ID: 1083332841

View in Genome Browser
Species Human (GRCh38)
Location 11:61906979-61907001
Sequence CCAGGAGCCAGGAAAGGCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 789
Summary {0: 1, 1: 0, 2: 10, 3: 80, 4: 698}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083332831_1083332841 1 Left 1083332831 11:61906955-61906977 CCCATGAGAGTTCTGGGACCGCC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1083332841 11:61906979-61907001 CCAGGAGCCAGGAAAGGCCCAGG 0: 1
1: 0
2: 10
3: 80
4: 698
1083332832_1083332841 0 Left 1083332832 11:61906956-61906978 CCATGAGAGTTCTGGGACCGCCC 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1083332841 11:61906979-61907001 CCAGGAGCCAGGAAAGGCCCAGG 0: 1
1: 0
2: 10
3: 80
4: 698
1083332830_1083332841 4 Left 1083332830 11:61906952-61906974 CCTCCCATGAGAGTTCTGGGACC 0: 1
1: 0
2: 2
3: 11
4: 121
Right 1083332841 11:61906979-61907001 CCAGGAGCCAGGAAAGGCCCAGG 0: 1
1: 0
2: 10
3: 80
4: 698

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083332841 Original CRISPR CCAGGAGCCAGGAAAGGCCC AGG Intronic
900014567 1:139117-139139 CCAGCAGCCTAGACAGGCCCAGG - Intergenic
900044433 1:494319-494341 CCAGCAGCCTAGACAGGCCCAGG - Intergenic
900065839 1:729225-729247 CCAGCAGCCTAGACAGGCCCAGG - Intergenic
900178543 1:1301574-1301596 CCAGGAGCAAAGAAAGGGCCTGG - Intronic
900267390 1:1765011-1765033 CCAGGTGCCAGCACAGGCACAGG - Intronic
900288599 1:1914328-1914350 CCAGAACCCAGGATGGGCCCTGG + Intergenic
900645004 1:3704993-3705015 CCAGGAGCCAGGAGAGGCGAGGG + Intronic
900649364 1:3723475-3723497 CCAGGAGCCAGGCTGTGCCCAGG + Intronic
901007231 1:6178048-6178070 CCAGGAGCCTGGAAAGGCTCTGG + Intronic
901636062 1:10670732-10670754 GCAAGGGCCAGGAAGGGCCCAGG + Intronic
901765002 1:11494407-11494429 CCAGGAGGCTGGAGAGGCACTGG - Intronic
901878654 1:12181325-12181347 CAAGGGGCCTGCAAAGGCCCTGG - Intronic
901907451 1:12426241-12426263 CCAGGCGGGAGGAAAGGCCTGGG - Intronic
902041115 1:13493198-13493220 GCAGGGGCCAGGGAAGACCCAGG + Intronic
902234062 1:15046646-15046668 CCAGGCCCCAGGACAGGCCGGGG + Intronic
902386488 1:16078879-16078901 CCATGGGCCAGGACAGGGCCGGG - Intergenic
903176840 1:21586523-21586545 TGAGAAGCCAGAAAAGGCCCTGG - Intergenic
903263621 1:22143670-22143692 CCAGGAGGCAGGGAGGGGCCGGG - Intronic
903276961 1:22228488-22228510 CCAGGGGCCAGGGCTGGCCCTGG + Intergenic
903326369 1:22571043-22571065 CCCGGAGCCAGCCAGGGCCCAGG - Intronic
903360533 1:22774198-22774220 CCAGGAGCCAGGAAACCCAGAGG - Intronic
903614390 1:24641697-24641719 GCGGGAGCCAGGGAAGACCCTGG + Intronic
903644609 1:24887045-24887067 CCAGGAGCCAGGAGAGCGCCTGG - Intergenic
904094410 1:27966180-27966202 CCAGGATGCAGCCAAGGCCCAGG + Intronic
904464465 1:30699699-30699721 TCAGGAGTCAGGAAATCCCCAGG - Intergenic
904577165 1:31512413-31512435 CCGGAAGCCAGAAAAGGCCTGGG - Intergenic
904894290 1:33802521-33802543 CAAGGAGCTAGGAATGTCCCAGG - Intronic
904944564 1:34189804-34189826 CCAGGAGCCAGCCAAGAGCCAGG - Intronic
905312853 1:37062488-37062510 CCAGGAGCTAGGACAGGCATGGG + Intergenic
905885724 1:41490877-41490899 CCAGGAGGCAGGCAAAGCCAGGG + Intergenic
906033377 1:42736795-42736817 CCAGGACCCAGCACAGGGCCTGG + Intronic
906147265 1:43567477-43567499 CCAGGTCCCAGGAAAGGCTGGGG + Intronic
906190689 1:43897892-43897914 CCAGCTTCCAGGGAAGGCCCTGG + Intronic
906607458 1:47181933-47181955 CCAGGAGACAGGAAAGGAAGAGG + Intergenic
906946879 1:50301924-50301946 CCAGGAGCCAGGCATGACCCCGG + Intergenic
907153073 1:52306806-52306828 CCAGGTGCCTGCACAGGCCCTGG - Intronic
907901524 1:58745931-58745953 AGAGGAGCCAGGAAAAGCCCAGG - Intergenic
907916967 1:58879984-58880006 CCTGGAGCCAGAAAAGCCCAAGG + Intergenic
907964449 1:59315588-59315610 CCAGGAGCTAGATAAGGGCCTGG + Intronic
907984881 1:59520927-59520949 GCAGGAGCCAGGCCAGGCGCTGG + Intronic
908887075 1:68801692-68801714 TCAAGACCCAGGAAAGGCCTGGG - Intergenic
910519051 1:88097013-88097035 CCAGGAGCCAGGAAAGGAGAGGG - Intergenic
912093686 1:106113866-106113888 CCTGGAGCCAGGGGAGGCCAGGG - Intergenic
912094383 1:106120841-106120863 CCAGGAGCATGGAGAGGCCAAGG - Intergenic
912252913 1:108029783-108029805 GCAGGAGGCAGGAATGTCCCAGG + Intergenic
912657535 1:111500495-111500517 ACACCAGCCAGCAAAGGCCCAGG + Intronic
913219133 1:116645345-116645367 CCTGGAGGCAGGAAAGGGGCTGG + Intronic
913997271 1:143661706-143661728 CCAGCATCCTGGAAACGCCCGGG - Intergenic
914393543 1:147242943-147242965 GCAGGAGCGAAGGAAGGCCCTGG - Intronic
914764100 1:150622770-150622792 GCAGGAGCCAGCACAGGACCCGG + Exonic
914846168 1:151284552-151284574 CCAGGTGCCAGTGATGGCCCAGG + Intronic
914865465 1:151424238-151424260 CCAGAAGAAAGGAAAGTCCCTGG - Exonic
914899287 1:151703351-151703373 CCAGAACCCAGTCAAGGCCCAGG + Exonic
914984095 1:152441697-152441719 ACAAGAGCCAGGACAGGCACTGG + Intergenic
915135524 1:153728604-153728626 CCAGGAGCCGGGAAAAGGTCAGG - Exonic
915274117 1:154776274-154776296 CCAGGAGGCAGGCAGGGCCAAGG - Intronic
915471055 1:156126131-156126153 CTGGGAGACAGGAAATGCCCAGG + Intronic
915603282 1:156935858-156935880 CTAGGATCCAGCCAAGGCCCGGG - Exonic
915828685 1:159105198-159105220 CCAGGCGCCAGCATAGGCACTGG + Intronic
915977651 1:160401142-160401164 CCCGGGCCCAGGAAAGTCCCCGG - Intronic
917186646 1:172363944-172363966 TCAGGAGCCAGGCAAGGCTATGG - Intronic
917190948 1:172418056-172418078 CTAGTAGCCAGGAAAAGTCCTGG + Intronic
917423757 1:174892114-174892136 GCAGGAGCCAGGGAAGCCACGGG - Intronic
917707474 1:177648951-177648973 CCAGGGGCCTGGCAAAGCCCTGG - Intergenic
917843670 1:179002893-179002915 CGGGGAGAGAGGAAAGGCCCCGG + Intergenic
918244115 1:182643935-182643957 CCTGGAGCCTGCATAGGCCCAGG + Intergenic
918729697 1:187976115-187976137 CCAGAAGCCAGTTTAGGCCCTGG - Intergenic
919249233 1:195030907-195030929 CCAGGAGCAAGGAGAGGCCAGGG + Intergenic
919632715 1:199974569-199974591 CCAGGAGTCAGGAAGGGGACAGG + Intergenic
919800621 1:201352367-201352389 CCAGGTCCCAGGAAGTGCCCAGG + Intergenic
919850171 1:201667198-201667220 CCAGGAGTCAGGGGAGCCCCAGG - Intronic
919986760 1:202681095-202681117 CCAGGAGCCAGGGTGGGACCAGG - Intronic
920692234 1:208155670-208155692 CCAGGAGTCAGGTAGGCCCCAGG - Intronic
920740295 1:208575502-208575524 CCAGGAGCCAGGAGAGAGCCTGG - Intergenic
920959055 1:210648056-210648078 CCAGCACCCAGGAAAGGGCCAGG - Intronic
922100963 1:222476574-222476596 CCAGCAGCCTAGACAGGCCCAGG - Intergenic
922220434 1:223554051-223554073 CCAAGAGACAGCAAAGGTCCTGG + Intronic
922504041 1:226116156-226116178 AGAGGAGACAGGAAAGGGCCTGG - Intergenic
922695296 1:227728382-227728404 CCTGAAGCCAGGGAAGCCCCAGG + Intergenic
922721586 1:227902723-227902745 CCAGGGGCCAGGCAGGGCTCGGG + Intergenic
922733653 1:227968098-227968120 CCAGCAGCCTAGACAGGCCCAGG + Intergenic
922799284 1:228357412-228357434 CCAGGAGGCAGGAAAGACTGTGG + Intronic
922950959 1:229558382-229558404 CCAGGAGCCGCGCGAGGCCCAGG + Exonic
923455290 1:234160292-234160314 CCAGGAGCCATGAAGGACTCAGG + Intronic
923512047 1:234661280-234661302 CCAGGAACCAGGACAGACCCCGG - Intergenic
923918049 1:238530558-238530580 CCAGGAGCAGGGAGAGGCCAGGG + Intergenic
