ID: 1083332846

View in Genome Browser
Species Human (GRCh38)
Location 11:61906999-61907021
Sequence AGGCCTCACATTTTGCAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 253
Summary {0: 1, 1: 0, 2: 5, 3: 24, 4: 223}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083332835_1083332846 3 Left 1083332835 11:61906973-61906995 CCGCCCCCAGGAGCCAGGAAAGG 0: 1
1: 0
2: 2
3: 37
4: 417
Right 1083332846 11:61906999-61907021 AGGCCTCACATTTTGCAGATGGG 0: 1
1: 0
2: 5
3: 24
4: 223
1083332831_1083332846 21 Left 1083332831 11:61906955-61906977 CCCATGAGAGTTCTGGGACCGCC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1083332846 11:61906999-61907021 AGGCCTCACATTTTGCAGATGGG 0: 1
1: 0
2: 5
3: 24
4: 223
1083332837_1083332846 0 Left 1083332837 11:61906976-61906998 CCCCCAGGAGCCAGGAAAGGCCC 0: 1
1: 1
2: 9
3: 66
4: 475
Right 1083332846 11:61906999-61907021 AGGCCTCACATTTTGCAGATGGG 0: 1
1: 0
2: 5
3: 24
4: 223
1083332840_1083332846 -3 Left 1083332840 11:61906979-61907001 CCAGGAGCCAGGAAAGGCCCAGG 0: 1
1: 0
2: 5
3: 78
4: 628
Right 1083332846 11:61906999-61907021 AGGCCTCACATTTTGCAGATGGG 0: 1
1: 0
2: 5
3: 24
4: 223
1083332838_1083332846 -1 Left 1083332838 11:61906977-61906999 CCCCAGGAGCCAGGAAAGGCCCA 0: 1
1: 2
2: 4
3: 47
4: 394
Right 1083332846 11:61906999-61907021 AGGCCTCACATTTTGCAGATGGG 0: 1
1: 0
2: 5
3: 24
4: 223
1083332842_1083332846 -10 Left 1083332842 11:61906986-61907008 CCAGGAAAGGCCCAGGCCTCACA 0: 1
1: 0
2: 1
3: 33
4: 262
Right 1083332846 11:61906999-61907021 AGGCCTCACATTTTGCAGATGGG 0: 1
1: 0
2: 5
3: 24
4: 223
1083332839_1083332846 -2 Left 1083332839 11:61906978-61907000 CCCAGGAGCCAGGAAAGGCCCAG 0: 1
1: 0
2: 6
3: 67
4: 524
Right 1083332846 11:61906999-61907021 AGGCCTCACATTTTGCAGATGGG 0: 1
1: 0
2: 5
3: 24
4: 223
1083332832_1083332846 20 Left 1083332832 11:61906956-61906978 CCATGAGAGTTCTGGGACCGCCC 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1083332846 11:61906999-61907021 AGGCCTCACATTTTGCAGATGGG 0: 1
1: 0
2: 5
3: 24
4: 223
1083332830_1083332846 24 Left 1083332830 11:61906952-61906974 CCTCCCATGAGAGTTCTGGGACC 0: 1
1: 0
2: 2
3: 11
4: 121
Right 1083332846 11:61906999-61907021 AGGCCTCACATTTTGCAGATGGG 0: 1
1: 0
2: 5
3: 24
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083332846 Original CRISPR AGGCCTCACATTTTGCAGAT GGG Intronic
901791614 1:11656246-11656268 AGTGCACACATTTTTCAGATGGG + Intronic
901872985 1:12149102-12149124 AAGCCTCCCATTTTACAGATGGG + Intergenic
902398420 1:16144689-16144711 AGCCCACTCATTTTACAGATGGG + Intronic
902400716 1:16155402-16155424 AGGCCTCGCATTTTGGGGAGGGG - Intronic
902586703 1:17443785-17443807 AGGCCACACAGCTGGCAGATAGG + Intergenic
902924443 1:19686816-19686838 ATGACTCTCATTTTACAGATGGG - Intronic
903371494 1:22839035-22839057 AGTCTGCTCATTTTGCAGATAGG + Intronic
903660486 1:24974203-24974225 AGGCCTCACATGCTGAAGCTTGG - Intergenic
903667186 1:25015264-25015286 AAGCCTCTCATTTTACAGGTGGG + Intergenic
903853995 1:26325113-26325135 ACCCCTCACATTTTACAGATGGG - Intronic
904767171 1:32859149-32859171 ATGCCTCAGTTTTTGCAGAGGGG + Intergenic
