ID: 1083332845

View in Genome Browser
Species Human (GRCh38)
Location 11:61906998-61907020
Sequence CAGGCCTCACATTTTGCAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 282
Summary {0: 1, 1: 0, 2: 4, 3: 39, 4: 238}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083332839_1083332845 -3 Left 1083332839 11:61906978-61907000 CCCAGGAGCCAGGAAAGGCCCAG 0: 1
1: 0
2: 6
3: 67
4: 524
Right 1083332845 11:61906998-61907020 CAGGCCTCACATTTTGCAGATGG 0: 1
1: 0
2: 4
3: 39
4: 238
1083332838_1083332845 -2 Left 1083332838 11:61906977-61906999 CCCCAGGAGCCAGGAAAGGCCCA 0: 1
1: 2
2: 4
3: 47
4: 394
Right 1083332845 11:61906998-61907020 CAGGCCTCACATTTTGCAGATGG 0: 1
1: 0
2: 4
3: 39
4: 238
1083332837_1083332845 -1 Left 1083332837 11:61906976-61906998 CCCCCAGGAGCCAGGAAAGGCCC 0: 1
1: 1
2: 9
3: 66
4: 475
Right 1083332845 11:61906998-61907020 CAGGCCTCACATTTTGCAGATGG 0: 1
1: 0
2: 4
3: 39
4: 238
1083332835_1083332845 2 Left 1083332835 11:61906973-61906995 CCGCCCCCAGGAGCCAGGAAAGG 0: 1
1: 0
2: 2
3: 37
4: 417
Right 1083332845 11:61906998-61907020 CAGGCCTCACATTTTGCAGATGG 0: 1
1: 0
2: 4
3: 39
4: 238
1083332830_1083332845 23 Left 1083332830 11:61906952-61906974 CCTCCCATGAGAGTTCTGGGACC 0: 1
1: 0
2: 2
3: 11
4: 121
Right 1083332845 11:61906998-61907020 CAGGCCTCACATTTTGCAGATGG 0: 1
1: 0
2: 4
3: 39
4: 238
1083332840_1083332845 -4 Left 1083332840 11:61906979-61907001 CCAGGAGCCAGGAAAGGCCCAGG 0: 1
1: 0
2: 5
3: 78
4: 628
Right 1083332845 11:61906998-61907020 CAGGCCTCACATTTTGCAGATGG 0: 1
1: 0
2: 4
3: 39
4: 238
1083332831_1083332845 20 Left 1083332831 11:61906955-61906977 CCCATGAGAGTTCTGGGACCGCC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1083332845 11:61906998-61907020 CAGGCCTCACATTTTGCAGATGG 0: 1
1: 0
2: 4
3: 39
4: 238
1083332832_1083332845 19 Left 1083332832 11:61906956-61906978 CCATGAGAGTTCTGGGACCGCCC 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1083332845 11:61906998-61907020 CAGGCCTCACATTTTGCAGATGG 0: 1
1: 0
2: 4
3: 39
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083332845 Original CRISPR CAGGCCTCACATTTTGCAGA TGG Intronic
900344247 1:2203581-2203603 CAGGTCCCACATTTCTCAGAAGG + Intronic
900666059 1:3816298-3816320 CAAGACACACATTCTGCAGAAGG - Exonic
900932386 1:5745581-5745603 CATTTCTCCCATTTTGCAGATGG + Intergenic
901435335 1:9244036-9244058 CAGTCCTCCCATTCTGCAAATGG - Intronic
901872984 1:12149101-12149123 CAAGCCTCCCATTTTACAGATGG + Intergenic
902398419 1:16144688-16144710 CAGCCCACTCATTTTACAGATGG + Intronic
902400717 1:16155403-16155425 CAGGCCTCGCATTTTGGGGAGGG - Intronic
902924444 1:19686817-19686839 CATGACTCTCATTTTACAGATGG - Intronic
902987827 1:20166216-20166238 CAGGACGCAGACTTTGCAGAGGG - Intronic
