ID: 1083332832

View in Genome Browser
Species Human (GRCh38)
Location 11:61906956-61906978
Sequence GGGCGGTCCCAGAACTCTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 100
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 93}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083332832_1083332845 19 Left 1083332832 11:61906956-61906978 CCATGAGAGTTCTGGGACCGCCC 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1083332845 11:61906998-61907020 CAGGCCTCACATTTTGCAGATGG 0: 1
1: 0
2: 4
3: 39
4: 238
1083332832_1083332841 0 Left 1083332832 11:61906956-61906978 CCATGAGAGTTCTGGGACCGCCC 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1083332841 11:61906979-61907001 CCAGGAGCCAGGAAAGGCCCAGG 0: 1
1: 0
2: 10
3: 80
4: 698
1083332832_1083332836 -6 Left 1083332832 11:61906956-61906978 CCATGAGAGTTCTGGGACCGCCC 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1083332836 11:61906973-61906995 CCGCCCCCAGGAGCCAGGAAAGG 0: 1
1: 0
2: 3
3: 37
4: 397
1083332832_1083332848 28 Left 1083332832 11:61906956-61906978 CCATGAGAGTTCTGGGACCGCCC 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1083332848 11:61907007-61907029 CATTTTGCAGATGGGCAACCAGG 0: 1
1: 0
2: 18
3: 147
4: 991
1083332832_1083332846 20 Left 1083332832 11:61906956-61906978 CCATGAGAGTTCTGGGACCGCCC 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1083332846 11:61906999-61907021 AGGCCTCACATTTTGCAGATGGG 0: 1
1: 0
2: 5
3: 24
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083332832 Original CRISPR GGGCGGTCCCAGAACTCTCA TGG (reversed) Intronic
900168632 1:1255329-1255351 GGGCCGTCCCAAACCTCGCAGGG - Exonic
902806245 1:18863084-18863106 GGGCCATCCCAGAACCCCCATGG - Intronic
905322029 1:37124667-37124689 GGGAGAACCCAGAACTCTCACGG - Intergenic
905925239 1:41745052-41745074 TGGGGGTCCCAGCACTATCAAGG + Intronic
912952126 1:114127440-114127462 GGGCAGTCCCAGAAAAGTCAAGG + Intronic
919744556 1:201000345-201000367 GGGCGGTCTGAGGGCTCTCAGGG + Intronic
920029881 1:203030444-203030466 GGGTGACCCCAGAAATCTCATGG + Intronic
921940578 1:220834616-220834638 GGGCTGGCCAAGAAGTCTCAAGG - Intergenic
923706974 1:236351952-236351974 GGATGTTCCCAGAACTGTCATGG + Intronic
1069072672 10:64005758-64005780 GAGAGGTCCCAGACCTCTAAGGG + Intergenic
1074566346 10:114581764-114581786 GACAGGTCCCAGAACTTTCATGG - Intronic
1076247943 10:128962143-128962165 GGGCAGCCCCAGACCTCCCAAGG + Intergenic
1077468077 11:2743166-2743188 GGGCATTCCCAGAAATCACAGGG + Intronic
1080757353 11:35214878-35214900 GGGGGGTCCCATACCACTCATGG + Exonic
1081702627 11:45161630-45161652 GAGCCGTCCCGGGACTCTCAGGG - Intronic
1081840976 11:46201208-46201230 GGGAAGTCCTAGAACTCTCCTGG - Intergenic
1083167402 11:60899199-60899221 GGCCTGTCACAGCACTCTCATGG + Exonic