923964254 1:239119190-239119212 CAAGGAACCAGGATGGGCCCAGG - Intergenic
924343889 1:243056691-243056713 CCAGCAGCCTAGACAGGCCCAGG - Intergenic
924422264 1:243920657-243920679 CCAGGATCCAAGAAAGGTCTAGG - Intergenic
1062840382 10:666029-666051 GCAGCACCCTGGAAAGGCCCAGG + Intronic
1062942462 10:1434535-1434557 TCAAGGCCCAGGAAAGGCCCGGG - Intronic
1063104895 10:2984594-2984616 CCAGCAGCCTGCAAAGCCCCTGG + Intergenic
1063568812 10:7195776-7195798 CCAGGTTCCAGGACAGGACCTGG - Intronic
1064196386 10:13247218-13247240 CCAGGCGCCAGCTCAGGCCCGGG - Intergenic
1064346851 10:14540466-14540488 CCCAGACCCAGGAGAGGCCCAGG - Intronic
1065529342 10:26653091-26653113 CCAGGAGCCAGGAGCACCCCCGG + Intergenic
1066370292 10:34814476-34814498 CTGGGAGCCGGGAAAGGCCTGGG + Intronic
1066732442 10:38448372-38448394 CCAGCAGCCTAGACAGGCCCAGG + Intergenic
1067188045 10:44046717-44046739 GCAGGAGCCAGAAAGGCCCCCGG + Intergenic
1067280141 10:44864990-44865012 CCAGGGGGCAGCAGAGGCCCGGG - Intergenic
1067672292 10:48334070-48334092 TCAGCAGCCAGGAAAGGTGCAGG - Intronic
1067749259 10:48959299-48959321 CCAGGAGCTAGGCTAGGCCCTGG - Intronic
1067782558 10:49219484-49219506 ACAGGAGCCAGGACAGGCTGTGG - Intergenic
1068416777 10:56733803-56733825 CCATGAGCCTGGAAAAGCCATGG - Intergenic
1068550627 10:58404071-58404093 CAATGAGACAGGAAAGCCCCAGG + Intergenic
1068919395 10:62466320-62466342 CCAGGTGCCAGCACAGGCACTGG - Intronic
1069438407 10:68406905-68406927 CCAGGAGCGAGGACAGGGCCAGG - Exonic
1069563255 10:69446240-69446262 GCAGGGGACAGGAAAGGCCTTGG - Intergenic
1070428703 10:76315438-76315460 CCGGGAGCAGGGAGAGGCCCGGG - Intronic
1070602196 10:77873663-77873685 CCTGGAGCTTGTAAAGGCCCTGG + Intronic
1070803874 10:79259165-79259187 CCAGGAGCCGGGCAGGGCCTTGG - Intronic
1071264903 10:83956493-83956515 CTGGGAGCCAGAAAAGGCCTGGG + Intergenic
1071312742 10:84358983-84359005 CCAGGAGACAGTAAATGCCTAGG - Intronic
1071526909 10:86364485-86364507 CCAGGAGCCAGGAAGTTCCCCGG + Intronic
1071569662 10:86690070-86690092 CTTGGAGCCAAGAAAGGCACAGG + Intronic
1072193732 10:93097166-93097188 CCAGGACACAGGCAAGTCCCTGG + Intergenic
1072685357 10:97533407-97533429 CCAGGAGAAAGCAAAGCCCCGGG - Intronic
1072902265 10:99419028-99419050 CCAGGAAGCAGGGAAGGCCCTGG - Intronic
1073084333 10:100878780-100878802 CCAGCTGCCAGGAAAGGCACAGG + Intergenic
1073484523 10:103808211-103808233 CCGGGAAGCAGTAAAGGCCCTGG + Intronic
1073497939 10:103911325-103911347 GCAGGAGCCAGGACAGCCCTGGG - Intronic
1074079143 10:110153594-110153616 CCAGGAGGCAGATAAGGCCAGGG - Intergenic
1074301695 10:112239606-112239628 CCAGGAGCCAGCACAGGCACTGG + Intergenic
1074893227 10:117752409-117752431 GCAGGACCCAGGACAGTCCCCGG - Intergenic
1075409439 10:122216526-122216548 CCATTAGCCAGGACAGGTCCCGG - Intronic
1075788011 10:125063053-125063075 CCAGCAGCGAGGCAGGGCCCTGG + Intronic
1076290844 10:129344279-129344301 CCAGAAGTCGGGAAAGGCCGGGG + Intergenic
1076411151 10:130251963-130251985 CTACAAGCCAGCAAAGGCCCAGG - Intergenic
1076568126 10:131412690-131412712 CCAGAAGCCAGGAGAGGGCCTGG + Intergenic
1076685205 10:132195568-132195590 CCAGGAGCCTGTCAAGGCCCTGG + Intronic
1076728874 10:132428571-132428593 ACAGGAGCCAGGCCAGGTCCCGG - Intergenic
1076970763 11:130794-130816 CCAGCAGCCTAGACAGGCCCAGG - Intergenic
1076980913 11:204277-204299 CCAGTGGACAGGGAAGGCCCAGG + Exonic
1077147998 11:1054415-1054437 CCAAGAGCCAGGAGACGGCCAGG - Intergenic
1077200415 11:1304178-1304200 CCAGGAGCCAGGAGAGGGCGGGG + Intronic
1077496160 11:2887300-2887322 TCAAGAGCCAAGAATGGCCCTGG - Intergenic
1077505494 11:2928213-2928235 CCAGAGGCCAGGAAGTGCCCTGG - Intergenic
1077844793 11:6013022-6013044 CCAAGAGCGCAGAAAGGCCCGGG + Intergenic
1078139562 11:8682486-8682508 CAAGGCGCCAGAAAAGGGCCTGG + Exonic
1079101000 11:17542433-17542455 CCATGCGCTAGGCAAGGCCCAGG - Intronic
1079134349 11:17768022-17768044 CCAGGAGCCTGGTAACTCCCAGG - Intronic
1079594457 11:22224986-22225008 CCAGAAGCCAGGAAAGGGAAGGG + Intronic
1081582855 11:44364589-44364611 CCAGCACCCAGGATAGGGCCTGG - Intergenic
1081627684 11:44665336-44665358 CCAGGATCCAGAACAGTCCCTGG + Intergenic
1081676031 11:44969918-44969940 CCAGGTGCCAGGATAGGACTTGG + Intergenic
1082261039 11:50076457-50076479 CCAGCAGCCTGGACAGGCCCAGG - Intergenic
1083170274 11:60920126-60920148 GCAGGAGCCAGGAAAGGATAGGG - Intronic
1083261056 11:61523384-61523406 CCAGAGGCAAGGAAAGACCCAGG + Intronic
1083261332 11:61524587-61524609 CCGGGAGGCAAGGAAGGCCCTGG + Intronic
1083319023 11:61834061-61834083 CAATGACCCAGGGAAGGCCCAGG + Intronic
1083332841 11:61906979-61907001 CCAGGAGCCAGGAAAGGCCCAGG + Intronic
1083544338 11:63537820-63537842 CCAGGACCCAGTGAAGGGCCTGG - Intronic
1083962568 11:66022520-66022542 CCGGGAGCCCGAGAAGGCCCTGG - Intronic
1084023175 11:66430502-66430524 CCAGGACCCAGCAAAGCCCTTGG - Intergenic
1084376043 11:68778307-68778329 CCAGGAGCCAGGGGAAGCCAGGG + Intronic
1084490843 11:69477404-69477426 CCAGGACCCAGCGAAGCCCCAGG - Intergenic
1084568181 11:69943519-69943541 CCAGGAGGCAGGAGGGACCCTGG - Intergenic
1084582381 11:70032101-70032123 GGAGGAGGCAGGAAAGGACCTGG + Intergenic
1084946099 11:72639416-72639438 ACATGAGCCAGGAAGGGCGCTGG + Intronic
1084961839 11:72720981-72721003 TCAGGAGCCAGCACAGGGCCAGG - Intronic
1085044059 11:73343256-73343278 CGAGGAGCCTGGGGAGGCCCAGG + Intronic
1085393711 11:76195483-76195505 CCAGGAGCTAGGGACGGGCCAGG + Intronic
1085467624 11:76734943-76734965 CCAGGTGGCAGGACAGGCTCAGG - Intergenic
1085497000 11:76978893-76978915 CCAGAAGCCAGCATAGGCACTGG - Intronic
1085689556 11:78654185-78654207 CCAGGAGCCAGACCTGGCCCGGG - Exonic
1085769230 11:79310122-79310144 CCAGGGCCCAGCACAGGCCCCGG + Intronic
1086564247 11:88207068-88207090 CCAGGAGACAGCAAATGACCTGG - Intergenic
1087407948 11:97752775-97752797 CCAGGAGCAGGGAGAGGCCAGGG + Intergenic
1089135716 11:116247417-116247439 CCTGGAGACAGAAGAGGCCCTGG + Intergenic
1089276322 11:117338426-117338448 CCTGGCGCCTGGGAAGGCCCTGG + Intronic
1089494116 11:118899898-118899920 CCAGGTGCGAGGACAGGCCAGGG - Exonic
1089497702 11:118916112-118916134 CCAGTAGCAAGGCATGGCCCAGG + Intronic
1089580963 11:119481829-119481851 CCAGGGCCCAGGAAAGACTCGGG - Intergenic
1089591213 11:119541880-119541902 CCAGGACCCAGGATAGGGCCTGG + Intergenic
1090194513 11:124803025-124803047 CCAGGAGCCAGCATGGGCACTGG + Intergenic
1090250485 11:125247456-125247478 CCTAGAGCCAGCACAGGCCCTGG + Intronic
1090403079 11:126461297-126461319 CCAGGACCCAGGCCAGGGCCAGG + Intronic
1090557162 11:127888560-127888582 TCAAGACCCAGGAAAGGCCTGGG + Intergenic
1091043381 11:132303325-132303347 CCAGAAGCCAGGAGAGGCGAGGG - Intronic
1091187073 11:133656571-133656593 CCAGGAGCCAGCACAGTCCTTGG + Intergenic
1091315410 11:134610785-134610807 CCAGGAGACAGGCAAAGCCATGG + Intergenic
1091331883 11:134736972-134736994 ACAGGAGCCAGGCAGAGCCCAGG - Intergenic
1091459040 12:630164-630186 CCAGGAGACCAGAAATGCCCTGG + Intronic
1091638948 12:2219797-2219819 CCAGGTATCAGGAGAGGCCCTGG + Intronic
1091805618 12:3353915-3353937 GCAGGGGCAAGCAAAGGCCCAGG + Intergenic
1091921124 12:4305761-4305783 GCAGGAGCCAGGAAAGCTGCAGG - Intergenic