903308453 1:22432086-22432108 CATTACTCCCATTTTGCAGATGG + Intergenic
903588641 1:24437652-24437674 CAGGCCTCACCTTGGGCTGAAGG + Intronic
903667185 1:25015263-25015285 CAAGCCTCTCATTTTACAGGTGG + Intergenic
903853996 1:26325114-26325136 CACCCCTCACATTTTACAGATGG - Intronic
904541347 1:31235733-31235755 AATGCCTCCCATTTTACAGATGG + Intronic
904767170 1:32859148-32859170 TATGCCTCAGTTTTTGCAGAGGG + Intergenic
904812928 1:33175518-33175540 CACGCTCCCCATTTTGCAGATGG - Intronic
906709630 1:47919591-47919613 CAATCCTCTCATTTTACAGATGG - Intronic
909764564 1:79339365-79339387 CAGGCCTCCTATTATTCAGAAGG - Intergenic
912434574 1:109652020-109652042 AAGGCCACCCATTTTGTAGAAGG + Intergenic
913570712 1:120117360-120117382 CAGTCCTTGCATTTTACAGATGG + Intergenic
914291519 1:146278336-146278358 CAGTCCTTGCATTTTACAGATGG + Intergenic
914552563 1:148729119-148729141 CAGTCCTTGCATTTTACAGATGG + Intergenic
915496991 1:156288945-156288967 CAGGCTTCCCATTTTACAAAGGG + Intronic
916262483 1:162856043-162856065 CTGCCCTCACAATTTTCAGAAGG + Intronic
916716188 1:167448513-167448535 CTGGCCTCACATTTGGTAGCAGG - Intronic
917187156 1:172371202-172371224 CAGCCCTGACATTTTGCAACTGG - Intronic
917517586 1:175720971-175720993 CAACCCTCTCATTTTTCAGATGG + Intronic
920095135 1:203481833-203481855 CAGTCCTCAGTTTTTGCAAATGG + Intronic
920117350 1:203629979-203630001 CAGGCTTTCCATTGTGCAGAGGG - Intronic
922336450 1:224622395-224622417 CAGACATTACATTTTCCAGAAGG - Intronic
923820116 1:237429242-237429264 CAGGACCCCCATTTTACAGATGG + Intronic
924879402 1:248143441-248143463 CATGCATCACATTTTACTGAAGG - Intergenic
1065635583 10:27729874-27729896 CAGGGCTCAGATTCTCCAGATGG - Intronic
1065721892 10:28635599-28635621 CAGGGCACACATGGTGCAGATGG + Intergenic
1069729373 10:70601085-70601107 CAGCCCCCACATTGTACAGATGG + Intronic
1070681819 10:78454079-78454101 CATCCCTCCCATTTTGGAGAAGG + Intergenic
1072135506 10:92542064-92542086 CAGGCATCACACTATGCAAATGG + Intronic
1072243096 10:93515588-93515610 TAGGCCTGACATTTTCCAAAAGG + Intronic
1072337443 10:94411036-94411058 CATGCCTCTCATTTTACAGAGGG - Intronic
1072941270 10:99766324-99766346 CCTGCCTCACAGTTTGCAGCAGG - Intergenic
1073070685 10:100791309-100791331 CAGGCTTCACCTTTTTCAGGAGG + Intronic
1073204329 10:101760887-101760909 AAGGCCTCCCATGTAGCAGATGG - Intergenic
1074777206 10:116775231-116775253 CAGGACTCCCATTTTACAGATGG + Intergenic
1074832650 10:117260379-117260401 CTGGCCTCACCATTTGCAGGTGG + Intronic
1074970635 10:118533658-118533680 CAGTCCCCTCATTTTACAGAGGG - Intergenic
1076110556 10:127856155-127856177 CAGGCCCCACATTTGACAGAAGG + Intergenic
1076252540 10:128995687-128995709 CAGCCTTCCCATTTTCCAGATGG - Intergenic
1076682583 10:132181466-132181488 CAGCCCTCATATTTTACAGAGGG - Intronic
