ID: 1083332836

View in Genome Browser
Species Human (GRCh38)
Location 11:61906973-61906995
Sequence CCGCCCCCAGGAGCCAGGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 438
Summary {0: 1, 1: 0, 2: 3, 3: 37, 4: 397}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083332830_1083332836 -2 Left 1083332830 11:61906952-61906974 CCTCCCATGAGAGTTCTGGGACC 0: 1
1: 0
2: 2
3: 11
4: 121
Right 1083332836 11:61906973-61906995 CCGCCCCCAGGAGCCAGGAAAGG 0: 1
1: 0
2: 3
3: 37
4: 397
1083332832_1083332836 -6 Left 1083332832 11:61906956-61906978 CCATGAGAGTTCTGGGACCGCCC 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1083332836 11:61906973-61906995 CCGCCCCCAGGAGCCAGGAAAGG 0: 1
1: 0
2: 3
3: 37
4: 397
1083332831_1083332836 -5 Left 1083332831 11:61906955-61906977 CCCATGAGAGTTCTGGGACCGCC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1083332836 11:61906973-61906995 CCGCCCCCAGGAGCCAGGAAAGG 0: 1
1: 0
2: 3
3: 37
4: 397

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083332836 Original CRISPR CCGCCCCCAGGAGCCAGGAA AGG Intronic
900152621 1:1185287-1185309 CTGTCCCCAGCAGCCAGCAAAGG + Intronic
900164500 1:1239380-1239402 GCGCCCCCAGGGGCCAGGCCAGG + Intergenic
900472083 1:2860000-2860022 GTGCCCCCTGGAGTCAGGAATGG + Intergenic
900513499 1:3070849-3070871 CCTCACCCAGGGGCCGGGAACGG - Intronic
900740749 1:4329311-4329333 CAGGCACCAGGGGCCAGGAATGG + Intergenic
900826081 1:4928069-4928091 CCTCCCACAGCAGCCAGGAAAGG + Intergenic
901023519 1:6267176-6267198 CAGCCCACAGGAGCCAGGTCCGG + Intronic
901160412 1:7172971-7172993 CCTCCCCGAGGCACCAGGAAGGG - Intronic
901290443 1:8120027-8120049 CCCTCCCCAGGAGTCAGCAAGGG + Intergenic
901628077 1:10634855-10634877 CCGCCCCCAAGAGCCGGGAGGGG - Intergenic
901637237 1:10676046-10676068 CCAACCCCAGCAGCCAGGGAGGG + Intronic
902923373 1:19680369-19680391 CCCCACCCAGGAGCCAGAACAGG - Intergenic
903473654 1:23604950-23604972 CCACCACCAGAAGCTAGGAAGGG + Intronic
903652030 1:24928425-24928447 CCACCCCCAGGAGCACGGAGAGG + Intronic
903838073 1:26218861-26218883 CTGTCCCCAGGGGCCAGGCACGG - Intergenic
904009646 1:27382494-27382516 CCGGCCAGAGGAGCCAGGTATGG - Exonic
904207353 1:28863689-28863711 CCGGGCCCAGGACCCAGAAAGGG + Exonic
905875946 1:41432155-41432177 CCTCCCCCAGGAGCAAAGCAGGG - Intergenic
906071109 1:43017099-43017121 CAGTCACCAGGAGCCAGGAGAGG + Intergenic
906935663 1:50212161-50212183 CCGATGCCAGGAGCCAGGGAGGG - Intergenic
907222399 1:52916628-52916650 AGCCCCCCAGGAGCCAGGCAGGG + Intronic
907417106 1:54322171-54322193 CCTGTCCCAGCAGCCAGGAAGGG - Intronic
907485662 1:54776305-54776327 CCGGCCCCAGGAGCCGGGGAGGG + Intergenic
907557763 1:55359475-55359497 CCACCACCAGAAGCTAGGAAGGG + Intergenic
908390695 1:63680996-63681018 CAACCCCCAGGAGCTAGGAGAGG + Intergenic
912977267 1:114342049-114342071 CCGTTCCCAGCAGCCAAGAATGG + Intergenic
915664515 1:157432363-157432385 GGGCCCCCAGGAGACAGCAATGG - Intergenic
916126488 1:161576081-161576103 CCACACCCAGGAGGAAGGAATGG - Intergenic
916136407 1:161657921-161657943 CCACACCCAGGAGGAAGGAATGG - Intronic
916353511 1:163878632-163878654 CCTCCCTCAGCAGCCAGGGATGG + Intergenic
916561655 1:165938953-165938975 CAGCCTCCAGAAGCTAGGAAAGG - Intergenic
917989890 1:180363780-180363802 CCTCCCACAGCAGCCAGGGAAGG + Intronic
918799995 1:188959747-188959769 CCTCCCCCAGGAGCCTGAATAGG - Intergenic
919925172 1:202188429-202188451 TGGCCCACAGCAGCCAGGAAGGG - Intergenic
921964806 1:221076774-221076796 CAGTTCCAAGGAGCCAGGAAGGG + Intergenic
922748725 1:228060932-228060954 CCGCCATGAGGGGCCAGGAAGGG - Exonic
922915891 1:229257438-229257460 CAGCCCCCAGAAGCCAGGAGCGG - Intergenic
922984801 1:229857943-229857965 CACCACCCAGGAGCCAGGGATGG - Intergenic
923337123 1:232979960-232979982 CCTCCCGGAGGTGCCAGGAAAGG - Exonic
923791497 1:237115123-237115145 CCCCTCCCAGCAGCCAGCAAAGG - Intronic
924090204 1:240493436-240493458 CCGCCACCAGGAACAAGGACAGG + Exonic
924853638 1:247855492-247855514 GTGCCCCCAGAAGCCATGAAAGG - Intergenic