1092785525 12:12023043-12023065 CCAGGAACTAGGAAAGGAACTGG + Intergenic
1093030048 12:14280092-14280114 CCATGAGTCAGGAAGGGACCTGG - Intergenic
1094642769 12:32292188-32292210 CCAGAAGCCAGGAAGGGGCAAGG - Intronic
1096396354 12:51269709-51269731 CCAGGTGTCAGGAGAGGGCCGGG + Intronic
1096531372 12:52244680-52244702 CCAGGAGCCTGAATAGTCCCAGG - Intronic
1096952015 12:55483436-55483458 TCAGGAACCAGAAAAGGCCCTGG - Intergenic
1097450793 12:59734389-59734411 CCAGGAGTGGGGAAAGGCCAGGG + Intronic
1098447040 12:70576571-70576593 CCAGCAGCCAGGAAACGCTGAGG + Exonic
1099738677 12:86602051-86602073 CCAGGTGCCAGCACAGGCTCCGG - Intronic
1100110007 12:91229380-91229402 CCAAGAGCCATGAAATACCCAGG + Intergenic
1100891496 12:99131178-99131200 CCAGGGGCCAGGACAGTCCCTGG + Intronic
1101060365 12:100964991-100965013 CCAGCACCTAGGACAGGCCCTGG + Intronic
1102246986 12:111362188-111362210 CCCGGAGCAAGGCCAGGCCCAGG + Exonic
1102326702 12:111991829-111991851 CCGTGAGCCAGCAAAGTCCCAGG + Exonic
1103029769 12:117603561-117603583 CCAAGGGCCAGGAAGGACCCAGG + Intronic
1103034745 12:117647440-117647462 CCAGGAGCCAGCACGGGCCCAGG + Intronic
1103370266 12:120414075-120414097 CCCGGCGCCAGGCGAGGCCCTGG + Intergenic
1103901424 12:124305577-124305599 CTAGGAGCCAGAACAGGCACAGG - Intronic
1104794174 12:131505664-131505686 ACAGAAGCCAGGCGAGGCCCAGG + Intergenic
1105002934 12:132702833-132702855 CCAGGAGGGAGGAAAGGACCAGG + Intronic
1105573052 13:21622358-21622380 CCATGAACGAGGAAGGGCCCAGG + Intergenic
1105705652 13:22966111-22966133 CCAGGGGCCAGGAGGGGCCACGG + Intergenic
1105858555 13:24391096-24391118 CCAGGGGCCAGGAGGGGCCACGG + Intergenic
1106136032 13:26974432-26974454 CAAGGAAGCAGGAAAGACCCAGG + Intergenic
1106379659 13:29223942-29223964 CCAGGTGCCAGCACAGGCGCTGG - Intronic
1106999645 13:35527664-35527686 CTGGGAGCCAGGAGAGGCCAGGG + Intronic
1108115115 13:47118983-47119005 CCAGAAGCTAGGAGAGGCCATGG + Intergenic
1108678599 13:52760126-52760148 ACAGGACCCCAGAAAGGCCCAGG - Intergenic
1109345800 13:61113503-61113525 CCAGGAGCTGGGAGAGGCCAGGG - Intergenic
1109396603 13:61766667-61766689 CCAGGAGCCAGGAGAAGGCAGGG + Intergenic
1109512451 13:63396909-63396931 CCAGGTGCCAGTACAGACCCCGG - Intergenic
1109770913 13:66971549-66971571 CCAGGAGGCAGTAATGGCCTTGG - Intronic
1109988043 13:70016457-70016479 CCAGGAGCAGGGAGAGGCCAGGG - Intronic
1110373020 13:74760381-74760403 CCAGGAGACAGAAAAGCCACAGG - Intergenic
1110519325 13:76456712-76456734 CCAGAACCCAGGAAAGGCTAAGG + Intergenic
1110794677 13:79622757-79622779 CAAGGTGACAGGAAAGGCCCTGG + Intergenic
1112339698 13:98543048-98543070 ACAGGTGCCAGCAAAGGCCAAGG + Intronic
1112484940 13:99811413-99811435 CCAGGAGCCAGGGAAGGATGGGG + Intronic
1112559257 13:100497541-100497563 ACAGGAGCCTGGAAAAGTCCTGG - Intronic
1113469402 13:110533849-110533871 CCTGGAGCCAGCACAGGGCCTGG + Intronic
1113540554 13:111104715-111104737 CCACCAACCAGGAAAAGCCCAGG + Intergenic
1114344455 14:21780812-21780834 CCAGGAGTGAGGAGAGGCCAGGG - Intergenic
1114344634 14:21781765-21781787 CCAGGTGCCAGCACAGGCCCTGG - Intergenic
1115119919 14:29927388-29927410 ACAGGAGCCAAGAACGGCGCGGG + Exonic
1116961569 14:50973125-50973147 CCAGGAGCAGGGAGAGGCCAAGG - Intergenic
1118256298 14:64208885-64208907 CCAGGAGCCTGGACAGACGCTGG + Exonic
1119113346 14:71995916-71995938 TCGGCAGCCAGGAGAGGCCCAGG - Intronic
1120481667 14:85056456-85056478 CCAGAAACTAGGAAAGGGCCAGG + Intergenic
1121032954 14:90675005-90675027 CCAGGAGCAGGCACAGGCCCCGG + Intronic
1121050315 14:90815947-90815969 CCAGGCGCCGGGACAGCCCCTGG + Intronic
1121127711 14:91418303-91418325 CCAGGAGTGCGGAAAGGCGCAGG - Intergenic
1121242566 14:92440887-92440909 CCAGGCGGAAGGAATGGCCCAGG + Intronic
1122286362 14:100655029-100655051 CCAGGAGGGAGGTCAGGCCCTGG - Intergenic
1122594985 14:102884188-102884210 CCATGAGCCAAGGAAGGCCAAGG - Intronic
1123049148 14:105532269-105532291 CCAGGTGCCAGGCATGGGCCTGG - Intergenic
1123073304 14:105652578-105652600 CCAGGAGCTGGTGAAGGCCCAGG - Intergenic
1123137089 14:106038061-106038083 TCAGCCCCCAGGAAAGGCCCTGG - Intergenic
1123152527 14:106196858-106196880 CCAGGCTCCAGGAAAGGGGCTGG - Intergenic
1124055968 15:26241290-26241312 CCAGAAGCCAGGCAGAGCCCTGG + Intergenic
1124504828 15:30263695-30263717 GCAGCAGCCAGGACTGGCCCTGG - Intergenic
1124738724 15:32274940-32274962 GCAGCAGCCAGGACTGGCCCTGG + Intergenic
1124957147 15:34367080-34367102 CCATGAGCCAGGGAAGTCCGGGG - Exonic
1125673887 15:41492623-41492645 CCAGGGCTCAGGAATGGCCCAGG - Intergenic
1126087283 15:45022385-45022407 CCAGCCCCCAGGAAAGGGCCTGG - Intergenic
1126111067 15:45175117-45175139 CCAGGAACCCAGAGAGGCCCAGG - Intronic
1126230860 15:46322610-46322632 CCAGGTGCCAGGCAAGAGCCAGG - Intergenic
1127261739 15:57331588-57331610 CCAGCACCCAGAAGAGGCCCAGG + Intergenic
1127764599 15:62172795-62172817 CTGTGAGCCAGGAAACGCCCAGG - Intergenic
1127960159 15:63884856-63884878 CCTGAGGCCAGGAAAGGCCAGGG + Intergenic
1128155037 15:65386588-65386610 CCAGGAGGCAGAGGAGGCCCAGG + Exonic
1128454089 15:67823110-67823132 CCAGGAGGGAGGAAAGGCCCTGG - Intronic
1128497846 15:68208403-68208425 CCAGGTACCTGGAAAGGCCAGGG + Exonic
1128524452 15:68402971-68402993 CCTGGAGCCAGGGATGACCCGGG + Exonic
1128571873 15:68739556-68739578 CCAGGAGGCAAGACAGTCCCTGG - Intergenic
1129236837 15:74228785-74228807 CCAGGAGACAGGCAGGGGCCGGG + Intergenic
1129517170 15:76163742-76163764 CCTGGGGTCTGGAAAGGCCCAGG + Intronic
1129713933 15:77836171-77836193 CCAGGGCCCAGGACAGTCCCAGG + Intergenic
1130048530 15:80464556-80464578 CCAGAAGCCATCCAAGGCCCAGG - Intronic
1130054601 15:80511732-80511754 CCCTGAGGCAGGAAAGCCCCAGG - Intronic
1130660859 15:85830657-85830679 CTAGGAGGCAGGAAAGCACCAGG + Intergenic
1130981642 15:88815978-88816000 CCAGAAGCCAGGAAGGGGCAAGG - Intronic
1132092231 15:98956098-98956120 CCCTGACCCAGGAAAGGCCCGGG - Intronic
1132346701 15:101113011-101113033 CCAGCTGCCAGAAAAGGCCACGG + Intergenic
1132356617 15:101175530-101175552 CCAGGAGCCAGACGCGGCCCAGG + Intergenic
1132585605 16:704790-704812 CCTGGAGCCTGGGAAGGGCCTGG + Intronic
1132715584 16:1288570-1288592 CCAGGATTCAGGGAAAGCCCCGG - Intergenic
1132863788 16:2083981-2084003 CCAGCAGCCAGGGCCGGCCCAGG - Intronic
1132933665 16:2470919-2470941 CCATCAGGCAGGCAAGGCCCCGG - Intergenic
1133213188 16:4274076-4274098 CCAGGAGCCAGGGGAGGGCCTGG - Intergenic
1133625784 16:7569343-7569365 TCAGGGGCCAGGAAAGGCATGGG - Intronic
1133740424 16:8647056-8647078 AAAGGGGCCATGAAAGGCCCTGG - Exonic
1134133948 16:11667894-11667916 CCACGAGCCAGACAAGGTCCCGG - Intergenic
1134487133 16:14667547-14667569 CCAGCACCCAGAAAAGGCCCAGG + Intronic
1134537819 16:15040779-15040801 CCAGGAGCTGGGAAAGTGCCTGG - Intronic
1135471848 16:22738092-22738114 GCAGGAGCTTGGAAAGGCCCTGG - Intergenic
1135758793 16:25119701-25119723 TCAGGATGCCGGAAAGGCCCTGG - Intronic
1135829292 16:25759475-25759497 ACAGGTGCCAGGAAAGGCGAGGG + Intronic
1135960145 16:26988330-26988352 CCAGGTGCCAGGATAGACACCGG - Intergenic
1136029168 16:27490203-27490225 CCTGGAGCCAGGTGGGGCCCAGG - Intronic
1136402557 16:30026522-30026544 GCAGGAGCCTGGGAAGCCCCGGG - Intronic