1077309131 11:1880776-1880798 CAGGCCTCCCATGTGGCAGGGGG - Intronic
1077580643 11:3415030-3415052 GAGGCGGCACATCTTGCAGATGG + Intergenic
1079278681 11:19067792-19067814 AAGGCATCCCATTTTACAGATGG - Intergenic
1080308007 11:30857717-30857739 CAGGCCTCTCATTTGTAAGAAGG + Intronic
1080395460 11:31886005-31886027 CAGGCCTCTCATTAGGCACATGG + Intronic
1081435843 11:43026679-43026701 CAGTCCTCCCAGTGTGCAGATGG + Intergenic
1081595865 11:44459086-44459108 CAGGGCAGACATTTTGGAGAGGG + Intergenic
1081789793 11:45774622-45774644 CAGGCTGCCCATTTTTCAGAGGG - Intergenic
1083332845 11:61906998-61907020 CAGGCCTCACATTTTGCAGATGG + Intronic
1084033529 11:66494509-66494531 CAGGAATCTCATTTTACAGATGG - Intronic
1085214935 11:74821296-74821318 AAGGCCTAACATAATGCAGAAGG - Intronic
1085387979 11:76168039-76168061 CAGCCCGCCCATTTTACAGATGG + Intergenic
1086595203 11:88562434-88562456 CAATCCTCCCATTTTTCAGATGG - Intronic
1086838041 11:91650623-91650645 CTGGCTCCTCATTTTGCAGAAGG - Intergenic
1087225379 11:95592824-95592846 CAGGCCAGAGGTTTTGCAGAGGG + Intergenic
1088368978 11:109067800-109067822 CAGGCTCCACATTTTGCTGAAGG - Intergenic
1090253161 11:125264869-125264891 CAGTCCTCCCATTTCACAGATGG - Intronic
1094248310 12:28328710-28328732 GAGGCATCACATTTTCCAAATGG + Intronic
1094371511 12:29743324-29743346 CATGCCTCAAATTTTACAGGTGG - Intronic
1095633201 12:44401817-44401839 CAGGCCTCACAATTTTCTCAGGG - Intergenic
1096880223 12:54661537-54661559 TAGGCCACACATTTAGCAGTTGG + Intergenic
1097648471 12:62264269-62264291 CAGGCCAGAAATTTTGCAGGTGG - Intronic
1102128997 12:110510240-110510262 CAGGGCTAACATTTTACAGAGGG - Intronic
1102554088 12:113714448-113714470 GAGGCCTCACATTTTAGAGTTGG + Intergenic
1102719998 12:115007804-115007826 CACTGCTCTCATTTTGCAGATGG - Intergenic
1102794273 12:115674901-115674923 CAGGCCTCTCATTTTTCAGATGG + Intergenic
1103523063 12:121549136-121549158 CAGGACCCACACTTTGTAGAAGG + Intronic
1104458668 12:128936051-128936073 CCTGCCTCACAGTTTGCAGCGGG + Intronic
1104832318 12:131761827-131761849 GAGGCTTCCCATTTTACAGATGG - Intronic
1108254576 13:48598186-48598208 AGGGCCCCACATTTTGGAGATGG + Intergenic
1111014457 13:82359939-82359961 CACACCTCACACTTAGCAGATGG + Intergenic
1114364653 14:22013399-22013421 CTGCCCTCACTTTCTGCAGAAGG - Intergenic
1114538133 14:23435932-23435954 CAGGCCTCACATTCCACAGCTGG + Intergenic
1118377315 14:65188385-65188407 AAGGCCTCAGATTTGGCTGAGGG + Intergenic
1120870891 14:89336572-89336594 CAGGTCACACAGCTTGCAGATGG - Intronic
1121184553 14:91955044-91955066 CAGAGCCCACATTTTGCACATGG - Intergenic
1122018610 14:98818375-98818397 TAACCCTCTCATTTTGCAGAAGG + Intergenic
1122052770 14:99071270-99071292 CAGGCCTCTCTTCTTGTAGATGG - Intergenic