1083173288 11:60935163-60935185 GGGTGCTCCCAGCACCCTCACGG - Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1090230571 11:125100191-125100213 GGGCAGTCCCAGAGAGCTCATGG - Intronic
1090897583 11:130992047-130992069 GGGAGGTGCCATGACTCTCAGGG + Intergenic
1095133572 12:38571601-38571623 GGGCGATGCCAGCACTCTCTTGG - Intergenic
1095514326 12:42989636-42989658 GGGAGGTTGCAGAACCCTCATGG - Intergenic
1095520032 12:43052606-43052628 GGGTGTTCCCAGAAGACTCAAGG + Intergenic
1095746637 12:45666730-45666752 GGGGGTTTCCAGAACTGTCATGG + Intergenic
1103518132 12:121520686-121520708 GGCAGGTCCCTGAAATCTCACGG + Intronic
1103627092 12:122227518-122227540 GCGTGGTCCCCGAGCTCTCAGGG + Exonic
1103676683 12:122661352-122661374 GGGCAGTCCCAGCAACCTCAGGG - Intergenic
1111405498 13:87799089-87799111 AGAGGGTCCCAGAACTTTCAAGG - Intergenic
1112113225 13:96325646-96325668 GGATGGTTCCAGAACTCCCAAGG - Intronic
1121344141 14:93122744-93122766 AGGTGGTCTCAGACCTCTCAGGG + Intergenic
1122685583 14:103504039-103504061 GGGCTGTGCCACAACTCCCAGGG - Intergenic
1123117396 14:105900859-105900881 GGGTGGGCCCAGGACTCTCTGGG + Intergenic
1128019981 15:64381644-64381666 GGGCGGTACCAGGACTCTCCAGG + Intronic
1130737973 15:86570547-86570569 GGGTGTTCCCCGAACTGTCATGG + Intronic
1131510074 15:93044929-93044951 GGGCGGTCCCAGCCCACACATGG + Exonic
1138419969 16:56892718-56892740 GGGCAGTCCCAGAGCCCTCTGGG - Intronic
1140046485 16:71443164-71443186 GGATGGTCCCAGGACTCTGACGG - Intergenic
1152659008 17:81533913-81533935 CGGCGTTCCCACACCTCTCATGG + Intronic
1161441033 19:4291703-4291725 CTGGGGTCCCAGAGCTCTCAGGG - Intergenic
1162095890 19:8309734-8309756 GGGCGGTCTCAGCACCCTCTTGG + Intronic
1163550645 19:17964799-17964821 GGGCAGTCCCCGATCCCTCAGGG + Intronic
1167424505 19:49423184-49423206 TGCCAGTCCCAGAACTCCCAGGG - Intronic
1167444272 19:49528223-49528245 GGGGGGTCCCAGACCTGCCAGGG - Intronic
1168361893 19:55748227-55748249 AGGCAGTCCCAGAAATTTCATGG - Intergenic
927101606 2:19791777-19791799 AGGGTGTCCCAAAACTCTCAAGG - Intergenic
927892379 2:26759833-26759855 GAGTGGACGCAGAACTCTCAAGG - Intergenic
929034526 2:37678009-37678031 GGGAGTTCCAAGTACTCTCAAGG - Intronic
931053572 2:58441653-58441675 TGGTGGTCCCAGGACTCCCAAGG + Intergenic
936454891 2:112665485-112665507 AGGCAGTGCCAGAACTCTGAGGG - Intergenic
936792075 2:116162854-116162876 GGATGGTCCCAGAAGTGTCATGG + Intergenic
937529303 2:122808962-122808984 TGGGGGTCCTAGAACTCCCAAGG - Intergenic
937656203 2:124379698-124379720 GGGCGCTGCCAGACCTCACAAGG - Intronic
942940254 2:181607239-181607261 GTGCGGTCCAGGGACTCTCAGGG - Intronic
947791021 2:232869402-232869424 GGGCGCTGACAGAACTCTGAGGG + Intronic
948591649 2:239054306-239054328 GGTCGGTGCCAGAACTCAGAGGG + Intronic
1170609633 20:17902115-17902137 GGCCCTGCCCAGAACTCTCAAGG + Intergenic
1177150385 21:17449798-17449820 GGGTGTTCCCAGAAGTGTCATGG + Intergenic
1179015653 21:37592707-37592729 GGTCGGGACCAGGACTCTCAGGG - Intergenic
