ID: 1083331911

View in Genome Browser
Species Human (GRCh38)
Location 11:61902660-61902682
Sequence TTCCTTTGGAAGCCGGGTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 203
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 186}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083331911_1083331923 5 Left 1083331911 11:61902660-61902682 CCCCCACCCGGCTTCCAAAGGAA 0: 1
1: 0
2: 1
3: 15
4: 186
Right 1083331923 11:61902688-61902710 AGCCAGGCAGAGAAGGGAGCTGG 0: 1
1: 1
2: 7
3: 98
4: 847
1083331911_1083331926 22 Left 1083331911 11:61902660-61902682 CCCCCACCCGGCTTCCAAAGGAA 0: 1
1: 0
2: 1
3: 15
4: 186
Right 1083331926 11:61902705-61902727 AGCTGGCCCCAGCCATCCCTGGG 0: 1
1: 0
2: 2
3: 28
4: 381
1083331911_1083331919 -2 Left 1083331911 11:61902660-61902682 CCCCCACCCGGCTTCCAAAGGAA 0: 1
1: 0
2: 1
3: 15
4: 186
Right 1083331919 11:61902681-61902703 AACCCAGAGCCAGGCAGAGAAGG 0: 1
1: 1
2: 7
3: 80
4: 601
1083331911_1083331920 -1 Left 1083331911 11:61902660-61902682 CCCCCACCCGGCTTCCAAAGGAA 0: 1
1: 0
2: 1
3: 15
4: 186
Right 1083331920 11:61902682-61902704 ACCCAGAGCCAGGCAGAGAAGGG 0: 1
1: 0
2: 5
3: 79
4: 657
1083331911_1083331925 21 Left 1083331911 11:61902660-61902682 CCCCCACCCGGCTTCCAAAGGAA 0: 1
1: 0
2: 1
3: 15
4: 186
Right 1083331925 11:61902704-61902726 GAGCTGGCCCCAGCCATCCCTGG 0: 1
1: 0
2: 2
3: 26
4: 364

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083331911 Original CRISPR TTCCTTTGGAAGCCGGGTGG GGG (reversed) Intronic
900115980 1:1028102-1028124 TTCCCTGGGAAGCCCCGTGGAGG - Intronic
900283733 1:1889879-1889901 TTCGGCTGGAAGCGGGGTGGGGG - Intronic
900648186 1:3718358-3718380 TTGCTCTGGAAGCTGCGTGGTGG - Intronic
901937431 1:12636469-12636491 TCCCTTGGGAGGCAGGGTGGGGG - Intergenic
902475630 1:16684221-16684243 TTCCTTTTGAAGCCATGTGAAGG + Intergenic
902689896 1:18104623-18104645 TTCCCTTGGGAGCCAGGTTGGGG + Intergenic
903824077 1:26129920-26129942 TTTTTTTGGTAGCGGGGTGGGGG + Intergenic
904079411 1:27862659-27862681 TTCCTTAGAAAGCAGGGAGGAGG + Intergenic
904920799 1:34006455-34006477 TTCCTCTGGAAACAGTGTGGAGG - Intronic
907513234 1:54977955-54977977 TCCCTTTGGAAGCCTGGAAGAGG + Intergenic
908458783 1:64329571-64329593 ATCCTTTGGAATCTGGGTGGAGG - Intergenic
909298046 1:73976202-73976224 TTTCTTTGGTAGGGGGGTGGAGG + Intergenic
909422752 1:75484756-75484778 ATCCTTTGAAAGCTAGGTGGAGG + Intronic
909829741 1:80173109-80173131 TTCATTTGGAAGCATGGTGACGG + Intergenic
910979990 1:92950470-92950492 TTACTTTGGAAGCAATGTGGAGG + Intronic
911026608 1:93442521-93442543 TTCCCTTGAAAGCAGGGTGTTGG - Intergenic
912932711 1:113979425-113979447 TAGCTTTGGAGGCGGGGTGGGGG - Exonic