1122330683 14:100910446-100910468 AAGGCCTCACAGTATGAAGAAGG + Intergenic
1122878593 14:104679883-104679905 CAGCATTCACACTTTGCAGAGGG - Intergenic
1124988874 15:34650912-34650934 CAGGCCCCACATTTTGCTGGTGG + Intergenic
1126303915 15:47232457-47232479 CAGGCCTCACACCTTGCTGATGG - Intronic
1126703715 15:51388519-51388541 CAGGCCTCACATTCTGCTTGGGG - Intronic
1126905681 15:53362324-53362346 CAAGCCCCTCATTTTGCAAATGG - Intergenic
1128374026 15:67063049-67063071 CAGCCCTCTCATTTTCCTGAGGG - Intergenic
1129232878 15:74206380-74206402 CGAGCCTCCCATTTTGCAGATGG - Intronic
1129703553 15:77781888-77781910 CAGGGCTACCATTTTGCAGATGG - Intronic
1131529334 15:93178804-93178826 CAGCCCTTTGATTTTGCAGATGG + Intergenic
1133810471 16:9157494-9157516 CAGGCTTCACATTTTCCTGCGGG - Intergenic
1133973228 16:10581428-10581450 CAGCCCTCCCAGTTTCCAGATGG - Intergenic
1134321553 16:13168790-13168812 AAGGCCACACAGTTGGCAGATGG - Intronic
1135049558 16:19181548-19181570 CAGCCCTCTCATTTTACAAATGG - Intronic
1135148550 16:19985158-19985180 TAGCCCTCTCATTTTGCAGTAGG + Intergenic
1135911477 16:26565517-26565539 CAGCCTTCCCATTTTGCAGATGG + Intergenic
1136588662 16:31203603-31203625 TAGGCCTCACATTTTAGAGAGGG - Intergenic
1137417812 16:48300873-48300895 CATCCCTCATATTTTACAGATGG - Intronic
1137924025 16:52522578-52522600 GAGGCCTTAGAGTTTGCAGAAGG - Intronic
1138098516 16:54232670-54232692 CAGGCCTCCCACTATGTAGATGG + Intergenic
1138121974 16:54407769-54407791 CAGGAATCTCATGTTGCAGATGG - Intergenic
1138936665 16:61734577-61734599 CAAGCCCCACCTTTTCCAGAAGG + Intronic
1139594764 16:67951130-67951152 CAGGGCTCACCTGTTACAGAAGG + Exonic
1140999841 16:80297906-80297928 TAATCCTCATATTTTGCAGATGG + Intergenic
1142140332 16:88469926-88469948 CAGCCCTCCCAGTCTGCAGAGGG + Intronic
1144707770 17:17380762-17380784 CAACCTCCACATTTTGCAGATGG - Intergenic
1145795454 17:27652982-27653004 GAGGCACCCCATTTTGCAGAGGG - Intergenic
1146555019 17:33815804-33815826 CAATCCTCTCATTTTACAGATGG + Intronic
1147322351 17:39653811-39653833 CAGCCCTCCCATGTGGCAGATGG - Intronic
1147378260 17:40035843-40035865 CAGGTCTCACATGAGGCAGACGG + Intronic
1147903712 17:43808666-43808688 CAGGTGTCACATTTTGCGGGAGG + Intronic
1147936463 17:44014240-44014262 CAGGCTTCACACTGTGCAGCTGG + Intronic
1148085511 17:44991425-44991447 CAGCTCTCTCATTTTACAGATGG - Intergenic
1148844787 17:50523262-50523284 CAGGCCACACATTTCACAGAAGG - Intronic
1149656060 17:58310155-58310177 CTTGCCTCACTTCTTGCAGAAGG - Exonic
1150337973 17:64343886-64343908 CAGGCCTGACATCAAGCAGAGGG - Intronic
1152629980 17:81406528-81406550 CAGGCCCCATCCTTTGCAGAAGG - Intronic
1153619627 18:6965114-6965136 CAGGATTCACATTTTGCTGGAGG - Intronic
1154979555 18:21491342-21491364 CAATTCTCTCATTTTGCAGATGG - Intronic