1062843418 10:688327-688349 CCGTCCCCAGAAGTCTGGAAAGG + Intronic
1063995024 10:11611313-11611335 CCTCCTCCAGGGGCCGGGAATGG + Intronic
1064528734 10:16285027-16285049 CAGATCCAAGGAGCCAGGAAAGG - Intergenic
1064627797 10:17279153-17279175 CAGCTCCCAGGAGCCAGCTAGGG + Intergenic
1066166213 10:32790480-32790502 CAGCAGCCAGGACCCAGGAATGG - Intronic
1067233200 10:44426155-44426177 TCCTCCCCAGGAGCCAGGACAGG - Intergenic
1067498940 10:46785255-46785277 CCGCCTGCAGGAGCCAGGCGAGG + Intergenic
1067595702 10:47555118-47555140 CCGCCTGCAGGAGCCAGGCGAGG - Intergenic
1067750537 10:48968517-48968539 CCCCCACCAGGAGGAAGGAAAGG + Intronic
1070775758 10:79108853-79108875 TCAGCCCCAGGAGCCAGGCAGGG - Intronic
1075637152 10:124037031-124037053 CAGCCACCAGAAGCCAGGAGAGG - Intronic
1076634935 10:131875819-131875841 CAGTCCCCAGGAGCCACGCAGGG + Intergenic
1076792435 10:132784582-132784604 CAGCCGCCAGGAGCCCGGGACGG - Intergenic
1076896834 10:133317261-133317283 CCGCCCCCAGGACACAGAGATGG + Intronic
1076908741 10:133377155-133377177 CTCCCCGCAGGAACCAGGAACGG + Intergenic
1077029781 11:459963-459985 CAGCCCCCAGGAGGCTGGACAGG - Intronic
1078132057 11:8621164-8621186 CGAACCCCAGGAGCCAAGAAGGG - Exonic
1078271394 11:9798354-9798376 CCACCCCAAGGAGCCAGTGATGG + Intronic
1080208583 11:29758305-29758327 CAGCCACCAGAAGCCAGGAGAGG - Intergenic
1081613697 11:44578393-44578415 CTGTCCCCAGGGGCCAGGCATGG - Intronic
1081854924 11:46296991-46297013 CCTCTCCCAGGCCCCAGGAAGGG + Intronic
1083243909 11:61410902-61410924 AATCCCCCAGCAGCCAGGAACGG + Intronic
1083289143 11:61680278-61680300 GCGCCCCCTGGCGCCAGGGAGGG - Intergenic
1083332836 11:61906973-61906995 CCGCCCCCAGGAGCCAGGAAAGG + Intronic
1083776541 11:64896856-64896878 CCACACCCAGGAGCCTGGCAGGG + Exonic
1083832457 11:65241569-65241591 CCCACCCCAGGAGGCAGGGAGGG - Intergenic
1083936330 11:65871925-65871947 ACACCCCCAGGAACCCGGAAAGG - Intronic
1084325835 11:68399620-68399642 TCCCTCCCAGGAGCCAGGACAGG + Intronic
1084897291 11:72282687-72282709 CAGCTTCCAGGAGCCAGGAGGGG - Intergenic
1084946098 11:72639410-72639432 CCGCTGACATGAGCCAGGAAGGG + Intronic
1084961843 11:72720987-72721009 CTGCCCTCAGGAGCCAGCACAGG - Intronic
1085393707 11:76195477-76195499 CCGCCACCAGGAGCTAGGGACGG + Intronic
1085605165 11:77891042-77891064 AAGCCCCCAGGACCCAGTAAGGG - Intronic
1088278511 11:108114349-108114371 CAACCCCCAGAAGCCAGAAAAGG - Intergenic
1089592432 11:119552223-119552245 CCCCTCCCAGGATCCTGGAAAGG + Intergenic
1089748043 11:120630596-120630618 CCCCTCTCAGGAGCCAGGTAAGG + Intronic
1090052504 11:123392063-123392085 CTTCCCCCAGGATCCATGAATGG - Intergenic
1090265705 11:125351599-125351621 CAGACCCCAGGAGCTAGGACTGG + Intronic
1090277186 11:125428664-125428686 CCGCCCCCAGCAGGCAGGGCAGG - Intronic
1090333642 11:125948908-125948930 AGGACCCCAGGAGACAGGAATGG + Intergenic
1090399041 11:126436591-126436613 CCTCCACCAGGAACCAAGAAAGG - Intronic
1090674464 11:128977089-128977111 CAGCCACCAGGAGCTTGGAAAGG + Intronic
1090852659 11:130584151-130584173 CTGCCCCCAGGAGAGTGGAAGGG + Intergenic
1091355930 11:134937711-134937733 CCAGCCCCAGGAGCCTGAAAAGG - Intergenic
1091677738 12:2503677-2503699 CAGCCCCCAGGAGCCAGCTCCGG + Intronic
1091888298 12:4032166-4032188 GCGCCCACAGGCCCCAGGAAGGG - Intergenic
1091910730 12:4228503-4228525 CCGCCCCCTGGAGCATGGACTGG + Intergenic
1092017686 12:5172837-5172859 CAGCCCGCAGGTGCCAGGAGCGG - Intergenic
1094545552 12:31401397-31401419 CCGCCCCCAGGAGCCCAGTTTGG - Intronic
1097195039 12:57238476-57238498 GCGCCTCCAGGGCCCAGGAAGGG + Intronic
1100476677 12:94941512-94941534 CAGTCCCCAGGAGCCCGCAATGG - Intronic
1101491602 12:105214829-105214851 CCGCCCCCATCTTCCAGGAACGG + Intronic
1101692375 12:107093850-107093872 CCGCCCCCAAGGGCCATGAGCGG + Intergenic
1101857385 12:108455294-108455316 CCTACCCAGGGAGCCAGGAATGG + Intergenic
1102970303 12:117161153-117161175 CCGCACACAGGAACCAGGGAAGG + Intronic
1103002303 12:117394520-117394542 ACGCCCCCAGGAGCTATCAAAGG - Intronic
