239961-156239983 GGGTGCCTTCTAGGAGCTGAGGG - Intergenic
983524654 4:168748778-168748800 GAGTGGCCTCTAGGAACTGAGGG - Intronic
985847048 5:2357699-2357721 GGGTGGCCTTTTGGAGCTGAGGG + Intergenic
985994168 5:3587455-3587477 GGGTGTCCCCTAGGAGCTTTGGG + Intergenic
989762587 5:45036128-45036150 TTGTGTCCTCTGGATGCTGATGG - Intergenic
990306054 5:54494880-54494902 GGGTGGCTTCTAGGAGCTGATGG - Intergenic
992980741 5:82168950-82168972 GGCTGTCCTCTACAAGTTGTTGG - Intronic
994186697 5:96823057-96823079 AGGTGGCCTCTAGGAGATGAGGG - Intronic
994385008 5:99120804-99120826 GGGAAGCCTTTAGAAGCTGATGG + Intergenic
995261782 5:110112822-110112844 AGGTGGCTTCTAGAATCTGAAGG - Intergenic
995825802 5:116297609-116297631 GGGTGACCTCTAGGGGCTGAGGG + Intronic
995870786 5:116741169-116741191 TGGTGTCCCCTAGAAGCTAAGGG - Intergenic
996389417 5:122943629-122943651 GGGTGGTCTTTAGGAGCTGAGGG - Intronic
996484365 5:124013983-124014005 GGTTGTCCTCAAGATGCTTAAGG - Intergenic
998626312 5:143850266-143850288 GGGTGACCTCTAGGAGCTGCAGG - Intergenic
1000104967 5:158050856-158050878 AGGTGTTTTCCAGAAGCTGAAGG - Intergenic
1002827440 6:786039-786061 GGGTGTCCTCTAGACACGGGAGG + Intergenic
1002895617 6:1378574-1378596 GGGCGGCGTCTAGAAGCTGCAGG - Intergenic
1005361871 6:25038579-25038601 GGGTGGCCTTTAGTTGCTGAAGG + Intronic
1005451190 6:25974297-25974319 GGGTGGCCTGTAGAAGCTGTGGG - Intronic
1008150708 6:47948224-47948246 GGGTAGCCTCTAGGAGCTGAGGG - Intronic
1008619571 6:53258507-53258529 CTGGGTCCACTAGAAGCTGATGG + Intergenic
1008856337 6:56092884-56092906 GTGTGTCCCCCAGAAGCTCAAGG + Intronic
1011154109 6:84310371-84310393 GTGTGTCCTGCAGAAGCTGTGGG + Intergenic
1011660030 6:89586770-89586792 AAGTGTACTGTAGAAGCTGATGG + Intronic
1013070514 6:106724862-106724884 GGGTGTCCTCTGCGAGCTGAGGG + Intergenic
1013477953 6:110526896-110526918 GGGTGGTGTCTAGGAGCTGAGGG - Intergenic
1014151846 6:118066367-118066389 AGGTGACCTCTAGGACCTGAAGG + Intronic
1015515189 6:134076419-134076441 GGGTGGCCTCCAGGAGCTGAGGG - Intergenic
1017771004 6:157644464-157644486 GGGTCTGCTCTAGAAGGAGACGG - Intronic
1018497561 6:164365627-164365649 GAATCACCTCTAGAAGCTGATGG - Intergenic
1022527258 7:31046356-31046378 GGGTGACCTCTAGAAGCTCAGGG + Intergenic
1023023855 7:36034108-36034130 GGGTGTCGGCAAGAGGCTGAGGG + Intergenic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1027149619 7:75723602-75723624 GGGAGGCCTCTAGGAGCTAAGGG - Intronic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1030166785 7:106563099-106563121 TGGAGTCCTCTGAAAGCTGAAGG + Intergenic
1032325970 7:130928345-130928367 GTTTGTACTCTTGAAGCTGAAGG + Intergenic
1032705768 7:134420116-134420138 AGGTGTCCTCAGGAAACTGAAGG + Intergenic
1033867330 7:145707536-145707558 GAGTGGCCTCTAAAAGTTGAGGG - Intergenic
1034809383 7:154118074-154118096 GGGTGTTGTGTGGAAGCTGAGGG + Intronic
1035207638 7:157304513-157304535 TGGTGACCTCTGGAAGCTGGGGG - Intergenic