1136497255 16:30651852-30651874 CCAGGAGCCCGAAACGGCCGAGG + Exonic
1137857817 16:51813785-51813807 CCAGGTGGCAGGATGGGCCCAGG + Intergenic
1137898310 16:52237825-52237847 CCTGGACCCTGGAAATGCCCAGG - Intergenic
1137911950 16:52386368-52386390 TCAGTAGCCAGGAAAGTCCCAGG - Intergenic
1138101147 16:54253269-54253291 CCAGGGGCTAGGAAAGGGCAGGG - Intronic
1138122499 16:54411806-54411828 CCTGGAGCCAGGATAGGCTAAGG - Intergenic
1138199496 16:55078414-55078436 CAAGGAGTCAAGAAAGGCCATGG + Intergenic
1138414446 16:56863407-56863429 TCAGGAGCCAGGAAAGGCGCTGG + Intergenic
1138474253 16:57261394-57261416 CCATGAGCCAGGAAGGACACAGG - Intronic
1139015580 16:62684941-62684963 CCAGGAGCCAGCACAGGCACCGG - Intergenic
1141109812 16:81262975-81262997 CTAGAAGCCAGGAAGGGGCCAGG - Intronic
1141177731 16:81731767-81731789 TCAAGGCCCAGGAAAGGCCCAGG + Intergenic
1141466230 16:84207466-84207488 TCAAGGCCCAGGAAAGGCCCAGG - Intergenic
1141482993 16:84319272-84319294 CCAGGTTCCAGGCTAGGCCCTGG - Intronic
1141890732 16:86924895-86924917 CCAGGACCCAGGAAAGGCTGGGG + Intergenic
1142151301 16:88513616-88513638 CCAGGAGGCAGGTGAGGGCCAGG + Intronic
1142200299 16:88757881-88757903 CCAGGAGGCAGGAAGGGTCTGGG + Intronic
1142263597 16:89053657-89053679 CGAGGAGCCAGGAAGAGCCAAGG + Intergenic
1142361795 16:89630892-89630914 GCAGGGGCCAGGAAAGGGCAAGG - Intronic
1142449487 16:90166692-90166714 CCAGCAGCCTAGACAGGCCCAGG + Intergenic
1142457605 17:65157-65179 CCAGCAGCCTAGACAGGCCCAGG - Intergenic
1142711913 17:1728069-1728091 ACAGGAGCCAGGCCCGGCCCCGG - Exonic
1142792566 17:2279254-2279276 CCAGGAGCCAGAAAAGAGCTTGG + Intronic
1143140802 17:4740794-4740816 CCAGGAGCCAGGCAGTCCCCAGG - Exonic
1143290770 17:5826229-5826251 CAAGCACCCAGGAAAGGCCTAGG - Intronic
1143768872 17:9155199-9155221 CCCTGAGCCAGGAAGGACCCTGG + Intronic
1143893586 17:10120229-10120251 CCAGGAGCCAGGCCAGCCACCGG + Intronic
1144742761 17:17593191-17593213 CGAGGAGACAGGAAAGACACTGG + Intergenic
1145064213 17:19751047-19751069 CCAGGAGCCAGGCCAGGCAGGGG - Intergenic
1145901674 17:28494095-28494117 CCAGGACCCAGGTAAGCACCTGG + Exonic
1145958622 17:28872429-28872451 CCAGGAGACTGGAAAGGTCATGG - Intergenic
1146381095 17:32328106-32328128 CCAGGTGCCAGGAAAGCCTGCGG - Intronic
1146638736 17:34524813-34524835 CCAGGACCCAGAAATGGCCAAGG + Intergenic
1146714673 17:35075205-35075227 CAAGGAGGAAAGAAAGGCCCAGG + Intronic
1147596827 17:41723185-41723207 CCAGGGGGCAGGAGAAGCCCGGG - Exonic
1147961156 17:44168430-44168452 CCAGGAGGCAGGACAGGCAGCGG + Intergenic
1147992514 17:44343793-44343815 CCAGGAGAGAGGAGAGGCCCAGG - Intergenic
1148166763 17:45489597-45489619 CCAGATGCCAGGAAAAACCCCGG + Intronic
1148332390 17:46820266-46820288 GCAGGAGCCATGACAAGCCCAGG - Intronic
1148367720 17:47069179-47069201 CCAGATGCCAGGAAAAACCCCGG - Intergenic
1149483166 17:57019637-57019659 CCATGTGCCTGGAAAAGCCCAGG - Intergenic
1149591390 17:57832184-57832206 CAAGGAGGCAGAAAAGGGCCGGG + Intergenic
1149684414 17:58527197-58527219 CCAGGGTCCAGGAAGAGCCCTGG + Intronic
1149909390 17:60553103-60553125 CCAAGAGCCAGGCATGGCCAGGG + Intergenic
1150165009 17:62933037-62933059 CCAGAAGCCAGGAAAAGGCAAGG + Intergenic
1150296064 17:64008148-64008170 CCTGGACCCAGGGAAGTCCCTGG + Intronic
1150397939 17:64836000-64836022 CCAGATGCCAGGAAAAACCCCGG + Intergenic
1150627346 17:66849865-66849887 CCAGGAGCTTGGAAAGGCAACGG - Intronic
1150699871 17:67437396-67437418 CCACGAGCCAGGGAACGCCTGGG + Intronic
1151340139 17:73465848-73465870 CCAGGAGACAGGAACAGCCAAGG + Intronic
1151360750 17:73587313-73587335 CCAGGAGCCTGGACGGGCCAGGG + Intronic
1151366125 17:73617444-73617466 CCAGGAGCCAGAAGGGCCCCTGG - Intronic
1151651528 17:75473141-75473163 CCTGGTGCCAGCAGAGGCCCAGG - Intronic
1151965324 17:77428175-77428197 CCAAGGCCCTGGAAAGGCCCTGG - Intronic
1151973084 17:77469079-77469101 CCAGGACCCAGCAGAGGGCCTGG + Intronic
1152027900 17:77823575-77823597 CCCGGAGCCAGGAAAGGGCATGG + Intergenic
1152391529 17:80006574-80006596 ACAGGAGCAAGGAAAGACCAGGG + Intronic
1152490622 17:80630839-80630861 CCAGGAGACAGGCAAAGCCAGGG - Intronic
1152530277 17:80914555-80914577 CCAGGAGCAGGGAGAGGCCAGGG - Intronic
1152580976 17:81165548-81165570 CCCGGACCCAGGAGAGGCCATGG + Intronic
1152640447 17:81447204-81447226 CCAGGAGCCTGGAGGAGCCCGGG + Exonic
1152666256 17:81571434-81571456 CCAGGAGCCACAAAGGCCCCTGG - Intronic
1152854872 17:82658999-82659021 CCACAAGCCAGGGAGGGCCCAGG + Intronic
1152867348 17:82732187-82732209 CCAGGAGCCATGGAGGGGCCAGG + Intergenic
1152896586 17:82914711-82914733 CCTGGGGCCAGCAAAGGCCATGG - Intronic
1153608079 18:6854857-6854879 CCAGGAGCGGGGAGAGGCCAGGG - Intronic
1154029698 18:10742527-10742549 CCAGGAGCCAGGGGAAGGCCAGG - Exonic
1154183355 18:12157369-12157391 CCAGGGGCGAGGATAGGGCCTGG - Intergenic
1154353266 18:13604956-13604978 CCAGATGCCAGGAAGGGTCCTGG - Intronic
1155496453 18:26447498-26447520 AAAGGAGAAAGGAAAGGCCCAGG + Intergenic
1155526762 18:26723784-26723806 CCATTAGAGAGGAAAGGCCCGGG - Intergenic
1155527180 18:26729251-26729273 GCTGGAGACAGGAAAGGCACTGG + Intergenic
1156244330 18:35283622-35283644 CCAGGTGCCAGTACGGGCCCTGG + Intronic
1156456077 18:37295157-37295179 CCAGCATCCAGGAGAGGCCCAGG - Intronic
1156561475 18:38130362-38130384 CCAGGAGGCAAGCAGGGCCCAGG - Intergenic
1156776184 18:40792170-40792192 CCCGGACCCACGACAGGCCCAGG + Intergenic
1157440429 18:47707484-47707506 ACAAAAGCCAGGAAAGCCCCTGG + Intergenic
1157602302 18:48901775-48901797 CCTGGAGCCTGGGAAGGGCCGGG + Intergenic
1157618029 18:48998857-48998879 CCAGCACCCTGGAAGGGCCCTGG - Intergenic
1157806132 18:50658858-50658880 GGAGGAGCCAGAAAAGGGCCGGG + Intronic
1157889806 18:51404817-51404839 CCAGGGCCTAGGACAGGCCCTGG + Intergenic
1158077261 18:53545137-53545159 CCAGGAGCCAGAAAAGGCAAGGG + Intergenic
1158406501 18:57164652-57164674 CAAGGAGTGAGGAAAGCCCCGGG + Intergenic
1158540883 18:58353212-58353234 TCAGGAGTAAGGAAAAGCCCAGG - Intronic
1159092036 18:63860613-63860635 CCTGAAGCCAGCACAGGCCCAGG + Intergenic
1159348361 18:67236806-67236828 CCAATAGCCAGGAGAGGCCCAGG + Intergenic
1159900216 18:74038452-74038474 GCAGGTGCCAGGAAACACCCAGG + Intergenic
1160240621 18:77119900-77119922 CCAGGAGACAGAGAGGGCCCTGG + Intronic
1160328004 18:77968281-77968303 CCAGGAGCCAAGGAATGCCAGGG + Intergenic
1160480882 18:79238663-79238685 CCAGGGCCCAGGACAGGCCGGGG - Intronic
1160718798 19:588789-588811 CCAGGTGCCAGGAGGGTCCCAGG + Intergenic
1161127430 19:2566286-2566308 CCACAAGCCAGGGAAGGCCAAGG + Intronic
1161127441 19:2566323-2566345 CCAGGAGCTGGGAGTGGCCCTGG + Intronic
1161152068 19:2714750-2714772 CCAGCAGCCAGGACAGGCTCGGG + Exonic
1161221009 19:3118155-3118177 CCAGGCCCCAGGGAAGGCCGGGG - Intronic
1161306753 19:3573060-3573082 CCCCGGGCCAGGAAAGACCCCGG - Intronic
1161326737 19:3667812-3667834 GCAGGCGCCAGGAGAGGCTCGGG + Intronic
1161326805 19:3668038-3668060 CCAGGAGCCAGGGCAGGGCTGGG - Intronic
1161430035 19:4226118-4226140 CCAGGAACAAGGAAACCCCCAGG - Intergenic
1161507919 19:4654008-4654030 CCAGGAGCTGGGAGAGGCCCAGG + Exonic