1103940109 12:124496734-124496756 CCCTCCCCAGGTGCCAGGGATGG + Intronic
1103952293 12:124557868-124557890 AAGCCCCCAGGACCCAGGAAAGG + Intronic
1104735138 12:131131895-131131917 CCGGCCACAGGAGGCAGGAGTGG - Intronic
1104943048 12:132403865-132403887 CCTCGCCCAGGAGCCAGGGAGGG + Intergenic
1105510383 13:21047189-21047211 CCGCCCTCAGCAGCCAGCACAGG + Intronic
1105541612 13:21321183-21321205 CTGCCCCCAGGAGCCAAGGAGGG - Intergenic
1106182523 13:27381316-27381338 CCGCCCCCAGGAACGAGAAGAGG - Intergenic
1106379409 13:29222618-29222640 GAGCCAGCAGGAGCCAGGAACGG + Intronic
1106759694 13:32856719-32856741 ACTCCCTCAGGAGTCAGGAAAGG - Intergenic
1108024983 13:46168417-46168439 CAGCCCCCAGGAGCGAGGCTGGG - Intronic
1112839997 13:103564191-103564213 CCATCCTCAGGACCCAGGAATGG - Intergenic
1113082906 13:106535834-106535856 CCGCCCGCGGGAGCCAGGGGCGG - Intergenic
1113415662 13:110126602-110126624 CTGCCTCCGGGAGCCAGGGACGG - Intergenic
1113960674 13:114124060-114124082 CAGCCCCCAGAAGCCCGGCACGG + Intronic
1115521212 14:34234674-34234696 CCCCAGCCAGGAGACAGGAAGGG + Intronic
1115695828 14:35897885-35897907 CTGCCACCAGGAGCTAGGACAGG - Intronic
1117873219 14:60222136-60222158 ATGCCCTCAGGAGCCATGAAGGG + Intergenic
1118650826 14:67892558-67892580 CATCTCCCAGGAGCCAGGCAAGG - Intronic
1118734278 14:68690813-68690835 CCGCTCCCAGAAGGGAGGAAGGG - Intronic
1120650092 14:87121977-87121999 CAGCCCTCTGGAGGCAGGAAGGG - Intergenic
1121318158 14:92974443-92974465 CTGCTCCTAGGAGCCAGGCAGGG - Intronic
1121483401 14:94295263-94295285 CAGCACCGAGGAACCAGGAAGGG + Intergenic
1121694840 14:95904219-95904241 CCCCCCACAGGAGCCAGTGATGG - Intergenic
1122020774 14:98836311-98836333 CCACCTCCAGAAGCCTGGAAAGG - Intergenic
1122232766 14:100315119-100315141 CCACCACAAAGAGCCAGGAATGG - Intergenic
1122323026 14:100866880-100866902 CCGCCTCCTGGTCCCAGGAAGGG - Intergenic
1122549870 14:102544153-102544175 CAGCCCCCAGATGCCAGCAAAGG + Intergenic
1122688332 14:103520456-103520478 CCTCACCCAGGTGCCAGGGACGG - Exonic
1122790392 14:104181897-104181919 CCCCCGCCTGGAGCCAGGGAGGG - Intergenic
1122806948 14:104264622-104264644 CCGCCCCCAAGGGCAAGGACCGG + Intergenic
1122985887 14:105211447-105211469 CAGCCCCCAGGAGGCCAGAAGGG - Intronic
1122995842 14:105263508-105263530 CAGTCCCGAGGTGCCAGGAAGGG + Intronic
1123071942 14:105646274-105646296 CAGCCTCCTGGTGCCAGGAAGGG - Intergenic
1124016061 15:25876967-25876989 TCGCCCCCAGGAGCTACGTAGGG + Intergenic
1125599236 15:40906559-40906581 ACACCCCCAGGAGCCAGGGTAGG - Intergenic
1128350034 15:66882298-66882320 CCTCCTCCTGCAGCCAGGAAAGG + Intergenic
1128776996 15:70328169-70328191 CCACCCCCATGAGGCAGGGATGG + Intergenic
1128805285 15:70526420-70526442 CGGCCCCAGGGAGCCAGAAATGG - Intergenic
1130040053 15:80398953-80398975 CCGGCCCCAGGAGGAAGGCATGG - Intronic
1130086004 15:80779106-80779128 CCGCCCGCAGCAGCCAGGTGAGG - Intergenic
1130362981 15:83207761-83207783 CCGCGCCCGGGAGCCCGGGAGGG - Exonic
1130981646 15:88815984-88816006 CTGCCACCAGAAGCCAGGAAGGG - Intronic
1132276377 15:100568519-100568541 CTGCCACCAGAAGCCAGAAAGGG + Exonic
1132338454 15:101063510-101063532 CCGCCCACAGGATTCAGGCACGG + Intronic
1132383782 15:101385390-101385412 CTGCCCACAGCAACCAGGAACGG + Intronic
1132552975 16:560827-560849 CCGCCCTCAGGGGCCAGGCGGGG + Intronic
1132655068 16:1038408-1038430 AAGCCCCCAGGAGCCAGGGCTGG - Intergenic
1132728629 16:1349801-1349823 CCACCCCCAGGCAGCAGGAAGGG + Intronic
1132747599 16:1443449-1443471 CTGCCCCCAACACCCAGGAAAGG + Intronic
1133353355 16:5117519-5117541 CCCACCGCAGGAGCCACGAATGG + Intergenic
1133433811 16:5761925-5761947 CCCCTCCCAGGAGGCAGGGATGG + Intergenic
1133885725 16:9825913-9825935 CAGGCCCCAGAAGCCAAGAATGG + Intronic
1134031403 16:10995372-10995394 CCGGCCTCAGGCGCCAGGACTGG - Intronic
1134091198 16:11392495-11392517 CTGCCCCCTGGAGCCAGAAAGGG + Exonic
1134462995 16:14446090-14446112 CCGCCCCCTGCAGCAGGGAATGG + Intronic
1136402708 16:30027279-30027301 CCTGTCCCAGGAGGCAGGAATGG - Intronic