1180004490 21:45013884-45013906 GGGTGTTCCCAGAACTGTCCTGG + Intergenic
1180073150 21:45448780-45448802 GGGCAGTCCCAGAGCCGTCAGGG + Intronic
1182300094 22:29332288-29332310 GGGTGGTCCCAGAGTTTTCAAGG - Intronic
1182722146 22:32411903-32411925 GGGCGGCCCCAGAACCGTGAGGG + Intronic
1183554660 22:38515873-38515895 GTGAGGTCCAAGAACTCTCTCGG + Intergenic
950680863 3:14584248-14584270 GGCCGGTCCCATAACTCTCTTGG + Intergenic
953561554 3:43996740-43996762 GGGCGGTCCCGGAGCGCACACGG - Intergenic
961463161 3:127065840-127065862 GGCCTGCCCCAGAACTCTCCCGG - Intergenic
966649492 3:182283382-182283404 GGGGTGGCTCAGAACTCTCAGGG + Intergenic
966943512 3:184761609-184761631 GGGGTGTGCCAGAACTCTCCTGG + Intergenic
968678508 4:1899387-1899409 GGGCGGACCCTGACCTCTGATGG - Exonic
969158060 4:5230623-5230645 GGGCTGTCCCAGACCTTTCCAGG - Intronic
969306325 4:6328081-6328103 GGGCTCTCCCAGACCTCTGAGGG - Intronic
971421427 4:26477189-26477211 GGGTGGTCTCAGAACGGTCATGG - Intergenic
972956219 4:44395489-44395511 GGGTGTTCCCAGAATCCTCATGG - Intronic
976635360 4:87281807-87281829 GGGTGTTCCCAGAACTGTCATGG - Intergenic
982665092 4:158251674-158251696 GGGTGGTCCCAGAACTGTCATGG - Intronic
983266042 4:165509181-165509203 GGGGGATACCAGAACTCTGAGGG + Intergenic
990399946 5:55428213-55428235 GGGGCATCCCAGAATTCTCACGG - Intronic
991298229 5:65103240-65103262 CGGCCGTCCCAGAACTTTCCAGG - Intergenic
995130286 5:108622934-108622956 GAGTGTTCCCAGAACTGTCATGG + Intergenic
1009558258 6:65203053-65203075 GGGCAGTGCCTGGACTCTCAGGG - Intronic
1010784047 6:79979109-79979131 GGGCAGTCCCAGAACTAACCTGG - Intergenic
1017179484 6:151536990-151537012 AGGCGCCCCCAGATCTCTCAAGG - Intronic
1019303511 7:321631-321653 GGGCGATCCCAGAGCTCTGTGGG - Intergenic
1019577479 7:1744479-1744501 GGGAGGTGCCTGCACTCTCAGGG - Exonic
1019738413 7:2661432-2661454 GGGCAGCCCCCGAACTCTCCAGG - Intronic
1022552515 7:31254703-31254725 GAGAGTTCCCAGAACTGTCACGG - Intergenic
1032737107 7:134702555-134702577 GGGCGGGACCGGACCTCTCATGG - Intergenic
1038035602 8:23683367-23683389 GAGAGCACCCAGAACTCTCACGG - Intergenic
1038345322 8:26726924-26726946 GGGCAGTCCAGGAAGTCTCATGG - Intergenic
1039180839 8:34864279-34864301 GGGTGTTCCCAGAACTGTCATGG + Intergenic
1041384090 8:57280174-57280196 GCGCGGTCCCAGCTGTCTCAGGG - Intergenic
1044300760 8:90580498-90580520 GGGTGTTTCCAGAACTGTCATGG - Intergenic
1050783025 9:9363044-9363066 GCACAGTTCCAGAACTCTCAAGG - Intronic
1051923863 9:22299480-22299502 GGGTGATGCCAGAACTCTCTTGG + Intergenic
1053165393 9:35840804-35840826 GGGCTGGCCCAGAATGCTCAGGG + Intronic
1057271917 9:93656303-93656325 GGGCACTGACAGAACTCTCATGG + Intronic
1186295181 X:8141462-8141484 GGGTGTTCCCAGATCTGTCATGG + Intergenic
1187475807 X:19609837-19609859 AGGAGATCGCAGAACTCTCAGGG - Intronic
1198256658 X:134929998-134930020 GGGTGTTCCCAGAACTGTTATGG + Intergenic