916131105 1:161612505-161612527 TTGCTCTGGAAGCCGGAGGGCGG - Intronic
920657208 1:207885961-207885983 TTGTTTTGGAAGCTGGGGGGAGG + Intronic
920836925 1:209519766-209519788 ATCCTTTGGAATCTTGGTGGAGG - Intergenic
923874637 1:238034479-238034501 TTCCTTTTGCAGCTGGGAGGTGG + Intergenic
1064619788 10:17203181-17203203 TTTCTTTGGAATCCGCTTGGTGG + Intergenic
1070986301 10:80692963-80692985 TTCCTTTGGAAGCTAGGGGATGG - Intergenic
1071697097 10:87887945-87887967 ATCCTTTGAAATCCTGGTGGTGG - Intronic
1073524297 10:104165001-104165023 TTTCTTTGGAACCTGGGTTGGGG + Intronic
1083331911 11:61902660-61902682 TTCCTTTGGAAGCCGGGTGGGGG - Intronic
1084688669 11:70712114-70712136 AGCCTCTGGAAGCCGGGCGGGGG - Intronic
1084952666 11:72675246-72675268 CCTCTTTGGAAGCAGGGTGGGGG - Intergenic
1086934755 11:92732832-92732854 GTCCCTTGGAAGACAGGTGGAGG - Intronic
1089422163 11:118340062-118340084 TTCCTTAGGATGCAGGGTGGAGG - Intronic
1089865285 11:121626292-121626314 TCCCCTTGGAAGTGGGGTGGGGG + Intronic
1090973471 11:131662482-131662504 TCCCTTTCAAAGCAGGGTGGGGG - Intronic
1091115375 11:133007514-133007536 TTCCTTTGGAAGGCAGGGTGGGG + Intronic
1091407943 12:220699-220721 ACCCTTGGGAAGCTGGGTGGGGG - Exonic
1091776549 12:3188551-3188573 TTCCTCTGGCAGCAGTGTGGGGG + Intronic
1092278176 12:7078364-7078386 TTCCATTTGTAGCCAGGTGGTGG - Intergenic
1093438678 12:19167433-19167455 TTGCTTTGGAAGCATGGTTGTGG + Intronic
1094090513 12:26644322-26644344 ATCCTTTGAAATCCAGGTGGAGG - Intronic
1094240513 12:28217775-28217797 TTAGTTTGGATGCAGGGTGGTGG + Intronic
1094501307 12:31023336-31023358 TTTCTTTGGCAGCTGGGAGGTGG + Intergenic
1095299494 12:40566379-40566401 TTCCTTTGGAAGTGGGGGTGGGG - Intronic
1095371657 12:41474678-41474700 TTCAATGGGAAGTCGGGTGGAGG + Intronic
1096072393 12:48782563-48782585 TTCCTCTGGAAGCAGGTAGGTGG - Exonic
1097277721 12:57824501-57824523 ATCCATTGGAAGCCTGGTGAGGG - Intronic
1097760494 12:63459246-63459268 TTTCTTTTGCAGCTGGGTGGTGG + Intergenic
1098302562 12:69069047-69069069 TGCCTTTGGAAGCAAGGTAGAGG - Intergenic
1098351159 12:69562535-69562557 ATCCTTTGGGAGCAGGGGGGTGG - Intronic
1102009081 12:109607016-109607038 TTCCTTTGGAAGCAGGGGGCTGG + Intergenic
1102027334 12:109720908-109720930 TTCCTTTGAGAGACTGGTGGTGG - Intronic
1104366235 12:128180293-128180315 TCCATTTGGAGGCAGGGTGGGGG + Intergenic
1107556584 13:41520975-41520997 TCCCTGGGGAAGCGGGGTGGTGG + Intergenic
1108443836 13:50486049-50486071 TTCTTTTAGAAGCAGGGAGGAGG - Intronic
1109953671 13:69536574-69536596 TTCCTTTGTAAGCTGGGGAGAGG + Intergenic
1110611617 13:77494347-77494369 TTATTTTTGAAGCCAGGTGGTGG - Intergenic