1138288066 16:55824954-55824976 CCCTCCCCAGGAGGCAGGCAGGG - Intronic
1141920739 16:87133819-87133841 CAGCCACCAGGAGCCAGGAGAGG - Intronic
1142114266 16:88348227-88348249 CAGCCACCAGGAGCCAGAAGAGG - Intergenic
1142624018 17:1180808-1180830 CAGCCCACAGGAGACAGGCATGG - Intronic
1143389145 17:6549837-6549859 CTGCAGCCAGGAGCCCGGAAGGG - Intronic
1143764790 17:9130401-9130423 CCTCCCCCAGTACTCAGGAAAGG - Intronic
1144961565 17:19047132-19047154 CAGACCCCAGGTGCCAGGAATGG + Exonic
1144973595 17:19127392-19127414 CAGACCCCAGGTGCCAGGAATGG - Intergenic
1145005136 17:19333288-19333310 CAGCCCCCAGGAACCATGACTGG - Intronic
1145126254 17:20302345-20302367 CAGCCCACAGGAGCCGGGCAGGG - Intronic
1146477346 17:33173515-33173537 CACCCTCCAGGAGGCAGGAAGGG - Intronic
1146480949 17:33204412-33204434 CCACCCCCGGGAGTCAGGCAGGG + Intronic
1146483650 17:33225780-33225802 CAGCCACCAGCAGCCAGGAAAGG + Intronic
1146634468 17:34493871-34493893 CCAACCCCAGGAGACAGGTAAGG - Intergenic
1147155677 17:38543520-38543542 CCTCCTCCAGGAGCCAGCAGTGG + Intronic
1148127862 17:45246073-45246095 CCTGCCCCAGGAGCCTGGGATGG + Intronic
1148687629 17:49509489-49509511 CCACCCACTGGTGCCAGGAAGGG + Intronic
1148860926 17:50604035-50604057 CTGCCACCAGAGGCCAGGAAGGG + Intronic
1151320682 17:73350545-73350567 GCGCTGCCAGGAGCCAGGAGAGG + Intronic
1151336297 17:73441606-73441628 CCACCACCGGAAGCCAGGAAGGG + Intronic
1151601701 17:75109973-75109995 CCGAGCCCAGGAGCCGGGGACGG + Exonic
1151926419 17:77200862-77200884 CCGCCCCGGGCAGCCAGGAAGGG + Intronic
1152066408 17:78114974-78114996 GAGCCCCCAGGGGCCAGGTAGGG - Intronic
1152084937 17:78212252-78212274 CTGCCCTCAGGAGGGAGGAAAGG - Intergenic
1152190112 17:78883143-78883165 CGGCCCCCGGAAGCCAGCAACGG + Intronic
1152564524 17:81094197-81094219 CTGTCCCCAAGAGCCAGCAAAGG - Intronic
1152730411 17:81967146-81967168 CCTCCCCCAAGAGCCAGCCAAGG - Intergenic
1152797346 17:82314825-82314847 CAGCCAGCAGGAGCCAGGGAGGG - Intergenic
1152862687 17:82705058-82705080 CCACCCCTCGGAGCCAGGCAGGG + Intergenic
1155057878 18:22200828-22200850 ACGCCGCCAGGAGGCAGGGAGGG + Exonic
1155280433 18:24234029-24234051 CTGCCCGGAGGAGTCAGGAAAGG + Intronic
1156844277 18:41646120-41646142 CAGCCTCTAGAAGCCAGGAAAGG - Intergenic
1157548068 18:48561538-48561560 CAGCCCCCAGCAGCCAGCACAGG - Intronic
1158077257 18:53545131-53545153 CAGCCACCAGGAGCCAGAAAAGG + Intergenic
1158954352 18:62524347-62524369 CCGGCCCCAGGGCCCAGGTAAGG + Exonic
1160264977 18:77334586-77334608 CCGGCTCCAGGAGTCAGGCAAGG + Intergenic
1160737918 19:673021-673043 CGGCCTCTAGGAGCCTGGAAAGG - Intergenic
1160827770 19:1088708-1088730 CCGCCTCTAGGGGCTAGGAAAGG + Exonic
1161352533 19:3801917-3801939 CCTTCCCCGGGAGCCAGGGATGG + Intronic
1161438588 19:4278585-4278607 CCGCCCCCAGAAGCCACAAAAGG + Exonic
1161909186 19:7179981-7180003 CTTACCCCAGCAGCCAGGAAGGG - Intronic
1162319096 19:9960241-9960263 CAGCCCCCAGCACCCTGGAAAGG + Exonic
1162911772 19:13851473-13851495 CTGCCCCCAGGAGCCCGGCCTGG + Intergenic
1163055468 19:14714435-14714457 CCGCCACCAGAAGCCAGGGAGGG + Intronic
1163167629 19:15508726-15508748 ACCCCCCCAGGACCCAGGACGGG + Intronic
1164574992 19:29400752-29400774 ATGCCCCCAGGAGCCAAGGATGG - Intergenic
1164806070 19:31118106-31118128 CCCACCCCAAGAGACAGGAAGGG + Intergenic
1165749928 19:38253409-38253431 CTTCCCCCAGGGGACAGGAAGGG + Intronic
1165882711 19:39054827-39054849 CAGCCTCCAGAAGCCAGGAGAGG - Intergenic
1166077266 19:40421049-40421071 TCGGCCCCAGGGGCCGGGAAGGG - Intergenic
1166296195 19:41890982-41891004 GAGCCCCCAGGAGCCAGGACAGG + Intronic
1167077992 19:47260630-47260652 CGGCCCCCAGGGGCCAGCAAGGG + Exonic
1167181491 19:47907538-47907560 GCGCCCCCTGGAGGGAGGAAGGG - Intergenic
1167182149 19:47912911-47912933 GCGCCCCCTGGAGGGAGGAAGGG - Intergenic
1167182807 19:47918289-47918311 GCGCCCCCTGGAGGGAGGAAGGG - Intergenic
1167183476 19:47923639-47923661 GCGCCCCCTGGAGGGAGGAAGGG - Intergenic
1167184115 19:47928678-47928700 GCGCCCCCTGGAGGGAGGAAGGG - Intergenic