1156107251 18:33678411-33678433 CAGGACTCACATTTCCCAGAAGG - Intronic
1156507783 18:37609433-37609455 CAGGCCTCACAGGCTGCAGCTGG + Intergenic
1160068261 18:75598590-75598612 CAGGCTTCAGGTTTTGCACATGG - Intergenic
1161280051 19:3441175-3441197 CAGGCACCTCATTTTGCAGAGGG + Intronic
1161506314 19:4645772-4645794 CTGGTCACCCATTTTGCAGATGG + Intronic
1163622679 19:18370117-18370139 CAGGCCTCTGATTTTGAGGAAGG - Intergenic
1163687463 19:18719853-18719875 CAGGCCTGACATTTTCAAGATGG + Intronic
1166831843 19:45643920-45643942 TTGGCATCACGTTTTGCAGACGG + Intronic
1167825652 19:51970585-51970607 CAGGCCTCCTATTTTTCTGATGG + Intronic
1167896566 19:52586554-52586576 CAGTCCTGGCATTTTGTAGAAGG + Exonic
926048206 2:9725652-9725674 TAGGCCGCTCATTTTACAGATGG + Intergenic
927377172 2:22431655-22431677 CAGTCCGCCCATTTTTCAGATGG - Intergenic
928465258 2:31517581-31517603 CAGGCCTCACAGTAAGCACAAGG - Intergenic
929087213 2:38180528-38180550 CAGGCCTCACAGCTGGCATATGG + Intergenic
930323020 2:49879288-49879310 AAGGCCACCCATTTTGCAGAAGG + Intergenic
930725894 2:54681033-54681055 AAGACCTCATATTCTGCAGAAGG + Intergenic
931711400 2:64991230-64991252 CAGCCATCACATTTTCCAGAAGG - Intronic
932283967 2:70517424-70517446 CAGGTCTCTCACTTTGCAGGTGG + Intronic
933254395 2:80064185-80064207 CAGCCCTCACATTCTACTGAAGG - Intronic
933560911 2:83885096-83885118 AAGGCCACAGAATTTGCAGAAGG - Intergenic
933766736 2:85714357-85714379 CAATCCTGTCATTTTGCAGATGG + Intergenic
935316605 2:101841124-101841146 CATCACCCACATTTTGCAGATGG + Intronic
935711368 2:105902030-105902052 CAGGTCTGACAGTTCGCAGAGGG + Intergenic
938172175 2:129088846-129088868 CCAGCCTCACATTTTCCAGTTGG + Intergenic
940024658 2:149193138-149193160 CAGGCCTCTCACCTTCCAGATGG + Intronic
945570380 2:211459678-211459700 GAGGCCTCATATCATGCAGAAGG - Intronic
947212990 2:227724858-227724880 CAGGCCTAACATGTGGCAGGTGG + Intergenic
1169317165 20:4602314-4602336 CAAGCATCTCATTTTCCAGATGG + Intergenic
1169827432 20:9784659-9784681 CAAGCCTCAAATTTTGCAGGAGG + Intronic
1170198060 20:13711408-13711430 CAGGCCTCACATGTGACGGAGGG - Intergenic
1172186415 20:33033881-33033903 CAAGCCTCCCATTTTGTTGATGG + Intronic
1172211485 20:33201783-33201805 CAGGCCTCTCATTCTACACATGG - Intergenic
1172304532 20:33871678-33871700 CAGCCCACACAGTTGGCAGAGGG - Intergenic
1172572381 20:35980712-35980734 CATGGCTGACATTATGCAGAGGG - Intronic
1173256664 20:41398609-41398631 CAGCCCTGACATTTTCCAGCTGG + Intergenic
1173439768 20:43065853-43065875 CAGACCTCTCATTTTACAGTTGG + Intronic
1173608830 20:44351812-44351834 CAGGCCCCCCTTTTTACAGATGG + Intergenic
1173642860 20:44615812-44615834 CAGCCCTCTCATGTTACAGATGG + Intronic
1173686146 20:44924621-44924643 CAGCCCTCTCACTTTCCAGATGG - Intronic
1174279467 20:49428293-49428315 CAGCCCACCCATTTTACAGATGG + Intronic