904812927 1:33175517-33175539 ACGCTCCCCATTTTGCAGATGGG - Intronic
906709629 1:47919590-47919612 AATCCTCTCATTTTACAGATGGG - Intronic
909135701 1:71797419-71797441 AGGCCACAGAATTTGCAGTTAGG + Intronic
913380219 1:118202398-118202420 AGGTCTCACCTTTTGGGGATTGG + Intergenic
915257035 1:154641343-154641365 AGGCCTCACAGTATGGAGAAAGG + Intergenic
915782714 1:158570641-158570663 AGGGCTGAGGTTTTGCAGATGGG + Intergenic
917187155 1:172371201-172371223 AGCCCTGACATTTTGCAACTGGG - Intronic
920750091 1:208666052-208666074 AGCCCCCTCATTTTGCAGATTGG + Intergenic
920875714 1:209833591-209833613 AGGCCTCACATTTTCATTATTGG + Intronic
923820117 1:237429243-237429265 AGGACCCCCATTTTACAGATGGG + Intronic
924321689 1:242857272-242857294 ATACCCCACATTTTGCAGAGAGG - Intergenic
924742389 1:246802671-246802693 AGGCCTGACAGTGTGCAGATAGG + Intergenic
1064509553 10:16074870-16074892 AGAAGACACATTTTGCAGATAGG + Intergenic
1065836954 10:29667009-29667031 AGCGCTCACATTTTGCTGGTTGG + Intronic
1067219522 10:44333970-44333992 AAGCCTGACATTTTTCAGAAAGG + Intergenic
1068388267 10:56359932-56359954 AGGTCTCCCATTTGGCTGATGGG - Intronic
1068858473 10:61822095-61822117 AAGCCCTTCATTTTGCAGATAGG + Intergenic
1068902357 10:62282284-62282306 AGGTCTCACGTTTTCCAGACTGG + Intergenic
1069522835 10:69139192-69139214 AGGCCTAAGTTTTTGCATATTGG + Intronic
1069729374 10:70601086-70601108 AGCCCCCACATTGTACAGATGGG + Intronic
1069775353 10:70923981-70924003 AGGTCTCTCATTGTACAGATGGG + Intergenic
1070823418 10:79376210-79376232 AGGATTCCCATTTTACAGATGGG - Intergenic
1072215867 10:93286611-93286633 AGGCCTCACATTGGGTAGGTAGG + Intergenic
1076167898 10:128297062-128297084 TGAACTCTCATTTTGCAGATGGG - Intergenic
1076252539 10:128995686-128995708 AGCCTTCCCATTTTCCAGATGGG - Intergenic
1076723221 10:132401769-132401791 AGTCTTCCCATTTCGCAGATTGG - Intronic
1079278680 11:19067791-19067813 AGGCATCCCATTTTACAGATGGG - Intergenic
1080958132 11:37125448-37125470 AGGCCAAACATTTTCCACATTGG - Intergenic
1081434769 11:43015049-43015071 AGGCATAAAATTGTGCAGATAGG + Intergenic
1081435844 11:43026680-43026702 AGTCCTCCCAGTGTGCAGATGGG + Intergenic
1083031210 11:59594162-59594184 AATTCTCACATTTTGCAGCTCGG + Exonic
1083332846 11:61906999-61907021 AGGCCTCACATTTTGCAGATGGG + Intronic
1083603315 11:63962051-63962073 AGCGCCCCCATTTTGCAGATGGG + Intergenic
1084033528 11:66494508-66494530 AGGAATCTCATTTTACAGATGGG - Intronic
1086595202 11:88562433-88562455 AATCCTCCCATTTTTCAGATGGG - Intronic
1087125674 11:94623494-94623516 AGCCCTCTCATATTACAGATTGG - Intergenic
1088819434 11:113444861-113444883 AGGGTGCACATTTTGCAGAGAGG + Intronic
1088902838 11:114131508-114131530 AAGCCTGCCAGTTTGCAGATAGG + Intronic
1089015455 11:115161676-115161698 AGGCCAAAGATTTTGCAAATAGG - Intergenic
1090253160 11:125264868-125264890 AGTCCTCCCATTTCACAGATGGG - Intronic
1090867188 11:130711453-130711475 TGGGCTCACATCTTGCAGAATGG + Intronic
1092863011 12:12735744-12735766 AGGCCTCACATTGTCCAGGCAGG - Intronic
1093058845 12:14582010-14582032 AGGCCTCAAATTTTAAAAATAGG - Intergenic