1167184772 19:47934041-47934063 GCGCCCCCTGGAGGGAGGAAGGG - Intergenic
1167186097 19:47944782-47944804 GCGCCCCCTGGAGGGAGGAAGGG - Intergenic
1167186755 19:47950156-47950178 GCGCCCCCTGGAGGGAGGAAGGG - Intergenic
1167187407 19:47955542-47955564 GCGCCCCCTGGAGGGAGGAAGGG - Intergenic
1167361299 19:49031905-49031927 GCGCCCCCTGGAGGGAGGAAGGG + Intronic
1167362353 19:49036880-49036902 GCGCCCCCTGGAGGGAGGAAGGG - Exonic
1167541503 19:50090928-50090950 GCGCCCCCTGGAGGGAGGAAGGG + Intergenic
1167541776 19:50092727-50092749 GCGCCCCCTGGAGGGAGGAAGGG + Intergenic
1167542449 19:50098064-50098086 GCGCCCCCTGGAGGGAGGAAGGG + Intergenic
1167542886 19:50101129-50101151 GCGCCCCCTGGAGGGAGGAAGGG + Intergenic
1167543322 19:50104193-50104215 GCGCCCCCTGGAGGGAGGAAGGG + Intergenic
1167543756 19:50107252-50107274 GCGCCCCCTGGAGGGAGGAAGGG + Intergenic
1167544430 19:50112606-50112628 GCGCCCCCTGGAGGGAGGAAGGG + Intergenic
1167545105 19:50117958-50117980 GCGCCCCCTGGAGGGAGGAAGGG + Intergenic
1167545782 19:50123312-50123334 GCGCCCCCTGGAGGGAGGAAGGG + Intergenic
1167546459 19:50128640-50128662 GCGCCCCCTGGAGGGAGGAAGGG + Intergenic
1167547128 19:50133982-50134004 GCGCCCCCTGGAGGGAGGAAGGG + Intergenic
1167547787 19:50139355-50139377 GCGCCCCCTGGAGGGAGGAAGGG + Intergenic
1167622673 19:50568098-50568120 CCCCACCCAGGAGCCGGGGAGGG - Intergenic
1167627930 19:50604823-50604845 GCGCCCCCTGGAGGGAGGAAGGG - Intergenic
1168244065 19:55101629-55101651 CCGCCCCCAGGACTCAGGGGTGG + Intronic
1168307432 19:55443028-55443050 CAGGCGCCAGGAGGCAGGAAGGG + Intergenic
925164845 2:1709625-1709647 CCGGCCCCAGGAGGCCGGCAAGG + Intronic
925757860 2:7151242-7151264 CAGCCCCCAGGAGCCAGCAAAGG + Intergenic
926274312 2:11391884-11391906 GCGCCTCCAGGAACCAGGACTGG + Intergenic
926620056 2:15039510-15039532 CCTATCCCAGGAGCCAAGAAGGG + Intergenic
927209002 2:20627307-20627329 CAATCCCCAGGAGCCAGGGAGGG - Intronic
928286055 2:29990910-29990932 CCTCCAACAGCAGCCAGGAAAGG + Intergenic
930780817 2:55223706-55223728 CCGCCCCCAGGAGCCTCGGCAGG + Intronic
932501667 2:72187864-72187886 CCAACCCCAGGTGCCATGAATGG - Intronic
933078202 2:77955144-77955166 GCGCCCCCTGGAGGGAGGAAGGG + Intergenic
934521162 2:95021043-95021065 CCTCCTCCAGGAGACAGCAAGGG + Intergenic
934673731 2:96234418-96234440 CCCCTGCCAGGAGACAGGAATGG - Intergenic
935133003 2:100275308-100275330 CCTCCACAAGGAGCAAGGAACGG + Exonic
935329123 2:101963347-101963369 AGGCCCCCGGGAGCCAGGACTGG - Intergenic
936274620 2:111083743-111083765 TCTCTCCCAAGAGCCAGGAAAGG + Intronic
938117761 2:128613384-128613406 TACCCCTCAGGAGCCAGGAAAGG - Intergenic
939406014 2:141757329-141757351 AAGCTCCCAGGAGCTAGGAATGG - Intronic
941621342 2:167782664-167782686 TCCCCCCCAGGAGCTGGGAAGGG - Intergenic
942151001 2:173075986-173076008 CCCCGCCCGGGAGCCAGGTAGGG + Exonic
943257873 2:185619267-185619289 CAGCCCCTAGAAGCTAGGAAAGG + Intergenic
944528270 2:200642189-200642211 ACGTCCCCAGGAGCAGGGAAAGG + Intronic
947301096 2:228689271-228689293 GGGCCTCCAGGAGGCAGGAATGG - Intergenic
947991083 2:234488019-234488041 CTGCCTCCAGGAGTCAGGGAAGG + Intergenic
948193567 2:236078686-236078708 CCAGCCACAGGAGCCAGGTAGGG - Intronic
948517359 2:238512116-238512138 CAGCCCCCAGGAGCCAGAAGAGG + Intergenic
948921421 2:241067709-241067731 ACTCCCCCAGGAGCAAGGAGGGG + Intronic
1168892410 20:1303498-1303520 CCCCCACCTGGAGGCAGGAAGGG + Intronic
1168954518 20:1825823-1825845 CGGCCCCCAGGACCCAGGTCAGG + Intergenic
1169531473 20:6489746-6489768 CAGGCCCCAGGGGCCAGGAAAGG - Intergenic
1170309455 20:14976326-14976348 CAGCCACCAGAAGCCAGAAAAGG - Intronic
1170799188 20:19576473-19576495 CCACCGTCAGGTGCCAGGAAGGG + Intronic
1170951239 20:20938198-20938220 CCGGCCACCAGAGCCAGGAAGGG - Intergenic
1171233666 20:23507873-23507895 CAGCCTCTAGGAGCCAGGAAAGG + Intergenic
1171301217 20:24062371-24062393 CAGCCTCCAGGAGCCAGGGAAGG - Intergenic
1171413811 20:24964091-24964113 CCGCCCCCACCATCCAGGAACGG + Intronic