1035839858 8:2799665-2799687 TGGTGTTCTCAAGAAGCTGAGGG - Intergenic
1036793123 8:11736556-11736578 GGGCGCCCTCTAGAGGCTGGAGG + Intronic
1037399045 8:18475161-18475183 AGGTGGCCTCTAGGAGCTGAGGG - Intergenic
1037742241 8:21616870-21616892 GGGTGTCCCCTGGCTGCTGATGG - Intergenic
1040636486 8:49280354-49280376 GTGTTTCCTCTATAAACTGATGG + Intergenic
1042792589 8:72624914-72624936 GGGTGGCCTCTTAGAGCTGAGGG + Intronic
1044250410 8:89999228-89999250 AGGTGACTTCTAGAAGCTGAAGG + Intronic
1045287134 8:100801582-100801604 GGGTGGCTTCTAGGAGCTGAAGG + Intergenic
1046339403 8:112832584-112832606 GGGTGGCCTTTAGGAGCTGAGGG + Intronic
1051181352 9:14415220-14415242 TGGTGGCCTCTGGGAGCTGAGGG - Intergenic
1051947779 9:22592473-22592495 GAATGTCCTCTAGAATCTGCAGG + Intergenic
1053634224 9:39979150-39979172 ACGAGTCCTCTAGAAGCTCATGG + Intergenic
1053771525 9:41484346-41484368 ACGAGTCCTCTAGAAGCTCATGG - Intergenic
1054209663 9:62271547-62271569 ACGAGTCCTCTAGAAGCTCATGG - Intergenic
1055231116 9:74066960-74066982 GGGTGACTTCTAGGACCTGAGGG - Intergenic
1055326459 9:75135858-75135880 GGGTGGCCTCTAAAAGCTGAGGG - Intronic
1055661019 9:78504151-78504173 AGGTTTTCTCTAGCAGCTGAGGG + Intergenic
1056389855 9:86131084-86131106 AGGTGCCCTCTAGAAGCTGGAGG - Intergenic
1056521176 9:87402866-87402888 GGGTATCCTCAAGGTGCTGATGG - Intergenic
1057303730 9:93900825-93900847 GGGAGGCCACTAGGAGCTGAGGG - Intergenic
1057868915 9:98703156-98703178 AGATGGCCTCTAGAAGCTGCAGG - Intronic
1058208700 9:102139938-102139960 GGGTGGCTGCTAGGAGCTGAAGG - Intergenic
1058836192 9:108860309-108860331 AGGTGGCCTCTAGGAGCTGGAGG + Intergenic
1059090059 9:111346964-111346986 GGGTATTCTCTAGAAGCTGCTGG - Intergenic
1059399015 9:114057168-114057190 GGCTGGCCTCTAGCAGCTCATGG - Intergenic
1060012202 9:120053616-120053638 AGGTGGCCTCTAGAAGCTTTGGG - Intergenic
1186744789 X:12556430-12556452 GGGTGGACTCTAAGAGCTGAGGG + Intronic
1187087937 X:16061240-16061262 GGGAGGCCTCTAGAAACTGAAGG - Intergenic
1187260922 X:17684533-17684555 AGGTGGCCTCTAGGAGCTGAGGG - Intronic
1187965976 X:24612122-24612144 AGGTGGCCTCTAGGAGCTGAGGG + Intronic
1188422858 X:30010799-30010821 AGGTGACCTCTAGGAGCTGAGGG - Intergenic
1188661454 X:32764466-32764488 TGGTGGCCTCTAGAAGCTGGGGG - Intronic
1189077913 X:37937415-37937437 GGATGGCCTCTACAAGCTGAGGG + Intronic
1190412537 X:50151238-50151260 GGATGGCCTCTAAGAGCTGAGGG + Intergenic
1190441707 X:50481451-50481473 GGATGGCCTCTAGGACCTGAGGG - Intergenic
1190451292 X:50583674-50583696 GGGTGGCCTTTAGGATCTGAAGG + Intergenic
1193163469 X:78256395-78256417 GGGGGTCCTCTCCAACCTGAAGG - Intergenic
1195620611 X:106950808-106950830 GGGTGTGGTCTAGAAGATGGGGG - Intronic
1195961865 X:110395172-110395194 GGGTGTCCTCTAAATTCCGAGGG + Intronic
1196733271 X:118962782-118962804 GGCTGTCCACTCGAAGCTGCAGG + Intergenic
1196959882 X:120990104-120990126 GGCTGTCCGCTTGAAGCTGTAGG + Intergenic
1196959977 X:120990808-120990830 GGCTGTCCACTAGAAGCTGCAGG + Intergenic