1162495583 19:11021624-11021646 CCAGCAGCCAGGAAGGCTCCAGG - Intronic
1162810839 19:13163661-13163683 TCAGGAAACAGGAAAGGTCCTGG - Intergenic
1163079857 19:14931030-14931052 TCAGGGCCCAGGAAAGGCCTAGG + Intergenic
1163105595 19:15121370-15121392 CCAGGTTCCAGGACAGGCACGGG - Intronic
1163131083 19:15273383-15273405 CTAGGAGCCAGCAAAGGCTCTGG + Intronic
1163291472 19:16381908-16381930 CCAGAAGCCAGCACATGCCCAGG - Intronic
1163296168 19:16414197-16414219 CCAGGAGCATGGAGTGGCCCTGG + Intronic
1163514742 19:17756022-17756044 CCAGGAGTCAGGGAAGGACCAGG + Intronic
1163651677 19:18521612-18521634 CCAGCAGGCCAGAAAGGCCCCGG + Intronic
1164250460 19:23470796-23470818 CCGCCAGCCAGGAAAGGGCCAGG - Intergenic
1164302209 19:23972296-23972318 CCGCCAGCCAGGAAAGGGCCAGG + Intergenic
1164467511 19:28500484-28500506 CCAGGAGTCAGGGGTGGCCCAGG + Intergenic
1164608458 19:29616594-29616616 CCAGGAGAGTAGAAAGGCCCAGG + Intronic
1164768832 19:30792499-30792521 CCAGGTGCCAAGAATGGCCTGGG - Intergenic
1164842097 19:31400270-31400292 CAAGGAGCCAGGACAGGACAGGG + Intergenic
1164876104 19:31691192-31691214 CCAGGTGCCAGGCAGTGCCCTGG - Intergenic
1165068233 19:33241176-33241198 CCAGGAGCCAGGCCAGGCCCAGG - Intergenic
1165322883 19:35097018-35097040 CCTGGGACCAGGAAGGGCCCGGG + Intergenic
1165738077 19:38189986-38190008 CCCCCAGCCAGGAAAGGGCCAGG - Intronic
1165826486 19:38708783-38708805 GCAGGAGCCAGGAAAGGTCCCGG + Intronic
1165904350 19:39184558-39184580 CCATGAGTCAGGAAAAGCCAGGG + Intergenic
1166360946 19:42252798-42252820 CCAGGAGCCAGGCACGGGCAAGG + Intronic
1166750456 19:45161962-45161984 CCAGGTCGCAGGAAGGGCCCTGG - Intronic
1166865696 19:45835441-45835463 GCAGGAGCCAGGCAAGGCAAGGG + Intronic
1167632068 19:50631587-50631609 CCAGGTGAAAGGAGAGGCCCAGG - Intronic
1168125216 19:54279054-54279076 CCAGGGGCCATGACAGGACCCGG + Exonic
1168307435 19:55443034-55443056 CCAGGAGGCAGGAAGGGCGGAGG + Intergenic
1168346098 19:55650908-55650930 CCAGGAGGCAGGCAAGGCCTTGG - Intronic
1168407663 19:56119410-56119432 CCAAGGCCCAGGAAAGGGCCTGG + Intronic
925264735 2:2559119-2559141 CCAGGAGCCTGGGAAGTCCAAGG - Intergenic
925551195 2:5076988-5077010 TCAGGACCCAGGGAAGGTCCAGG - Intergenic
926019679 2:9484126-9484148 CAGAGAGGCAGGAAAGGCCCAGG - Intronic
926088682 2:10036214-10036236 CCTGGTGCCAGGAAAGCCCCTGG + Intergenic
926116169 2:10214731-10214753 ACAGGAGCCAGGATGTGCCCAGG - Intergenic
926155671 2:10452597-10452619 CCTGGAGCCCAGAAGGGCCCTGG + Intergenic
926728163 2:16014569-16014591 TCAGCAGCCAGGCAAGCCCCGGG + Intergenic
926785277 2:16511812-16511834 CCAGGACCCAGTAGAGGCCGAGG + Intergenic
926830774 2:16959737-16959759 ACAGGAGCAAGGCAAGGCCCAGG - Intergenic
926889849 2:17629654-17629676 CCTGGGGCCAAGCAAGGCCCAGG - Intronic
928205190 2:29278877-29278899 CCAGGGGCCAAGCCAGGCCCTGG + Intronic
928630516 2:33186992-33187014 CCAGCAGCCAGGCAAGGCGTTGG + Exonic
928832948 2:35510830-35510852 CAAGGAGCCAGGAATGAGCCTGG - Intergenic
929006932 2:37404514-37404536 CAAAAATCCAGGAAAGGCCCAGG - Intergenic
929492572 2:42409008-42409030 CCAGGTGCCAGCACAGGCACTGG - Intronic
929879403 2:45823035-45823057 CCAGGTGCCATGCTAGGCCCAGG + Intronic
930019107 2:46990366-46990388 CCAGGCCCAAGGACAGGCCCGGG - Intronic
931247456 2:60503394-60503416 CCAGGAGCCAGACATGTCCCTGG + Intronic
931817602 2:65920134-65920156 CCAGGAGCAATGAAAGGCCATGG - Intergenic
932102534 2:68913809-68913831 ACAGAAGAGAGGAAAGGCCCAGG + Intergenic
932438521 2:71717272-71717294 CCTGGAGCCAGGACAGGAACTGG - Intergenic
933258671 2:80108008-80108030 TCAGGGCCCAGGAAAGGCACTGG - Intronic
933586557 2:84185734-84185756 ACAGAAGCCAGGAGAGGTCCAGG - Intergenic
933705221 2:85284563-85284585 CAAGCACCCAGGAAAAGCCCAGG - Intronic
933829411 2:86195039-86195061 CCAGCAGCCAGGATTGGTCCTGG + Intronic
933980234 2:87543224-87543246 CCAAAATCCTGGAAAGGCCCTGG - Intergenic
934521166 2:95021049-95021071 CCAGGAGACAGCAAGGGGCCTGG + Intergenic
935160301 2:100523977-100523999 CCAGGAGCCTGGAAATAACCAGG - Intergenic
935292834 2:101624646-101624668 CCAGGAGTGAGGAAGGGCCGGGG + Intergenic
935949465 2:108315723-108315745 TCAAGGCCCAGGAAAGGCCCAGG - Intergenic
936022030 2:109002232-109002254 CCAGGAGCAAGCACAGGGCCAGG - Intergenic
936055666 2:109260302-109260324 CCAAGTGCTAGGCAAGGCCCAGG + Intronic
936313592 2:111407567-111407589 CCAAAATCCTGGAAAGGCCCTGG + Intergenic
936991504 2:118371861-118371883 CAAGATGCCAGGAATGGCCCAGG + Intergenic
937228742 2:120384674-120384696 CCAGGGGCCTGGCAAGCCCCAGG - Intergenic
937883212 2:126883593-126883615 CCAGCATCCAGGACAGGGCCGGG - Intergenic
937922873 2:127144331-127144353 TCAGGAGCCAGGAAGGCCCTGGG - Intergenic
938159890 2:128975683-128975705 CCAGGAGGCAGGATGGGCCCAGG - Intergenic
938422582 2:131156470-131156492 CCATGAAACAGGAAAGGCCAAGG + Intronic
939466322 2:142561838-142561860 CCAGGAGCAGGGAGAGGCCAGGG - Intergenic
939996120 2:148921541-148921563 CCAGCAGACAGCAAAGGGCCTGG - Intronic
940276560 2:151946402-151946424 CCAGGACACAGGACAGTCCCAGG + Intronic
940984364 2:160037973-160037995 CCAGGAGCCAGAGAAGTCCCTGG + Intronic
942072686 2:172329765-172329787 ACAGGCACCAGGAAAGGACCAGG - Intergenic
943247566 2:185474317-185474339 CCAGGTGCCAGCACAGGCTCTGG - Intergenic
943279696 2:185916512-185916534 CTTAGATCCAGGAAAGGCCCAGG - Intergenic
944086276 2:195851104-195851126 ACAGAAGCCAGGAAGGGCTCTGG + Intronic
946495511 2:220192117-220192139 CCAGGAGCAGGGAGAGGCCAGGG - Intergenic
947605534 2:231483322-231483344 CCAGAAGCCTGGAGAGGGCCGGG + Intronic
947733788 2:232444671-232444693 CCAGGAGGCAGGCAGAGCCCAGG - Intergenic
947918162 2:233848148-233848170 CAAGGTGCCAGGAAAGGGACTGG + Intronic
948083617 2:235227651-235227673 CCAGGAGACAGGAAAGCCCAGGG - Intergenic
948328976 2:237150361-237150383 CTAGGAGCCAGGACAGGGTCAGG - Intergenic
948786650 2:240356162-240356184 CCAGGAGGCAGGACAGGCACCGG + Intergenic
948806838 2:240456713-240456735 ACAGGCCCCAGGAAAGGACCCGG + Exonic
948949663 2:241240761-241240783 CGAGGGTCCTGGAAAGGCCCCGG + Intronic
949000454 2:241610184-241610206 CCACGAGGCAGGACAGCCCCGGG + Intronic
949001628 2:241617882-241617904 CCAGGAGACAGGACAGTCTCTGG - Intronic
1168908718 20:1427819-1427841 CCAGGAAACAGGAAAGTACCAGG + Intergenic
1169029525 20:2396784-2396806 CCAGGACCCAGTGCAGGCCCTGG - Intronic
1169399683 20:5269391-5269413 CCAAGAGCCAGGCAAGCTCCTGG - Intergenic
1169784796 20:9348034-9348056 CCAGGAGCCAAGGATGGTCCAGG + Intronic
1171238730 20:23548298-23548320 GCAGGAGCCAGGACAGGACCAGG + Intergenic
1172006227 20:31820433-31820455 CCAGGATCCTGGAAAGCCCAGGG + Exonic
1172097090 20:32465783-32465805 CCAGGAACCAGGAAGTGACCAGG - Intronic
1172237382 20:33387432-33387454 CCAGCAGCCGGGGAAGGTCCCGG + Exonic
1172601303 20:36185351-36185373 CAAGGAGCCACAGAAGGCCCTGG - Intronic
1172687939 20:36771344-36771366 CCAGGAGCCAGGAAAGATTTGGG + Intronic
1172706051 20:36882758-36882780 CCAGGATCCAGGAAAGGGTGAGG + Intronic
1172893552 20:38283874-38283896 CCAGAACCCAGGAAACCCCCAGG + Intronic
1172969584 20:38863534-38863556 ACAGGAACCTGGAAAGGGCCTGG - Intronic
1174289872 20:49500469-49500491 CCAGCAGCCACGGAAGGCTCTGG - Intergenic