1172113210 20:32559653-32559675 AGGCCCCCAGGCGCCAGGACTGG + Intronic
1172443465 20:34980921-34980943 CCACCACCCAGAGCCAGGAATGG - Intronic
1172606251 20:36216190-36216212 CTGCCAGGAGGAGCCAGGAAAGG + Intronic
1173227116 20:41168460-41168482 CCGCTCCCAGGAGTCAGGGCTGG - Intronic
1173732502 20:45338501-45338523 CTGCCCCCAGGAGCCATGGAAGG + Intronic
1175109317 20:56635372-56635394 CTGCACCCTGGAGCCAGGGAAGG + Intronic
1175794956 20:61765705-61765727 CCGGGGCCAGGAGTCAGGAAGGG + Intronic
1176145576 20:63563915-63563937 CGGCCTGCAGGAGCCAGGAATGG + Exonic
1176379141 21:6103023-6103045 CGGCCACCAGGAGCCAGGAGAGG + Intergenic
1179152817 21:38822956-38822978 CTGCTCCGAGGACCCAGGAAAGG + Exonic
1179744332 21:43435214-43435236 CGGCCACCAGGAGCCAGGAGAGG - Intergenic
1179821877 21:43941772-43941794 CTCCGCCCAGGCGCCAGGAACGG - Intronic
1179918916 21:44496610-44496632 CCGCTCCCCGGTGCCAGGAGAGG + Intergenic
1181059177 22:20273768-20273790 CCGCACCCATGAGCCTGGGAAGG - Intronic
1181106619 22:20579496-20579518 CCGGAGCCAGGAGCAAGGAACGG + Intronic
1181264518 22:21623093-21623115 TCCCCCCCAAGAGCCAAGAAGGG - Exonic
1181277451 22:21695621-21695643 GGGCTCCCAGGGGCCAGGAAAGG - Intronic
1181937610 22:26449959-26449981 CAGCCACCAGGTGCCAGAAAAGG - Intronic
1182347094 22:29673934-29673956 CCTCCCCCATGTGCCAAGAAAGG - Intronic
1182684054 22:32107155-32107177 CTGCCCCAGGGAGGCAGGAAGGG - Intronic
1183949683 22:41345893-41345915 CTGGCCCCATGAGCCAGGCAGGG - Intronic
1184553121 22:45216121-45216143 CCACATCCAAGAGCCAGGAAAGG + Intronic
1184711074 22:46249934-46249956 CCGCCCCCAGGAGCCTCGGCAGG - Intronic
1184935273 22:47716358-47716380 CTGCCACCAGGGGCCAGGAGGGG + Intergenic
1185273344 22:49938526-49938548 CCCCACCCAAGAGCCAGGGATGG + Intergenic
1185279281 22:49963013-49963035 CAGCCCCCAGCATCCAGGGATGG - Exonic
1185280002 22:49965939-49965961 GCCGCCCCAGGAGCCAGAAAAGG - Intergenic
1185315704 22:50178322-50178344 CCGCCTCCCGGAGCCAGGAGGGG + Exonic
950441722 3:13014588-13014610 CTGCCCCCAAGAGCCAGGGCTGG + Intronic
950498609 3:13349485-13349507 CCCACCCCATGAGCCAGGGAAGG - Intronic
951718354 3:25673131-25673153 CCGCCCCCAGGTGCCAGCAAGGG + Intergenic
951790796 3:26481937-26481959 CAACCACCAGAAGCCAGGAAAGG + Intergenic
953415033 3:42710804-42710826 GTGTCCCCTGGAGCCAGGAAAGG - Intronic
953666335 3:44928863-44928885 CTGCCCTCAGGACCCAGGCATGG + Intronic
954370804 3:50168734-50168756 ACCCCCACAGGATCCAGGAAGGG - Intronic
954422793 3:50427355-50427377 CCGCCCACAGGAGCCAGCTGGGG - Intronic
954427387 3:50450523-50450545 TCGCCCACCAGAGCCAGGAAAGG + Intronic
954616206 3:51969894-51969916 CCCCTGCCAGGAGCAAGGAAGGG - Intronic
955349816 3:58185098-58185120 TGGCCACCAGAAGCCAGGAAGGG - Intergenic
955716619 3:61836451-61836473 TGGCCTCCAGGAGACAGGAAAGG - Intronic
957551294 3:81708928-81708950 CCACCCCAAGGAGCCAGGCCAGG + Intronic
958186011 3:90120034-90120056 CAGCAACCAGAAGCCAGGAAAGG - Intergenic
960255903 3:115511387-115511409 CAGCTCCCAAGAGCCAGAAAAGG + Intergenic
960702188 3:120450287-120450309 CCGCCCCCAGGAGACAGACTTGG + Intronic
961299285 3:125911935-125911957 CGGCCACCAGAAGCCAGGAGAGG - Intergenic
961695103 3:128698744-128698766 CCGCTCCCAGGGGCCAGGCTGGG - Intergenic
961783277 3:129334103-129334125 CCCACCCCATGAGCCAGGGAAGG - Intergenic
962193373 3:133334598-133334620 CTGCCCCAAGGAGTGAGGAAGGG - Intronic
963040410 3:141066029-141066051 CCACTCCCCGTAGCCAGGAATGG - Exonic
966390788 3:179451058-179451080 TCGCCCCGGGGAGCGAGGAACGG - Intronic
967557824 3:190878168-190878190 GCGCCCCCTGGAGGGAGGAAGGG + Intronic
968281000 3:197476625-197476647 CCACACCCTGGAGCCAGTAATGG - Intergenic
968501639 4:952928-952950 GCGGCCCCAGGAGCCAGCAGGGG + Intronic
968619104 4:1595696-1595718 CAGCTCCCAGGAGCCAGGCCCGG + Intergenic
968900566 4:3429754-3429776 CAGCCCCGAGGGGCCAGGACGGG - Intronic
969437066 4:7194291-7194313 CTGGCCTCTGGAGCCAGGAAAGG + Intronic
975690641 4:76959165-76959187 CAGACCCCAGCAGCCAAGAATGG - Intronic
976315697 4:83656576-83656598 GCTTCCCCAGGAGCCAGGTAGGG - Intergenic