1093970864 12:25374777-25374799 TGCACTCCCATTTTGCAGATTGG + Intergenic
1096880224 12:54661538-54661560 AGGCCACACATTTAGCAGTTGGG + Intergenic
1099839046 12:87943104-87943126 AAGCCACATATTTTGAAGATGGG - Intergenic
1100532893 12:95476973-95476995 AGCCATCTCATTTTACAGATAGG + Intronic
1101300535 12:103475408-103475430 GGGCCTCACATTTTGTTGGTTGG - Intronic
1101317083 12:103639095-103639117 AAGACCCTCATTTTGCAGATGGG - Intronic
1102128996 12:110510239-110510261 AGGGCTAACATTTTACAGAGGGG - Intronic
1102794274 12:115674902-115674924 AGGCCTCTCATTTTTCAGATGGG + Intergenic
1103577328 12:121887982-121888004 TGGCCTCACATTTTGCTAGTTGG + Intergenic
1104832317 12:131761826-131761848 AGGCTTCCCATTTTACAGATGGG - Intronic
1110295723 13:73862340-73862362 ATGAATCACATTTTACAGATAGG + Intronic
1118377316 14:65188386-65188408 AGGCCTCAGATTTGGCTGAGGGG + Intergenic
1121074337 14:91055146-91055168 AGGCCTCATAAATTGCTGATGGG + Intronic
1121208908 14:92191726-92191748 AGGCCACACGGTTGGCAGATTGG + Intergenic
1121323061 14:93003913-93003935 AGCCCACACATCTTACAGATGGG - Intronic
1121879970 14:97491171-97491193 AGGAGTCTCATTTTGCATATAGG - Intergenic
1122018611 14:98818376-98818398 AACCCTCTCATTTTGCAGAAGGG + Intergenic
1124714178 15:32043602-32043624 AGTCCTCACATTGTACAGAAAGG - Intronic
1125363100 15:38885423-38885445 AGGGCTCCCATTGTGCAGCTGGG - Intergenic
1125937308 15:43648526-43648548 AAGCCTGACATTTTGAAAATGGG + Intronic
1125950211 15:43745945-43745967 AAGCCTGACATTTTGAAAATGGG + Intergenic
1126303914 15:47232456-47232478 AGGCCTCACACCTTGCTGATGGG - Intronic
1127418103 15:58776905-58776927 AAGCCTCATATTTTTCAGTTTGG + Intronic
1128062946 15:64746793-64746815 ATCCCTCTCATTTTACAGATGGG + Intronic
1128526125 15:68413638-68413660 GAGCCTCTCATTTTACAGATGGG - Intronic
1129232877 15:74206379-74206401 GAGCCTCCCATTTTGCAGATGGG - Intronic
1129618967 15:77125723-77125745 AGTCCTCACATTTTGTACCTAGG + Intronic
1129703552 15:77781887-77781909 AGGGCTACCATTTTGCAGATGGG - Intronic
1132318418 15:100907618-100907640 AGTATCCACATTTTGCAGATGGG - Intronic
1133973227 16:10581427-10581449 AGCCCTCCCAGTTTCCAGATGGG - Intergenic
1134822952 16:17261379-17261401 ATGACTTTCATTTTGCAGATGGG + Intronic
1135049557 16:19181547-19181569 AGCCCTCTCATTTTACAAATGGG - Intronic
1135148551 16:19985159-19985181 AGCCCTCTCATTTTGCAGTAGGG + Intergenic
1135205095 16:20477020-20477042 AGGCCTTACAGATTGCATATTGG + Intronic
1136032788 16:27515726-27515748 TGTCATCCCATTTTGCAGATCGG - Intronic
1137417811 16:48300872-48300894 ATCCCTCATATTTTACAGATGGG - Intronic
1138098517 16:54232671-54232693 AGGCCTCCCACTATGTAGATGGG + Intergenic
1138121973 16:54407768-54407790 AGGAATCTCATGTTGCAGATGGG - Intergenic
1140259784 16:73367727-73367749 ATGCCACCCATTTTACAGATGGG - Intergenic
1144058724 17:11562678-11562700 AAGCCCCTCATTTTACAGATGGG - Exonic
1144707769 17:17380761-17380783 AACCTCCACATTTTGCAGATGGG - Intergenic
1146555020 17:33815805-33815827 AATCCTCTCATTTTACAGATGGG + Intronic
1148903037 17:50893089-50893111 AGCCCTCAGCTTTTGCAGAGTGG + Intergenic