1175362978 20:58429315-58429337 CAGTCCTCCGCTTTTGCAGAAGG + Intronic
1178586150 21:33873094-33873116 GAGGCCTCAGATTTTCCAAAAGG + Intronic
1179902082 21:44399601-44399623 CTGGCCTCCCATTTTGCAGATGG + Intronic
1180252838 21:46601023-46601045 CAGGCCTGAAACTTTGCAGAGGG - Intronic
1180729349 22:17970034-17970056 CAGGATTCACAGTGTGCAGAGGG + Intronic
1180854849 22:19039266-19039288 CGGGCCTCAGATTTTGAAGGAGG + Intronic
1181530042 22:23512161-23512183 CATTGCTCCCATTTTGCAGATGG + Intergenic
1181987857 22:26813573-26813595 CATCCCTCTCATTTTACAGATGG + Intergenic
1182963655 22:34501704-34501726 AGGGCCTCACTTTTTACAGAAGG + Intergenic
1183649896 22:39147781-39147803 CAGTCCTCTGATTTTTCAGATGG - Intronic
1184478261 22:44733244-44733266 CAGGCACCACACTTTGCAGTTGG + Intronic
1184583222 22:45430804-45430826 CTGGCCTCTCATTCTACAGATGG - Intronic
1185058479 22:48593297-48593319 CAGCCCCTCCATTTTGCAGATGG + Intronic
950082859 3:10235736-10235758 CAAGCCTCCCATTTTACAGAAGG + Intronic
950190154 3:10970948-10970970 AATGCCTGCCATTTTGCAGATGG + Intergenic
950389860 3:12688067-12688089 TAGCCCCCACATTTGGCAGATGG + Intergenic
952568723 3:34687340-34687362 TAGGCCCCACATTTTGGAGGAGG - Intergenic
953703125 3:45211894-45211916 CAGCCTTGACATTTTACAGATGG - Intergenic
954396363 3:50295469-50295491 CGGGCCTCACAGTGTGCTGAGGG + Exonic
955921735 3:63964321-63964343 GAGGCCTCACATTTTGCACAGGG - Intronic
956825689 3:72995529-72995551 CAGCCCTGACATTTTACAAATGG - Intronic
958616597 3:96501135-96501157 GAGTCCTCACTTTTTTCAGAGGG + Intergenic
958804828 3:98797632-98797654 CACGCCTCAAAGTTTGGAGAAGG + Exonic
959344051 3:105170533-105170555 CAGGCCAATCATTGTGCAGAGGG + Intergenic
960785863 3:121372303-121372325 CAGGCCTCACAGTTTCCCTAGGG + Intronic
962417242 3:135194168-135194190 CAGGCCCCACATTTTGATGAAGG + Intronic
967120886 3:186381865-186381887 CACACCTCACATTTTGAAGGAGG + Intergenic
967404176 3:189098454-189098476 CAGCCATCTCATTTTGCAGAAGG - Intronic
967492650 3:190111434-190111456 CAGGCATCCCATTTTACAGATGG - Intronic
967592263 3:191292204-191292226 CAGGCATAACATTTTTAAGATGG - Intronic
969316053 4:6381850-6381872 CAGGCCCCACTTTTTGCATGTGG + Exonic
969375611 4:6761485-6761507 CAGCCCTCTCCTTTTTCAGATGG - Intergenic
971539092 4:27792552-27792574 CAGGACTGACCTTTTGCAAATGG - Intergenic
972670501 4:41210308-41210330 CAGCTCTCTCATTTTACAGATGG + Intronic
973180316 4:47259202-47259224 CAGCCTTCACATTGTGCAGAAGG + Intronic
974131390 4:57760702-57760724 CAGGCCTCTCATTTTTCAGTTGG - Intergenic
975328974 4:73092002-73092024 CAGGCCTCACATTATTCACTGGG + Exonic
984412687 4:179414869-179414891 CAGGAATCCCATTTTACAGAAGG - Intergenic
985220143 4:187695706-187695728 GAGGCCTCACACATGGCAGAAGG - Intergenic