979022141 4:115515973-115515995 CTGCTCCCAGCAGCCAGGAGAGG - Intergenic
981168515 4:141592296-141592318 CAGCCTCTAGGAGCTAGGAATGG + Intergenic
983099978 4:163613349-163613371 CAGCTCCCAGGAGCCAGTCAAGG - Exonic
983510952 4:168609283-168609305 CTGATCCCAGGAGACAGGAATGG + Intronic
983837051 4:172401878-172401900 CCTCCTCCAGAAGCCAGGGAAGG - Intronic
985508800 5:300125-300147 CAGCTCCCAGGAGCCAGCCAAGG - Intronic
985562997 5:601330-601352 CCACCCCAGGGATCCAGGAAGGG + Intergenic
985723528 5:1503172-1503194 CAGCCCCCAGAAGCGGGGAAGGG - Intronic
985739325 5:1605791-1605813 CAGCTCCCAGGAGCCAGCCAAGG + Intergenic
985888640 5:2699379-2699401 CGGCCCCCAAGGGCCAGGAGGGG + Intergenic
988515228 5:31898700-31898722 CTGCCCCCCAGAGCTAGGAAAGG - Intronic
989273684 5:39561628-39561650 CAGCCACTAGGAGCAAGGAAAGG - Intergenic
991263529 5:64691005-64691027 GCTCCCCCGGGAGCCAGGACAGG + Intronic
991474362 5:67004132-67004154 CCCCTCCCCGGAGCCCGGAATGG - Intronic
994817265 5:104599859-104599881 CCACCCCCAGGATTCAAGAAGGG - Intergenic
998119206 5:139561921-139561943 CCGCCCCGAGGGGCCAGCACCGG - Intronic
998177501 5:139911004-139911026 CCGGCCCCTGGAGCCAGGGGAGG - Intronic
999122561 5:149220429-149220451 ACTCTCCCAGGAGCCAGGAGAGG - Intronic
1001297678 5:170510151-170510173 CTGCCTACAGAAGCCAGGAAAGG - Intronic
1001858318 5:175031970-175031992 GGTCCCCCAGGAGACAGGAATGG - Intergenic
1002103608 5:176869293-176869315 GCACCCCCAGGAGCCAGCAGAGG + Intronic
1002182969 5:177441083-177441105 CCGTCCCCTGGAGCCAGGTTAGG - Intronic
1002183223 5:177442103-177442125 CTGCCCCCAGGAGCCAAGGCGGG - Exonic
1002441438 5:179266469-179266491 CAGCCCCCAGGAGCTGGGAGGGG + Intronic
1002441984 5:179269162-179269184 CAGCCCCCAGGAGCGGGGATGGG + Intronic
1002568621 5:180127880-180127902 CTGCCCCCATGAACCGGGAAAGG - Intronic
1002600916 5:180353470-180353492 CGGCCCCCAGGAGCCAGGGAGGG + Intergenic
1003156196 6:3597467-3597489 TTACCTCCAGGAGCCAGGAATGG + Intergenic
1005154720 6:22791417-22791439 CCGCCATCAGAAGCTAGGAAGGG + Intergenic
1006725545 6:36196926-36196948 CCGCGCCCAGGGGCCCCGAACGG + Exonic
1007070023 6:39029599-39029621 GCGCCCCCAGAGGCCAGGCATGG - Intronic
1007397335 6:41585345-41585367 CTGCCCCCAGGAGCCCAGATGGG + Intronic
1007830082 6:44631145-44631167 CCCCACCCAGGGGCCAGGCATGG - Intergenic
1014391596 6:120872089-120872111 AGGCACCCAGGAGCCAGGAGAGG - Intergenic
1018431227 6:163724374-163724396 CCGCCCCCCGGGGCCTGGAAAGG + Intergenic
1018445647 6:163855809-163855831 CCACCCCCAGCAGCCGGGGATGG + Intergenic
1019143564 6:169962813-169962835 CCGCGCCCAGGGCCCGGGAAAGG + Intergenic
1019394213 7:808334-808356 CAGAGCCCAGGACCCAGGAAAGG - Intergenic
1019415832 7:926176-926198 CCGCCCTGAGGAGCCAGGGCAGG + Intronic
1020085684 7:5309000-5309022 CCGACCCCAGGCCCCAGGACAGG + Intronic
1022536326 7:31100945-31100967 CTGCCCTGAGGAGCCAGCAATGG - Intronic
1022721129 7:32942748-32942770 AAGCCCCCAGGACCCAGGCAGGG - Intergenic
1024231952 7:47369399-47369421 CTGGCCCCAGGAACCAGGAGGGG - Exonic
1024558857 7:50627161-50627183 CTGCCCCCAGGAGGTGGGAAAGG - Intronic
1024971976 7:55079072-55079094 CAGCCTTCAGGAGCCAGGAGGGG + Intronic
1025099217 7:56121673-56121695 CCGCCCCCAGGACCAGGAAATGG + Intergenic
1025897681 7:65718939-65718961 AAGCCCCCAGGACCCAGTAAGGG + Intergenic
1026975073 7:74492791-74492813 CAGCCCCCAGGAGCTAGAAGAGG - Intronic
1029086656 7:98017154-98017176 CTGCCTCCAGGAGTGAGGAATGG + Intergenic
1029487722 7:100853403-100853425 TGGCCCCCAGGAGCCGGGAGGGG + Intronic
1030006776 7:105127973-105127995 CCGCCCCAAGGAGCCAATACTGG + Intronic
1031367902 7:120925579-120925601 CCGCCACCAGAAGCCAGAAGAGG + Intergenic
1033282094 7:140013577-140013599 ACTCTCCCAGGAACCAGGAACGG + Intronic
1033866519 7:145697004-145697026 CAGGCTCCAGGAGCCAGCAATGG - Intergenic
1035202719 7:157277390-157277412 CTGCCCCCAGCAGCCCGGCAAGG - Intergenic
1036776014 8:11613613-11613635 CAGACCCCCGGAGCCAGGGAGGG + Intergenic
1038268336 8:26053362-26053384 CCGCCACTAGGAGGCAGTAACGG - Intergenic