1174420835 20:50398257-50398279 CCAGGCCCCAGGAAACGGCCGGG - Intergenic
1175223871 20:57433626-57433648 CCAGGGGCCTGCAGAGGCCCTGG - Intergenic
1175233678 20:57493383-57493405 GCAGTGGCCAGGCAAGGCCCGGG - Intergenic
1175419137 20:58820374-58820396 CCAGGTGCCAGGTATGGCTCCGG - Intergenic
1175587103 20:60149750-60149772 CCAGGGGCAAGGAAAGGCTTGGG + Intergenic
1175766206 20:61594415-61594437 ACAGGAGCCAGGGCAGACCCAGG - Intronic
1175836821 20:62001363-62001385 CCAGGAGTCAGGAGAGGCTGAGG - Intronic
1176110174 20:63407472-63407494 CCAGGAAACAGGAGAGACCCAGG + Intronic
1176110213 20:63407584-63407606 CCAGGAAACAGGAGAGACCCAGG + Intronic
1176142016 20:63548990-63549012 CCTGGAGCCAGCAGGGGCCCTGG + Intronic
1176170928 20:63696097-63696119 CCAGGAGCCAGGGAAGTTCTGGG - Exonic
1176379145 21:6103029-6103051 CCAGGAGCCAGGAGAGGCATGGG + Intergenic
1176822029 21:13666266-13666288 ACAGGCCCCAGGGAAGGCCCAGG - Intergenic
1177112795 21:17049112-17049134 CCAGGAGCCAAGCAAGGCCCAGG - Intergenic
1179164848 21:38927333-38927355 CCAGGAGCCAAGAAATGCAAGGG - Intergenic
1179221538 21:39412470-39412492 CCAGGAGGCAAGAAAGGCTTTGG + Intronic
1179276860 21:39899727-39899749 ACAGGAGACAGGAAAAGCCCTGG - Intronic
1179320298 21:40285197-40285219 CCAGGAGCAAGGCAAAGCACTGG - Intronic
1179488501 21:41726126-41726148 CGGGGAGGCAGGAGAGGCCCTGG - Intergenic
1179593628 21:42427781-42427803 CCAGGCACCAGGATGGGCCCTGG - Intronic
1179744328 21:43435208-43435230 CCAGGAGCCAGGAGAGGCATGGG - Intergenic
1180064440 21:45405463-45405485 CGCGGAGCCAGGTAAGACCCGGG + Intronic
1180198736 21:46212477-46212499 CCCAGAGCCAGGACAGGACCAGG + Intronic
1180225470 21:46389421-46389443 CCAGCAGGCAGGTGAGGCCCAGG + Exonic
1180802056 22:18636587-18636609 GGAGGAGCCAGGCAAGGCCCGGG + Intergenic
1180853293 22:19032139-19032161 GGAGGAGCCAGGCAAGGCCCGGG + Intergenic
1181139108 22:20791001-20791023 CCAGCAGCCCGGAGAGGCGCAGG + Intronic
1181219666 22:21358672-21358694 GGAGGAGCCAGGCAAGGCCCGGG - Intergenic
1181311730 22:21948589-21948611 CCAGGGGCCAGGGCAGTCCCAGG - Intronic
1182428696 22:30288140-30288162 CCAGGCCCCAGGGAGGGCCCAGG + Intronic
1183005979 22:34902583-34902605 GAAGGAGCCAGGAAAGGCTGAGG + Intergenic
1183058187 22:35319747-35319769 CCAGGAGCCAGGGACGGGCGAGG + Intronic
1183540734 22:38427923-38427945 CCAGGAGACAAGGAAGGCCGCGG + Exonic
1183734656 22:39637102-39637124 CCAGGGCCCAGCATAGGCCCTGG - Intronic
1183745397 22:39688902-39688924 CCAGGAGCCTGGGACGGGCCAGG - Exonic
1183872341 22:40749239-40749261 CCCGGAGCCAAGCGAGGCCCGGG + Intergenic
1183990802 22:41595957-41595979 CCAGGAGCCAGGGAAAAGCCTGG - Intergenic
1184091238 22:42294084-42294106 ACAGGAGCCAGGAAGAGCCTGGG + Intronic
1184349870 22:43936477-43936499 CCAGCACCCAGGACAGGGCCTGG + Intronic
1184552583 22:45212417-45212439 CGAGGAGCCAGGAACGCCACTGG + Exonic
1184552759 22:45213326-45213348 CCAGGAGCCAGGCAGGGCATGGG - Intronic
1184610115 22:45597997-45598019 CCAGGACACAGCAAAGGCTCAGG - Intronic
1184658803 22:45955858-45955880 CCAGAGGCCAGCAGAGGCCCAGG + Intronic
1184730459 22:46368636-46368658 CCAGGAGCCACGACAGGGTCAGG - Intronic
1184818165 22:46888126-46888148 GCAGCAGCCAAGAAAAGCCCTGG + Intronic
1185027629 22:48424764-48424786 GCAGGGGCCAGGGAAGGCCTTGG + Intergenic
1185130369 22:49035425-49035447 TCAGGAGCAGGGAAAGGCCATGG - Intergenic
1185178879 22:49347979-49348001 CCAGGATGCAGAGAAGGCCCTGG - Intergenic
1185212358 22:49577452-49577474 CCAGGCCCCAGCAAAGGCCTTGG + Intronic
1185212378 22:49577512-49577534 CCAGGCCCCAGCAAAGGCCTTGG + Intronic
1185220744 22:49628012-49628034 CCAGGCCCCAGGCAGGGCCCAGG + Intronic
1185386981 22:50537922-50537944 TCAGGAGCAAGGAAGGGGCCGGG - Intergenic
949438490 3:4054963-4054985 CCCTGAGTCAGGAAAGACCCTGG - Intronic
950422863 3:12908907-12908929 CCTGGAGCCAGGGATGGCCTTGG + Intronic
950503037 3:13376518-13376540 CCAGCAGCCAGGCCAGGCCAAGG + Intronic
952540100 3:34358345-34358367 CAAGGTGTCAAGAAAGGCCCTGG + Intergenic
952964663 3:38613682-38613704 CCAGGTGGCTGGAAAGGCCCAGG + Intronic
953027744 3:39154375-39154397 CCCCGAGTCAGGAAAGGCCTTGG - Intronic
953070297 3:39513739-39513761 CCCTGAGCCATGAAAGACCCTGG - Exonic
953138497 3:40205060-40205082 ACAGGTGCCAGGAAGGACCCTGG + Intronic
953747639 3:45587222-45587244 CCAGCACCTAGGAAAGGGCCCGG + Intronic
954130055 3:48556314-48556336 CCAGGAGAGAGGGAAGGGCCTGG + Intronic
954195131 3:48991857-48991879 CCGGCAGGCAGGAATGGCCCTGG - Intronic
954322348 3:49840726-49840748 CCAGGAGCCAGGAAGAGCAGAGG + Intronic
954633518 3:52059298-52059320 ACAGCTGCCAGGCAAGGCCCCGG - Intergenic
954724136 3:52592784-52592806 CTAGCAACCAAGAAAGGCCCAGG - Intronic
955086864 3:55710963-55710985 CCAGGGGCAAGGACAGGGCCAGG - Intronic
956060153 3:65340912-65340934 CCAGGATGCAGGAAAGGGCCAGG + Intergenic
956378624 3:68642627-68642649 CTACGAACCAGGAAAAGCCCTGG - Intergenic
958703782 3:97627209-97627231 CCAGGATCCAGAAAAGTACCTGG - Intronic
958758238 3:98275354-98275376 CCAGGACCCAAGCAAGGCCCAGG + Intergenic
959379131 3:105620486-105620508 TCAGGGCCCAGTAAAGGCCCCGG + Intergenic
960571498 3:119189175-119189197 CCAGGAGCCAGCAAAGCTCTTGG + Intronic
961044616 3:123699957-123699979 CCATGAGCTAGGAGTGGCCCTGG + Intronic
961470442 3:127107930-127107952 CCAGGAGCCAGGGATGGCCCAGG - Intergenic
961553327 3:127681103-127681125 CAGGGAGCCAGGATGGGCCCAGG - Intergenic
961604811 3:128085744-128085766 AGAAGTGCCAGGAAAGGCCCAGG + Intronic
961695100 3:128698738-128698760 CCAGGGGCCAGGCTGGGCCCTGG - Intergenic
963045207 3:141097210-141097232 CCAAGGGCCAACAAAGGCCCTGG - Intronic
963651093 3:147981033-147981055 GCAGCAGCCAGGAATGGCCCAGG + Intergenic
963932738 3:151020993-151021015 CCAGGAGCAAGGACAGCACCTGG + Intergenic
966156071 3:176917984-176918006 CCAGGGGCCAGGAACTGCCTTGG - Intergenic
967391875 3:188964137-188964159 CCAGGAACTAGGACTGGCCCAGG - Intronic
967788131 3:193519450-193519472 CCATGAGGCAGGAAAGGGCTGGG - Intronic
968484459 4:852243-852265 CCAGGAGCCAAGGCAGACCCAGG + Intronic
968484482 4:852306-852328 CCAGGAGCCAAGGCAGACCCGGG + Intronic
968654881 4:1774139-1774161 CCATGAGCCAGGACATGGCCCGG - Intergenic
968663359 4:1807970-1807992 ACAGGAGGCAGGCATGGCCCTGG + Exonic
968896799 4:3409070-3409092 CCTGGAGCCTGGGCAGGCCCAGG + Intronic
969045012 4:4330333-4330355 CCTGAAGCCAGGAGAGGGCCTGG + Intergenic
969351178 4:6598822-6598844 CCAGGAGCCAGGAAGGGACCGGG - Intronic
969366974 4:6701540-6701562 CCAAGAGCCAGGAGAGCCTCAGG - Intergenic
969864815 4:10067940-10067962 CCATGAGCCAGGCTAGCCCCAGG - Intergenic
970232282 4:13923025-13923047 GCAGGAGCCAGGAGATGCCAAGG - Intergenic
971266892 4:25103603-25103625 GCAAGGGCCAGGAAAGGGCCTGG + Intergenic
971454030 4:26827138-26827160 TAAGGAGCCAGGAAAGGCTATGG - Intergenic
971859328 4:32085118-32085140 CCCAGAGCCAAGCAAGGCCCTGG - Intergenic
973551199 4:52038013-52038035 CCAGGAGCCAGGGGCGGCCTCGG - Intronic
973816423 4:54623500-54623522 CCAGGAGGCAGGAATGGCAAGGG - Intergenic
973967788 4:56181667-56181689 CCAGAAGCCAGGAAGAGCCAAGG - Intronic
974515153 4:62898264-62898286 CCAGGTGCCAGCACAGGTCCTGG - Intergenic
976111778 4:81683051-81683073 TCAGGATCCATGAAAGACCCAGG - Intronic