1111601627 13:90481841-90481863 ATCCTTTGAAATCCAGGTGGAGG + Intergenic
1113367858 13:109693442-109693464 TTCCTTTGGAGGCTGGGAGAAGG - Intergenic
1113450077 13:110402815-110402837 ATCCCTTGGAAGCTGGGTGGAGG + Intronic
1114401436 14:22414568-22414590 TTCCCTTGGGAGAGGGGTGGTGG - Intergenic
1115347474 14:32358687-32358709 TTACTTTGGAGCTCGGGTGGTGG + Intronic
1117188883 14:53271646-53271668 TTACTTGGCAAGGCGGGTGGGGG - Intergenic
1117213004 14:53520866-53520888 TTCCTTTGGAAAACTGGTTGAGG + Intergenic
1118884285 14:69853569-69853591 TTCCTCTGGAGGCAGGGTGTGGG + Intergenic
1119253142 14:73174798-73174820 TTCCTTGGGAAGTCGGGCGCTGG + Intronic
1122213474 14:100188310-100188332 TTCTTTTGCAATCTGGGTGGAGG - Intergenic
1126988012 15:54337141-54337163 CTCTTTTGGGAGCAGGGTGGGGG + Intronic
1128679240 15:69635824-69635846 TTCCTTGGACAGCCTGGTGGAGG + Intergenic
1129388884 15:75210678-75210700 TGGCTTTGGAAGCCAGGAGGTGG + Intronic
1129760578 15:78127147-78127169 TGCCTTTGGGACCTGGGTGGTGG - Intronic
1129852219 15:78799975-78799997 TTAATGTGAAAGCCGGGTGGTGG - Intronic
1130250780 15:82299098-82299120 TTAATGTGAAAGCCGGGTGGTGG + Intergenic
1132204017 15:99974297-99974319 TTCTTGTGGCAGCCGGGTGGGGG + Exonic
1134320331 16:13156983-13157005 TTCCTTTGGAAACCTGGCTGAGG + Intronic
1135046336 16:19159036-19159058 TTCCTTTAGAGGCAGGGAGGAGG - Intronic
1137447905 16:48543363-48543385 TGCCTTTGGAAGCCAGGGAGCGG - Intronic
1140127471 16:72130344-72130366 TTGCTTTAGAAAACGGGTGGAGG - Exonic
1140186601 16:72778678-72778700 TCCCTTTGGGGGCAGGGTGGGGG + Intergenic
1141696807 16:85624135-85624157 TTCCGTGGGACGGCGGGTGGCGG - Intronic
1143523475 17:7459547-7459569 TTCCCTGGGAAGACGGGTGGTGG - Exonic
1146603795 17:34240672-34240694 GTCTTTTGGTAGCAGGGTGGAGG + Intergenic
1147119421 17:38327156-38327178 TGCCCTTGGGAGGCGGGTGGAGG - Exonic
1147341198 17:39754180-39754202 TTCCTTGGCCAGGCGGGTGGAGG + Intergenic
1147736668 17:42643064-42643086 TTCCTTCGGCAGTCTGGTGGGGG + Intergenic
1148667166 17:49383359-49383381 TTCCCATGGAAACTGGGTGGTGG - Intronic
1151199762 17:72459106-72459128 TTCATTTAGAAGCCTGGTGCTGG - Intergenic
1152288242 17:79424609-79424631 AGCCCTTGGAAGCCTGGTGGGGG - Intronic
1154121753 18:11657888-11657910 TTCCTCAGGAAGCCGGGGAGTGG - Intergenic
1155545517 18:26910378-26910400 TTCCTTTGGAAGCTTGGCGGGGG + Exonic
1157749627 18:50166663-50166685 TTCTTTTGGTAGGCGGGGGGTGG - Intronic
1158617268 18:58999836-58999858 TTACTTTTTAAGCTGGGTGGTGG + Intergenic
1159299625 18:66546166-66546188 TTCCTTTAGAAGCATGGAGGAGG + Intronic
1161075672 19:2284301-2284323 TTTTATTGGAACCCGGGTGGAGG + Intronic