985599524 5:819464-819486 CAGACCACACATTCTGCACATGG + Intronic
985719846 5:1483087-1483109 CAAACCTGACATTTTGGAGAGGG - Intronic
986776891 5:11023943-11023965 CTGTTCTCACATTTTTCAGATGG + Intronic
990173409 5:53080691-53080713 CATGTCTGACATTTTACAGATGG + Intronic
990606086 5:57411417-57411439 TAGGGCTCCCATTATGCAGAAGG - Intergenic
990773126 5:59273240-59273262 CAGGCCTCAAATTGCTCAGAGGG - Intronic
991550022 5:67825703-67825725 CAGTACTCACATCTTGCAGGTGG - Intergenic
993514603 5:88814969-88814991 CAGGCTTCACATTTTTTATATGG + Intronic
997409647 5:133681265-133681287 CAGGCCTCACATTATTTAGGGGG - Intergenic
997472958 5:134126943-134126965 GTGGCCTCCCTTTTTGCAGATGG + Intronic
999370357 5:151051519-151051541 CAGACCTCTCACTGTGCAGAGGG - Intronic
999371863 5:151060574-151060596 ATGACCTCACATTATGCAGAGGG - Intronic
999448289 5:151659007-151659029 CAGCCCTCTCATTTCCCAGATGG - Intergenic
1000448213 5:161350960-161350982 CTGGCTTCTCATCTTGCAGACGG + Intronic
1000453548 5:161420559-161420581 CTGGCCACACGTTTTGCAGAGGG - Intronic
1000870034 5:166564796-166564818 CAGGCCTGACAATGTCCAGAAGG + Intergenic
1001070930 5:168584509-168584531 CAGTCATCTCATTTTGCAGATGG - Intergenic
1001197279 5:169685118-169685140 CAGCACTCGCATTATGCAGATGG - Intronic
1001241763 5:170076696-170076718 CAGCCTTCCCATTTTACAGATGG + Intronic
1001268649 5:170294040-170294062 TAACCCTCACATTTTGCAGATGG + Intronic
1002962462 6:1928481-1928503 CAAGCCTCATATTTTTCAGTAGG + Intronic
1004321000 6:14631425-14631447 CAGGTCTCACATATTGTAAATGG + Intergenic
1005494192 6:26374593-26374615 CAAGCCTGACATTTTTGAGAAGG + Intronic
1006435790 6:34025609-34025631 CACGGCTCCCATTTTCCAGATGG - Intronic
1006465186 6:34189729-34189751 CAGGACTCAGGTTTTGCCGAGGG - Intergenic
1013235889 6:108197709-108197731 AAGGGCCCACATTTTGCAGCTGG + Intergenic
1013489405 6:110630622-110630644 CTTCCCTCACCTTTTGCAGACGG + Intronic
1015161870 6:130161692-130161714 CATGCCTCACACTTTACTGATGG + Intronic
1015185174 6:130408011-130408033 CATGCCCCACATTTTGCAGGTGG - Intronic
1015681305 6:135811808-135811830 CAGGCCTCTGACTCTGCAGAGGG - Intergenic
1015792283 6:136975723-136975745 CACTCCTCTCATTTTTCAGAGGG - Intergenic
1016301516 6:142636868-142636890 GTGTCCTCACATTTTGCAGAAGG - Intergenic
1018358520 6:163042158-163042180 CTGGCCACACATATTGCAGCTGG + Intronic
1018388471 6:163325627-163325649 CCTCCCTCCCATTTTGCAGATGG - Intergenic
1020228647 7:6299893-6299915 GAGGCCTCATATGTTGCTGAAGG + Intergenic
1021219430 7:17958903-17958925 CAGGTTTCACATTTGGAAGAGGG - Intergenic
1021919445 7:25469697-25469719 CAGGCCATACACTTTACAGAAGG - Intergenic
1022588042 7:31634562-31634584 CAGGCTTCAAATTTTCTAGATGG + Intronic
1026550542 7:71364686-71364708 CAGGACACTCATTTTGAAGAAGG + Intronic