976554568 4:86435119-86435141 CCAGAGGCCAGGAAGGGGCCAGG + Intronic
976707323 4:88033074-88033096 CCAGGTCCCAGGAAAGTCCATGG - Intronic
977617938 4:99106245-99106267 CCAGGAGACAGTTAACGCCCTGG + Intergenic
977861298 4:101963766-101963788 CCAGGTGCGAGAAAAGGCCTCGG - Intronic
979258830 4:118630997-118631019 CCAGCAGCCTAGACAGGCCCAGG + Intergenic
979329519 4:119409560-119409582 CCAGCAGCCTAGACAGGCCCAGG - Intergenic
980007111 4:127555286-127555308 CCAGGAGCTGGGAAAGTGCCAGG + Intergenic
981090493 4:140727315-140727337 GCAGGAGCCAGGAGAGAGCCAGG - Intronic
981727449 4:147862287-147862309 CCGGGAGCCGGGAGAGGCCAGGG + Intronic
982132497 4:152243187-152243209 CCAGGAGTCAGGTAAAGTCCAGG - Intergenic
984296775 4:177862798-177862820 CCAGGAGCCGGCACAGGCACTGG - Intronic
984699506 4:182809582-182809604 CCAGGGACCAGGCAGGGCCCAGG - Intergenic
984763693 4:183383778-183383800 CCAGAAGTGGGGAAAGGCCCGGG - Intergenic
985634329 5:1028529-1028551 CCAGGGGCCAGGAGAGCCCCCGG + Intronic
985724832 5:1510680-1510702 CCAGGATACAGGGACGGCCCTGG + Intronic
985772043 5:1817829-1817851 CCAGGAGCCAGGCCAGCCCCTGG + Intergenic
986116721 5:4782492-4782514 CAAGGAGCCAGGCAAGGGGCAGG + Intergenic
986507997 5:8473124-8473146 CATGGAGCCAAGAGAGGCCCAGG - Intergenic
987030795 5:13974895-13974917 CCAGGAGGCTGGTAAGGCCAGGG + Intergenic
990175980 5:53109529-53109551 CCCGGAGACAGGAAGGGCCCGGG + Exonic
990732187 5:58821296-58821318 CCAGGGGCTTGGAAAGGCCCTGG - Intronic
990940966 5:61202755-61202777 CTAGGTGCCAGGAAGGGCCAGGG - Intergenic
991359158 5:65802313-65802335 CCAGGTGCCAGCACAGGCGCTGG + Intronic
992029748 5:72709316-72709338 CCAGGAGCAGGGAGAGGCCAGGG + Intergenic
992615640 5:78543621-78543643 TCAGGAGCCAGCAAAGCCCAGGG + Intronic
992771864 5:80055962-80055984 GGAGGGGCCAGCAAAGGCCCTGG - Exonic
993556068 5:89339997-89340019 TCAGGAACCAGGCAAGGCACTGG - Intergenic
994014014 5:94943910-94943932 CCTGGAGCAACCAAAGGCCCAGG - Intronic
995063305 5:107834936-107834958 CCAGGTGCCAGCCAAGGACCAGG + Intergenic
996097654 5:119415672-119415694 CCAACAGCCAGAAAAGACCCGGG + Intergenic
997356744 5:133267331-133267353 CCAGGACCCATGAGAGGGCCTGG + Intronic
997435643 5:133872757-133872779 CCAGGGTCCAGGGAATGCCCTGG + Intergenic
997712594 5:136018298-136018320 CCAAGACCAAGGAAAGGCACAGG + Intergenic
998012820 5:138709001-138709023 CAAGGAGATAGGAGAGGCCCAGG + Intronic
998825377 5:146096132-146096154 CCAGAAGCCAGGAAAGAGACAGG - Intronic
998872252 5:146564210-146564232 CCAACAGCCAGGAGAGCCCCAGG - Intergenic
999122556 5:149220423-149220445 CCAGGAGCCAGGAGAGGGATGGG - Intronic
999270843 5:150295579-150295601 GCAGGAGCCAGGATAGGCAGAGG - Intergenic
999315222 5:150579248-150579270 CCAGGAGCAGGGAGAGGCCAAGG - Intergenic
1000027952 5:157376406-157376428 CATGGAGCCAGGGAAGGGCCTGG - Intronic
1000662370 5:163951848-163951870 ACAGGAGCCAGGAAGAGCCATGG - Intergenic
1001154774 5:169263456-169263478 CCAGGAGCCAGGAAGGAGCAAGG + Intronic
1001281831 5:170391480-170391502 CCCGCAGCCAGCAAAGGACCTGG - Intronic
1001631369 5:173177887-173177909 TCAGGGGCGAGGGAAGGCCCAGG + Intergenic
1002681723 5:180970238-180970260 CCAGGAGCAGGGAATGCCCCAGG - Intergenic
1002729410 5:181324610-181324632 CCAGCAGCCTAGACAGGCCCAGG + Intergenic
1002778256 6:347138-347160 CTAGGAGCCAGGAGAAGCCCAGG - Intronic
1004199495 6:13534621-13534643 GCAGGGGCCAGGAGAGGCCTTGG + Intergenic
1005728695 6:28674584-28674606 CCGGGACCCGGGATAGGCCCTGG + Intergenic
1006463718 6:34178592-34178614 CCAGGCGCCAGCACAGGCACTGG + Intergenic
1006520048 6:34565984-34566006 AGAGGAGCCAGGGCAGGCCCAGG - Intergenic
1006721914 6:36160490-36160512 CCAGAAGCTAGGAAAGGGCAAGG - Intergenic
1007294828 6:40813903-40813925 GCAGGAGGCTGGACAGGCCCTGG - Intergenic
1007735243 6:43978262-43978284 CCTGGAGCAAGGGAAGCCCCTGG - Intergenic
1007741604 6:44013176-44013198 TCAGGAGCCAGGATATGGCCTGG + Intergenic
1007823267 6:44577970-44577992 CCAGTAGACAGGAAAGAGCCTGG + Intergenic
1011409304 6:87050253-87050275 TCAGGAGCCAGGAAGGCCCATGG + Intergenic
1012100980 6:95084960-95084982 CCAGGCGCCAGCACAGGCGCTGG - Intergenic
1013223970 6:108106405-108106427 ATAGGAGCAAGGAAAGGTCCTGG + Intronic
1013598574 6:111683335-111683357 GCAGGGGCCAGGACAGGCCTGGG + Intronic
1014442275 6:121487434-121487456 CCAGGAATCAGGAAAGGGCCAGG + Intergenic
1014736466 6:125100297-125100319 CCAGGAACCAGGAGGAGCCCTGG + Intergenic
1015201505 6:130586529-130586551 CAGGGAGCCAGCAAAGGACCAGG - Intergenic
1016120434 6:140337008-140337030 CCAGAAGCTAGGAAAGGGCTAGG - Intergenic
1017396135 6:154002204-154002226 CCAGGTGCCAGCACAGGCACTGG + Intergenic
1018424883 6:163671337-163671359 CCAGGATCCAGGAAAAGGCCAGG - Intergenic
1018743086 6:166744866-166744888 CCCAGAGCCGGGGAAGGCCCAGG - Intronic
1018803257 6:167239321-167239343 CCAGTAGCCAGGGAAGCCACAGG - Intergenic
1018826986 6:167415764-167415786 ACAGGAGCCAGGGAAGCCACAGG + Intergenic
1018984050 6:168622438-168622460 CCAGGCACCAGGAGAGGCACAGG - Intronic
1019080162 6:169424876-169424898 CCAGCAGCGGGAAAAGGCCCTGG - Intergenic
1019299524 7:296285-296307 CTAGGAGGCAGAAAAGACCCAGG - Intergenic
1019314601 7:378751-378773 CCAAGAGCAGGGAAGGGCCCTGG + Intergenic
1019758349 7:2789751-2789773 CCAGGAGCAAGGAGGGGACCTGG - Intronic
1019767590 7:2863221-2863243 CCGGGAGCCAGGACAGGGCAAGG - Intergenic
1020658903 7:10959635-10959657 CCAGGTGCCAGCATAGGCACCGG + Intergenic
1022505825 7:30908193-30908215 CCAGGAGCCAGCAGAGGGCGAGG + Intergenic
1022509916 7:30928484-30928506 CCAGGAGTCTGGAAAAGCACTGG + Intergenic
1022673455 7:32477146-32477168 CCTGGAGCCAGGAAAACACCTGG + Intergenic
1022818792 7:33938521-33938543 CCAGGATCTAGGAAAGGCAAGGG + Intronic
1023224341 7:37953161-37953183 CCAGGATCCAGGCAAGCCCCAGG + Intronic
1023648836 7:42347562-42347584 GCAGGAGGAGGGAAAGGCCCAGG + Intergenic
1023840536 7:44094918-44094940 TTAGGATCCAAGAAAGGCCCAGG - Intergenic
1023902174 7:44490349-44490371 CCAGGAGTCAGGGCAGGCCGGGG + Intronic
1024073735 7:45808047-45808069 CCAGCAGCCTAGACAGGCCCAGG + Intergenic
1024098177 7:46003005-46003027 CCAGGAGCCAAGGAATGCCATGG + Intergenic
1024258718 7:47558521-47558543 GCAGGGACCAAGAAAGGCCCAGG + Intronic
1024535086 7:50423829-50423851 CCAGGAGCCAGGCAAAACCATGG - Intergenic
1024649599 7:51392153-51392175 CCAGCAGCCTAGATAGGCCCAGG - Intergenic
1024722104 7:52148855-52148877 CCTGGATCAGGGAAAGGCCCTGG - Intergenic
1025053680 7:55747483-55747505 CCAGCAGCCTAGACAGGCCCAGG - Intergenic
1025131783 7:56377957-56377979 CCAGCAGCCTAGACAGGCCCAGG - Intergenic
1025689347 7:63745938-63745960 CCAGCAGCCTAGACAGGCCCAGG + Intergenic
1028505103 7:91561766-91561788 CCTGAAGCCAGGAAAAGCCCAGG + Intergenic
1029117389 7:98244356-98244378 CAGGGAGCCAGGCCAGGCCCAGG - Intronic
1029506133 7:100965192-100965214 CCAGGAGGCAGGATAGGCACAGG - Intronic
1029864436 7:103611619-103611641 CGAGGTGCCAGGTAAGGCCGTGG + Exonic
1029899432 7:104023216-104023238 CCAGGAGCCAGCACAGGTGCGGG - Intergenic
1032051134 7:128651746-128651768 CCAGCAGCCTAGACAGGCCCAGG + Intergenic
1032466969 7:132152168-132152190 GCAGGGGCCAGGAAAAGCCAAGG + Intronic