1161142127 19:2654132-2654154 TTATTTAGGAAGCCAGGTGGGGG + Intronic
1163579262 19:18128611-18128633 CTGCCTTGGAAGTCGGGTGGGGG + Intronic
1165402951 19:35613353-35613375 TTCCCTGGGAAGGCGGGTGGTGG - Intronic
1165982184 19:39734241-39734263 ATCCCATGGAAGCCGGGTGCGGG + Intronic
1167071674 19:47225862-47225884 TTCCTTTGGATGCAAGGAGGGGG + Intronic
1167382849 19:49148782-49148804 TCCCTTTGGGAGCCAGGTGGAGG + Intronic
1168333817 19:55585813-55585835 TTCCTGTGGGACCCGCGTGGAGG + Intergenic
927658583 2:24972279-24972301 TTGCTTTCGCAGCCGAGTGGTGG + Intergenic
929036675 2:37699758-37699780 TTCCTTTGGCAGCCAGGTGGAGG + Intronic
929681188 2:43995469-43995491 TGCTTTGGGAAGTCGGGTGGTGG - Intronic
929699635 2:44150889-44150911 ATCCTTTGGAATCTAGGTGGAGG - Intergenic
929827795 2:45323064-45323086 TTCCTTTGGAATCAGGTGGGGGG + Intergenic
932272145 2:70419843-70419865 TTCCTATGGAAGGGGGGTTGAGG + Intergenic
932606928 2:73171715-73171737 TTCCAAGGGAAGCTGGGTGGGGG - Intergenic
933925500 2:87088696-87088718 TTCCAAGGGAAGCTGGGTGGGGG + Intergenic
937988955 2:127651693-127651715 TTCCCTTCGAAGCTGGGGGGCGG - Exonic
938040304 2:128070241-128070263 TTGCTTTTGAAGGCGTGTGGGGG - Intergenic
939879575 2:147614616-147614638 TCTGTTTGGAAGACGGGTGGAGG + Intergenic
941362839 2:164573970-164573992 TTCCTTTAGAAGCCAGATGTTGG + Intronic
942039027 2:172039752-172039774 TTGCTTTAGAACCCGGGAGGCGG - Intronic
944608731 2:201378264-201378286 TCACTTTGGAGGCAGGGTGGTGG - Exonic
945198808 2:207261647-207261669 TTCCTTTGAAAGCTGGTCGGTGG - Intergenic
1173577551 20:44122991-44123013 TGCCTTTGGAAGCTGGGTTGAGG + Intronic
1175009501 20:55720868-55720890 TTCCTTTTGAAGTCAGTTGGGGG - Intergenic
1175702663 20:61151464-61151486 ATCCTTTGAAATCTGGGTGGAGG + Intergenic
1176056543 20:63151891-63151913 TTCGTTTGGAACGCGGGCGGGGG - Intergenic
1176201586 20:63863223-63863245 TTCCCTTAGGAGCTGGGTGGGGG - Exonic
1176236042 20:64054012-64054034 TTCCATGGGAAGCAGGCTGGGGG + Intronic
1176727225 21:10448168-10448190 TTGCTGTGGAAGCAGGGAGGAGG + Intergenic
1178925194 21:36768917-36768939 GGCCTTAGGAAGCCAGGTGGAGG - Intronic
1180172216 21:46065434-46065456 TTCCTGTGGACACCGGGCGGGGG + Intergenic
1181854737 22:25773881-25773903 TGCCTTTGGCTGCTGGGTGGAGG + Intronic
1181993189 22:26853846-26853868 TTCTGTTGGAAGCAGGATGGTGG + Intergenic
1183253848 22:36748009-36748031 CTCCTTTGGACGAAGGGTGGAGG + Intergenic
949343675 3:3056065-3056087 TTCCCTTTGAAGCCGGGATGGGG + Intronic
953408534 3:42673390-42673412 ATCCTTTGAAATCCAGGTGGAGG - Intergenic
953636471 3:44669567-44669589 TTCCTCTGGCATCCAGGTGGAGG + Intergenic