1038326596 8:26577234-26577256 CCGCCCCCAGGAGCCGGGCCCGG + Intronic
1041721854 8:60983437-60983459 CCCTCCCCAGCAGCCAGGGAGGG + Intergenic
1044932323 8:97261771-97261793 CCCAGCCCTGGAGCCAGGAAAGG - Intergenic
1045348514 8:101316645-101316667 CAGCCACCAGCAGCCAGGAGAGG + Intergenic
1046652446 8:116852049-116852071 CCGCCTCCAGGAGTCAGTGATGG - Exonic
1047550683 8:125869381-125869403 CTGCCTCCAGGAGCCAGTGATGG + Intergenic
1047763139 8:127968898-127968920 CAGCCACCAGAAGCCAGGAGAGG + Intergenic
1047769541 8:128019773-128019795 GGCCCCCCAGGAGACAGGAATGG + Intergenic
1048263417 8:132964870-132964892 CAGCCTGCAGGGGCCAGGAAAGG + Intronic
1049199673 8:141333962-141333984 CAGCCCTCAGGATCCAGGACAGG + Intergenic
1049400559 8:142424882-142424904 CGGCCCCCAGGAGGCAGCCATGG + Intergenic
1049602535 8:143514581-143514603 TCGCCCCTAGCAGCCAGGACGGG + Intronic
1049777138 8:144411835-144411857 GGGCCACCAGTAGCCAGGAAAGG + Intronic
1051697281 9:19782207-19782229 CGGCCCCCAGCAGCCAGGCTAGG + Intronic
1051972137 9:22901722-22901744 TGGCCCCCATAAGCCAGGAAAGG + Intergenic
1052864304 9:33455795-33455817 CTGGCCCCTGCAGCCAGGAAGGG + Intergenic
1056733565 9:89185619-89185641 CAGCCAGCAGGAGTCAGGAATGG + Intergenic
1056825513 9:89873958-89873980 CTGCCCCGAGGAGTCAGGACGGG - Intergenic
1056950452 9:91036989-91037011 GCGGCCCCGGGAGCCAGCAAAGG + Intergenic
1057075803 9:92137611-92137633 TGGCCCACAGCAGCCAGGAAGGG - Intergenic
1057972412 9:99570630-99570652 GCACCCCCAGGAGTCAGGGAAGG + Intergenic
1060821742 9:126665291-126665313 CCTCCCCCTGGAGCCAGGGCTGG + Intronic
1060895431 9:127213951-127213973 GAGCCTCCAGGAGCCTGGAATGG + Intronic
1061230907 9:129315407-129315429 CCTCCCCCCGGAGCCAGGGTGGG + Intergenic
1061252651 9:129435873-129435895 CCGCCTGCAGGAGACAGGCAGGG - Intergenic
1061453712 9:130682306-130682328 CCGTCCCCAGGAGCCAGGTTTGG - Exonic
1061974886 9:134063045-134063067 CCGGCCCCAGGAGACAGGCCTGG + Intronic
1061994777 9:134177871-134177893 CCCCTCCCAGGACCCAGGACCGG + Intergenic
1062461793 9:136665477-136665499 CGGCCGCCAGGAGCCAGGAGAGG - Intronic
1062599783 9:137314614-137314636 CCGCCCCCAGGGCCCCGGAAGGG + Intronic
1185445203 X:254191-254213 GAGCCCCCAGGAGCCGGGAGAGG - Intergenic
1185530416 X:814114-814136 GAGCCCCCAGGAGCTGGGAAAGG + Intergenic
1185677444 X:1860187-1860209 GAGCCCCCAGGAGCTGGGAAAGG - Intergenic
1185698869 X:2215369-2215391 CAGCCCCCAGGAGCTGGGAGAGG + Intergenic
1185758696 X:2672976-2672998 GAGCCCCCAGGAGCTAGGAGGGG + Intergenic
1185758757 X:2673364-2673386 CAGCCCCCAGGAGCTGGGAGGGG + Intergenic
1185813548 X:3132546-3132568 GAGCCCCCAGGAGCCGGGAGAGG - Intergenic
1185875005 X:3694870-3694892 GAGCCCCCAGGAGCCGGGAGAGG + Intronic
1186130021 X:6456345-6456367 CCACCTCCAGAAGCTAGGAAAGG - Intergenic
1186192855 X:7083045-7083067 GAGCCCCCAGGAGCTGGGAAAGG + Intronic
1186448852 X:9655306-9655328 AAGGCCCCAGGAGCCAGGCAGGG - Intronic
1188817017 X:34728058-34728080 CCGTCCCCAGCAGTCAGGAATGG + Intergenic
1189000750 X:36941943-36941965 CCGTCCCCAGCAGTCAGGAATGG - Intergenic
1192438089 X:71154920-71154942 CCGCCCCCAGGGCCCAGCCATGG + Intronic
1192551367 X:72056858-72056880 CCGGCCTCAAGAGCCAGGGAAGG - Intergenic
1193919405 X:87407008-87407030 CCGAGCCCAGGATCCATGAATGG - Intergenic
1196476602 X:116093423-116093445 CAGCCTCCAGGAGCTAGAAAAGG + Intergenic
1198532541 X:137560417-137560439 ATGGCCCCAGGAGCCAAGAATGG - Intergenic
1199605853 X:149579201-149579223 CCGGTCCCTGGTGCCAGGAAGGG + Intergenic
1199633268 X:149790167-149790189 CCGGTCCCTGGTGCCAGGAAGGG - Intergenic
1199854808 X:151751675-151751697 CATCCTCCAGGAGCAAGGAAGGG - Intergenic
1200184851 X:154175560-154175582 CCGCTCCCAGGAGCCACCTATGG - Intergenic
1200190504 X:154212698-154212720 CCGCTCCCAGGAGCCACCTATGG - Intergenic
1200196255 X:154250500-154250522 CCGCTCCCAGGAGCCACCTATGG - Intergenic
1200201910 X:154287618-154287640 CCGCTCCCAGGAGCCACCTATGG - Intronic
1200759559 Y:7025539-7025561 AAGGCCCCAGGAGCCAGGACGGG - Intronic