1032683518 7:134209182-134209204 CAAGGAGTCAGGGGAGGCCCAGG + Intronic
1032934527 7:136713481-136713503 CCAGAAGCCAGGAAAGAGCATGG + Intergenic
1033038136 7:137894280-137894302 CCAGGTGCCAGGACAGATCCGGG - Intronic
1033546504 7:142405974-142405996 CCAGGAAGCAGGTGAGGCCCAGG + Intergenic
1035397793 7:158546547-158546569 CCAGCAGCCAGGAAGCACCCTGG + Intronic
1035450950 7:158976459-158976481 CCAGGGGCCATGAAGGGCCGTGG + Intergenic
1035562139 8:613828-613850 CCAGGAGCCAGCCAGGGCCTGGG - Intergenic
1035859219 8:3010021-3010043 CAATGAGGCAGGATAGGCCCAGG - Intronic
1036773501 8:11594278-11594300 TCAGCAGCCTTGAAAGGCCCAGG - Intergenic
1037440714 8:18913518-18913540 CCAGGAGCCAGGCCAGCCTCAGG + Intronic
1037693948 8:21207701-21207723 CCAGAAGCCAGGACAGTCTCAGG - Intergenic
1037755680 8:21708725-21708747 CCAGAAGCCAAGGAATGCCCAGG + Intronic
1037788973 8:21919942-21919964 CCGGGAGGCGGGAAAGGCCCCGG - Intronic
1037879577 8:22566215-22566237 CCAGGACCCGGGAGACGCCCTGG + Intronic
1037944815 8:22982188-22982210 CAAGTAGCCAAGAAAGGGCCTGG + Intronic
1037969779 8:23163856-23163878 CCAGGAGCCAGGACAGCGTCGGG - Exonic
1038124139 8:24652367-24652389 CCAGGAGCCAGGAGGGGCAGAGG + Intergenic
1038286448 8:26210044-26210066 CCAAGGCCCAGGAAAGGCCTAGG - Intergenic
1038338401 8:26663527-26663549 CCAGGAGGGAGGCCAGGCCCTGG - Intergenic
1038689298 8:29746606-29746628 CTAGGAGCCAAGGAAGGCCAAGG + Intergenic
1042784916 8:72536780-72536802 CCCGGGGCCGGGAAAGCCCCGGG - Intergenic
1043582682 8:81732443-81732465 CTGGCAGCCAGGAAATGCCCTGG + Exonic
1043711297 8:83422248-83422270 CCAGGAGGCAGGAAAGGAGGTGG - Intergenic
1044580365 8:93820135-93820157 CCAGGAGCCAGGGCAGAGCCTGG - Intergenic
1044748930 8:95397946-95397968 CCAGGAGGCAGGACAGACCAGGG - Intergenic
1045003101 8:97895283-97895305 CCAGAAGCCATGAGAGGCTCTGG + Intronic
1045285620 8:100788953-100788975 CTAGGAGCCAGCAAAGGGCCTGG - Intergenic
1045348518 8:101316651-101316673 CCAGCAGCCAGGAGAGGGACAGG + Intergenic
1046249525 8:111611870-111611892 CCAGGAGCCAGCACAGGCCCTGG + Intergenic
1047324657 8:123824815-123824837 CCAGGAGCCAAGGAACGCCAGGG + Intergenic
1047792327 8:128216929-128216951 TCAGGAGACAGAAAAGACCCTGG - Intergenic
1048157896 8:131978889-131978911 AAAGGATCCAGGAAAGACCCTGG - Exonic
1048308803 8:133302419-133302441 CCAGGAGCCAGGAAGGGGCAAGG - Intergenic
1048331720 8:133475256-133475278 GCAGGAGCCAGGAGCGGGCCTGG + Intronic
1048896507 8:138997267-138997289 CCAGGAGCCAAGAAATGCGAGGG - Intergenic
1049277399 8:141726633-141726655 CCAGCAGGCAGGAAAGACACAGG - Intergenic
1049365037 8:142232987-142233009 GCTGGAGTGAGGAAAGGCCCAGG - Intronic
1049422678 8:142523899-142523921 AGAAGAGCCAGGAAGGGCCCAGG + Intronic
1049444895 8:142625368-142625390 CCAGGAGCCATGAATCTCCCAGG + Intergenic
1049454541 8:142680392-142680414 CCTGGAGCCAGTGAGGGCCCCGG - Intronic
1049638374 8:143701843-143701865 GCAGGAACCTGGCAAGGCCCAGG - Intronic
1049668118 8:143857480-143857502 ACAGCAGCCAGGGAAAGCCCGGG + Exonic
1049796290 8:144498679-144498701 CCAGGACCCAGGGAAGGACAAGG - Intronic
1051360557 9:16278081-16278103 CGAGGAGGCTGGAGAGGCCCAGG + Intergenic
1052551896 9:29962521-29962543 CCAGGAGTCATGATAGGTCCTGG - Intergenic
1052609955 9:30759146-30759168 CCAGGAGCGAGGAGAGGCCAAGG + Intergenic
1052995201 9:34548189-34548211 GCAGAAGCCAGGACAGTCCCTGG + Intergenic
1053526450 9:38835198-38835220 CCAGGAGCCAAGAGAAGCTCGGG - Intergenic
1054198677 9:62059623-62059645 CCAGGAGCCAAGAGAAGCTCAGG - Intergenic
1054639678 9:67528742-67528764 CCAGGAGCCAAGAGAAGCTCAGG + Intergenic
1055572699 9:77632728-77632750 CCAGGTGCCAGCAAAGGCACCGG - Intronic
1056245141 9:84687778-84687800 CCAAGACCCAGGAAAGTACCAGG - Intronic
1056512108 9:87316029-87316051 CCAGGAGCTGGGAAAGGCAGGGG + Intergenic
1056773311 9:89495356-89495378 CCAGCTTCCAGGGAAGGCCCTGG + Intronic
1057009662 9:91590039-91590061 GCAGGAGCCAGGAGATGTCCAGG - Intronic
1057266096 9:93619215-93619237 CCAGGAGCCAGGAGATGGCTGGG - Intronic
1057798917 9:98177407-98177429 GCAGGAGCAAGGAAAAGACCAGG + Intronic
1057955848 9:99407215-99407237 CCAAAAGCCTGGAAAGGCCTGGG + Intergenic
1058113234 9:101054660-101054682 CCAGCACCTTGGAAAGGCCCTGG - Intronic
1058270727 9:102968313-102968335 CCAAGAGCAAGGAGAGGCCATGG + Intergenic
1058321813 9:103641494-103641516 CCAGATGCTAGGAAATGCCCAGG - Intergenic
1059045522 9:110861999-110862021 CCAGGTGCCTGGAAAAGCCATGG + Intergenic
1059095226 9:111406346-111406368 CCAGAGGCCAGGAAAGGTACTGG + Intronic
1059269147 9:113061254-113061276 TCAGGAGACAGGAAGGGACCCGG - Intergenic
1060311997 9:122470655-122470677 CCAGGTGCCTGGAAAAGCCATGG + Intergenic
1060618748 9:125044031-125044053 CCAGGAGCTGGGAGAGGCCAGGG - Intronic
1061169280 9:128942806-128942828 CCCAGAGGAAGGAAAGGCCCTGG - Intronic
1061278242 9:129581823-129581845 CCAGGACCCAGGCAGGGCCATGG - Intergenic
1061718957 9:132539694-132539716 AGAAGAGCCAGGAGAGGCCCTGG - Intronic
1061724606 9:132575262-132575284 CCAGGAGAGAGGGAAGGGCCGGG - Intergenic
1061725434 9:132579941-132579963 CCAAAGGCCAGAAAAGGCCCTGG + Intergenic
1061824953 9:133252288-133252310 CGAGGACACAGGAAAGGGCCTGG + Intronic
1062008004 9:134251226-134251248 CCAGGAGCATGGCAAGGCACAGG + Intergenic
1062081794 9:134627991-134628013 GCAGCAGCCAGGAGATGCCCAGG + Intergenic
1062144374 9:134980742-134980764 GCAAGTGCCAGGAGAGGCCCTGG - Intergenic
1062161760 9:135084170-135084192 CCAGGAGCAAGGAAAGGACCTGG - Intronic
1062282000 9:135756366-135756388 CCAGGAGCCAGCCAGGGACCTGG - Intronic
1062339354 9:136087124-136087146 CCACATGCCAAGAAAGGCCCAGG + Intronic
1062389149 9:136327285-136327307 CCAGCAGCAAGGCCAGGCCCAGG + Intergenic
1062503147 9:136859782-136859804 CCAGGAGCCAGCAGAGGCTGAGG + Intronic
1062597977 9:137307596-137307618 GCAGGAGCCAGGTGAGCCCCGGG - Exonic
1062628815 9:137454555-137454577 CCAGGAGCCAGGGAGAGCACTGG - Intronic
1203577382 Un_KI270745v1:19879-19901 CCAGCAGCCTAGACAGGCCCAGG + Intergenic
1186553077 X:10527619-10527641 CCTGAAGCCAGGTAAGGCCCTGG - Intronic
1189073529 X:37890075-37890097 TCAGGGCCCAGGAAAGGCCTGGG - Intronic
1189091043 X:38083140-38083162 CCAGCAGCCATGAAAAGCCTTGG - Intronic
1189988767 X:46575465-46575487 CCGGGAGCCTGGAATGGCCTGGG + Intronic
1190062338 X:47219275-47219297 CCAGCTCCCAGGACAGGCCCAGG - Intronic
1192556301 X:72092315-72092337 CCAGAACCCAGGAGAAGCCCAGG - Intergenic
1197892865 X:131283210-131283232 CCAGGTGCCATGATGGGCCCAGG + Exonic
1198461559 X:136867925-136867947 CCAAAAACCAGAAAAGGCCCAGG + Intronic
1199255953 X:145719193-145719215 CCTGCAGCCAGGAAAGGCAATGG - Intergenic
1199555256 X:149101103-149101125 CAAAGAACCAAGAAAGGCCCTGG - Intergenic
1199559398 X:149146949-149146971 CCAGGAGCAGGGAGAGGCCAGGG - Intergenic
1199841151 X:151650728-151650750 CCAGCAGGCAGCAAAGGCCATGG + Intronic
1199990835 X:152987131-152987153 CAAGGAGCCCTGACAGGCCCTGG + Intergenic
1200033924 X:153316605-153316627 CAAGGAGCCCTGACAGGCCCTGG + Intergenic
1200147513 X:153934376-153934398 CCTGGGGCCAGGAAAGGCCATGG + Exonic
1200743178 Y:6877360-6877382 CCAGGAGCCCGGAAATATCCTGG + Intergenic
1200759555 Y:7025533-7025555 CCAGGAGCCAGGACGGGCACAGG - Intronic