958469825 3:94503048-94503070 TTCCTTTGAAATCTAGGTGGAGG + Intergenic
967329969 3:188280563-188280585 TTCGTTTGGGGGCGGGGTGGGGG - Intronic
967572920 3:191052184-191052206 TACCTTCGGAAGCAGAGTGGAGG - Intergenic
968661995 4:1802477-1802499 TTCCCATGGCTGCCGGGTGGGGG + Intronic
975033767 4:69656945-69656967 TTTCTTTGGCAGCCGGGAGGTGG + Intergenic
976348964 4:84038687-84038709 ATCCTTTAGAGGCAGGGTGGGGG + Intergenic
977141077 4:93372991-93373013 TTCCTTTTTAAGCTTGGTGGTGG + Intronic
983056864 4:163107756-163107778 CTCCTTGGCAAGCAGGGTGGAGG - Intergenic
983253065 4:165366428-165366450 TTCCTTTGGAGGGGGCGTGGTGG + Intronic
984266747 4:177505654-177505676 TTTCTTTGGCAGCGGGGAGGCGG - Intergenic
986928659 5:12792034-12792056 TTCTTTTAGATGACGGGTGGTGG - Intergenic
988095421 5:26602411-26602433 TTCCTTTGTATGCCTTGTGGTGG + Intergenic
990000056 5:50882363-50882385 TTCCTTTGGGAGAAGAGTGGAGG + Intergenic
990955531 5:61334504-61334526 TTTCTTTGGAAGTGGGGTGGGGG + Intronic
991321968 5:65383844-65383866 ATCCTTTGGAATCTAGGTGGAGG + Intronic
996030747 5:118701975-118701997 TTCCTTTGGAAGGAGGGGTGAGG + Intergenic
996899950 5:128533281-128533303 TTGGTTTGGAACCCGGGTGGAGG - Intronic
997207423 5:132058007-132058029 GTCCTCTGGAAGACAGGTGGTGG - Intergenic
998038858 5:138938143-138938165 TGCCTCTCAAAGCCGGGTGGCGG - Intergenic
999025588 5:148227836-148227858 TTCACTTGGAAGTAGGGTGGAGG - Intergenic
1001864571 5:175092202-175092224 TTCCTTTGGATGAGAGGTGGTGG + Intergenic
1006078183 6:31547705-31547727 TTCCTCTGGAACCTGGGGGGAGG - Exonic
1006907559 6:37543275-37543297 TTCCTTTGGGAGTTGGGAGGCGG + Intergenic
1007220168 6:40272612-40272634 ATCCTTTGAAATCCAGGTGGAGG + Intergenic
1007521718 6:42455126-42455148 GTCCTTTGGAAGGTGGGGGGGGG - Intergenic
1007731099 6:43947359-43947381 CTTCTTTGTATGCCGGGTGGTGG - Intergenic
1008435965 6:51476974-51476996 TTCTTATGGCAGCGGGGTGGGGG + Intergenic
1013231588 6:108165883-108165905 TTTCTTTGGGAGCCGCTTGGAGG + Intergenic
1015530565 6:134217456-134217478 TGCCTTTGGATCCTGGGTGGTGG + Intronic
1016603304 6:145888698-145888720 TCCCTTTGGCAACCGTGTGGAGG + Intronic
1018233141 6:161695205-161695227 TTCCTTTTGTAGCCAGTTGGGGG - Intronic
1019304352 7:325788-325810 CTCCTTTGGAAGAGGGGTTGTGG - Intergenic
1020696543 7:11420496-11420518 ATCCTCTGAAATCCGGGTGGAGG - Intronic
1021044907 7:15910321-15910343 TTGCTTTGGAAGCAAGGGGGTGG + Intergenic
1024046746 7:45590383-45590405 TTCCTTTAGAAAGTGGGTGGTGG + Intronic
1024503586 7:50140959-50140981 CTCCTTTGGAGACCGGCTGGAGG - Intronic
1026415958 7:70180941-70180963 TTGCTTTTCAAGCTGGGTGGTGG - Intronic
1028990061 7:97039667-97039689 TTCCTTTTGCAGGTGGGTGGGGG - Intergenic