1029355442 7:100048429-100048451 CAGGGTTCCCATTATGCAGATGG - Intergenic
1030653090 7:112136815-112136837 GAGGGCTGACATTTTCCAGAAGG + Intronic
1031520930 7:122764881-122764903 TAGGCTTCAGATTTTGTAGATGG - Intronic
1033650112 7:143335366-143335388 CAAGCCTAACAGTTTGCAGCAGG + Intronic
1035777111 8:2196557-2196579 CAGGCTTCTCAGCTTGCAGACGG - Intergenic
1037785206 8:21898863-21898885 CAGGCCTATCATTCTGCAGATGG + Intergenic
1037914032 8:22761186-22761208 CAGCCATCACATCTTGCAGGTGG + Intronic
1040572175 8:48620834-48620856 CCGGCCTCACATACTGCAGACGG + Intergenic
1041952668 8:63521628-63521650 CAGGCCTCACTTGTTCCAGTGGG - Intergenic
1042406151 8:68407686-68407708 AAGGCCTAACATTTTTAAGAAGG - Intronic
1043947552 8:86271587-86271609 CAGGAGTCACATACTGCAGAAGG + Intronic
1046820747 8:118631861-118631883 GAGGCTTCACTTTTTGAAGAGGG + Intergenic
1047501319 8:125443968-125443990 CACTCCTCCCATTTTACAGATGG + Intergenic
1049098717 8:140564074-140564096 CTGCCCTCATCTTTTGCAGATGG - Intronic
1049783855 8:144441169-144441191 CAGGGCTCACAGCTTGCAGGTGG - Intronic
1052296656 9:26903812-26903834 CACCCCTTACATTTTGAAGAGGG + Intergenic
1053318439 9:37073232-37073254 CAACTCTCTCATTTTGCAGAAGG - Intergenic
1053322510 9:37112619-37112641 CAACTCTCTCATTTTGCAGAAGG - Intergenic
1057146598 9:92763465-92763487 CTGCACTCCCATTTTGCAGAGGG + Intronic
1057743584 9:97733802-97733824 CAGGCCCCACATCTTGAAAATGG + Intergenic
1058355818 9:104082619-104082641 CTGGCCTCTCAGCTTGCAGATGG - Intergenic
1059612289 9:115911569-115911591 GAGGCCTCTCATTTTAGAGATGG - Intergenic
1059969325 9:119648821-119648843 CTGGCCTCTCATTTTGCAGATGG + Intergenic
1060073785 9:120573873-120573895 CAACCATCACCTTTTGCAGATGG + Intronic
1061709833 9:132480088-132480110 CAGCCCCCTCATTTTGCAGATGG + Intronic
1061895150 9:133643305-133643327 CATCCCTCCCATTTTACAGATGG + Intronic
1185969183 X:4642914-4642936 CAGGCCTCACCTTCAGCACATGG - Intergenic
1186086884 X:6000391-6000413 CATGCCTCAAATCCTGCAGAGGG - Intronic
1187941096 X:24382475-24382497 CAGTCCTCACATGTCGCAGGAGG + Intergenic
1191811635 X:65195957-65195979 CAAGCCTCACTTTTTGATGAGGG + Intergenic
1194495108 X:94606153-94606175 GAGAACTCACATTTTGCAAATGG - Intergenic
1196002808 X:110804829-110804851 CAGGTCTTACATTTTACAGACGG - Intergenic
1196111582 X:111952345-111952367 CAGCCCTCACAATTTGCAGGGGG + Exonic
1196916068 X:120536273-120536295 AAAGGCTCACATTTGGCAGATGG - Intronic
1196995654 X:121380362-121380384 CATGCTTCTCATTTTACAGAGGG - Intergenic
1198055184 X:132987149-132987171 CAAACCACACATTTTACAGATGG - Intergenic
1198118133 X:133564378-133564400 CAAGCCTCAAATTTTGATGAGGG - Intronic
1199569721 X:149255276-149255298 CTGGCCTCACTGTTCGCAGAGGG - Intergenic
1201533847 Y:15023508-15023530 CAGGACTGCCATGTTGCAGACGG - Intergenic