1033117169 7:138635482-138635504 TTCCTTTGGAAGGCTGGGGCAGG - Intronic
1033220814 7:139525202-139525224 TGCCCTTGGAAGACTGGTGGTGG + Intronic
1033369101 7:140693225-140693247 TTCATTCTGAAGCTGGGTGGGGG - Intronic
1033454991 7:141494947-141494969 TAACTATTGAAGCCGGGTGGTGG + Intergenic
1034829727 7:154298786-154298808 TTCCTCTCGAAGCCTGGGGGAGG + Intronic
1037928893 8:22865691-22865713 TTCCTCTGGGATCCGGGCGGCGG - Intronic
1039414148 8:37379198-37379220 ATCCTTTGGAAGCAGGGATGTGG - Intergenic
1039921154 8:41895644-41895666 TTCCTTTGGAAGCCAGGCACGGG - Intronic
1042467182 8:69141079-69141101 TTTCTTTGGCAGCTGGGAGGTGG - Intergenic
1043782901 8:84359172-84359194 TTTCTTTGGGAACAGGGTGGGGG + Intronic
1045982156 8:108203027-108203049 TTCCTTTAGAAGCCAGATGTTGG - Exonic
1049064411 8:140301691-140301713 TTCCTGCGGAGGCCGGGAGGCGG - Intronic
1052559742 9:30070046-30070068 CACTTTGGGAAGCCGGGTGGGGG + Intergenic
1057119547 9:92559050-92559072 TTTCTTTGGCAGCTGGGAGGTGG - Intronic
1058789288 9:108425195-108425217 TTCCTTTGGAAGCATGGTATAGG + Intergenic
1059142183 9:111864114-111864136 TTCCTTTGGGAGAGGAGTGGAGG - Intergenic
1059348122 9:113646119-113646141 TCCCTCTGGCAGCTGGGTGGAGG + Intergenic
1059785501 9:117578508-117578530 ATCCTTTGAAATCCAGGTGGAGG - Intergenic
1059887120 9:118758434-118758456 ATTCTTTGGAATCTGGGTGGAGG + Intergenic
1060404062 9:123364482-123364504 TTCCATTCCAAGCCGGGTGGGGG + Intronic
1061199102 9:129126060-129126082 ATCCTTTGAAACCCGGGAGGCGG + Intronic
1062235442 9:135505717-135505739 TTAATTTTGAGGCCGGGTGGAGG + Intergenic
1062280661 9:135750314-135750336 GGCATTTGGAAGCAGGGTGGGGG + Intronic
1186001218 X:5013321-5013343 TTCCTTTGGATACCAGGTAGTGG - Intergenic
1186063564 X:5737785-5737807 ATCCCCTGGAAGCAGGGTGGAGG - Intergenic
1186490070 X:9964424-9964446 TTCCTTGGGAAGTCGGGGAGAGG + Intergenic
1187534485 X:20126912-20126934 TTCCTTTTGAAGCCATGTGAAGG + Exonic
1188738051 X:33742365-33742387 TTTCTTTGGCAGCTGGGAGGCGG - Intergenic
1190232642 X:48594282-48594304 TTTCTTTGGAAGCAGAGTGGTGG + Intronic
1190580355 X:51887651-51887673 TTCATTTGGCAGCGGGGAGGGGG - Intronic
1192153609 X:68726939-68726961 TTCTTTTGGAAGGAGGTTGGTGG + Intergenic
1193085651 X:77446487-77446509 GGCCATTGGAAGCCTGGTGGGGG - Intergenic
1193156802 X:78183066-78183088 TTCCTTTCGCAGCTGGGAGGAGG + Intergenic
1194838674 X:98713384-98713406 ATCCTCTGAAATCCGGGTGGAGG - Intergenic
1195529333 X:105934249-105934271 TTCTTTTAGGAGCCAGGTGGTGG + Exonic
1196582543 X:117393993-117394015 ATCCTTTGAAATCCAGGTGGAGG + Intergenic
1201532756 Y:15010288-15010310 ATCCCCTGGAAGCAGGGTGGAGG + Intergenic