1154979554 18:21491341-21491363 AATTCTCTCATTTTGCAGATGGG - Intronic
1155421044 18:25656389-25656411 AGGCCTATCACTTTGCATATTGG + Intergenic
1155780593 18:29828093-29828115 AGACACCACATTTAGCAGATTGG + Intergenic
1156107250 18:33678410-33678432 AGGACTCACATTTCCCAGAAGGG - Intronic
1158437521 18:57443692-57443714 ATGCCTGACATGGTGCAGATGGG + Intronic
1158526722 18:58221140-58221162 AGGCCCCACACTCGGCAGATGGG - Intronic
1161360653 19:3847655-3847677 AGGCCTCACCTTTTGAAGGAAGG + Intronic
1161506315 19:4645773-4645795 TGGTCACCCATTTTGCAGATGGG + Intronic
1163089756 19:15011425-15011447 AGGCCTCAGTCTTTGCAGTTAGG - Intronic
1163433134 19:17280262-17280284 GATTCTCACATTTTGCAGATGGG + Intronic
1163687464 19:18719854-18719876 AGGCCTGACATTTTCAAGATGGG + Intronic
1166831844 19:45643921-45643943 TGGCATCACGTTTTGCAGACGGG + Intronic
1167201333 19:48067592-48067614 AGGCCACACATTTTTCAGTATGG + Intronic
926048207 2:9725653-9725675 AGGCCGCTCATTTTACAGATGGG + Intergenic
926772879 2:16393786-16393808 AGGCCACACAATTTCCAGATAGG - Intergenic
927377171 2:22431654-22431676 AGTCCGCCCATTTTTCAGATGGG - Intergenic
927815253 2:26210226-26210248 AACCCTCTCATTTTACAGATTGG + Intronic
931982395 2:67707865-67707887 GGGTTTCATATTTTGCAGATAGG + Intergenic
933766737 2:85714358-85714380 AATCCTGTCATTTTGCAGATGGG + Intergenic
935672347 2:105566572-105566594 AGGCCTCAGCGTTTTCAGATTGG + Intergenic
941905533 2:170714515-170714537 AGGCCACAACTTTTGCAGAGTGG - Exonic
942130016 2:172869146-172869168 AGTCTTCATATTTTACAGATAGG - Intronic
946489677 2:220135601-220135623 AGGACTGATATTTTGCATATTGG - Intergenic
948370424 2:237486249-237486271 ATTCCTATCATTTTGCAGATAGG + Intronic
948894203 2:240920769-240920791 AGGCCTCCCATTGTGTAGACAGG + Intronic
1172009932 20:31840907-31840929 AGGGTCCACATTTTACAGATGGG + Intergenic
1172186416 20:33033882-33033904 AAGCCTCCCATTTTGTTGATGGG + Intronic
1172211484 20:33201782-33201804 AGGCCTCTCATTCTACACATGGG - Intergenic
1172430350 20:34885449-34885471 ACTCCTCTCATTTTACAGATGGG - Intronic
1173439769 20:43065854-43065876 AGACCTCTCATTTTACAGTTGGG + Intronic
1173608831 20:44351813-44351835 AGGCCCCCCTTTTTACAGATGGG + Intergenic
1173686145 20:44924620-44924642 AGCCCTCTCACTTTCCAGATGGG - Intronic
1176264243 20:64200486-64200508 AGTCCTCTCATTTTCCTGATTGG - Intronic
1177026971 21:15932405-15932427 CCGCCTCATATTTTCCAGATTGG - Intergenic
1179902083 21:44399602-44399624 TGGCCTCCCATTTTGCAGATGGG + Intronic
1181530043 22:23512162-23512184 ATTGCTCCCATTTTGCAGATGGG + Intergenic
1181775852 22:25159667-25159689 AAGCTTCCCATTTTACAGATAGG + Intronic
1182079829 22:27521132-27521154 AGTCCTCCCATTCTGCAGCTGGG + Intergenic
1182963656 22:34501705-34501727 GGGCCTCACTTTTTACAGAAGGG + Intergenic
1183159969 22:36106328-36106350 ATACCTCTCATTTTTCAGATGGG + Intergenic
1183324559 22:37184300-37184322 ATTCCTCCCACTTTGCAGATGGG - Intronic
1183649895 22:39147780-39147802 AGTCCTCTGATTTTTCAGATGGG - Intronic
1184583221 22:45430803-45430825 TGGCCTCTCATTCTACAGATGGG - Intronic
1185058480 22:48593298-48593320 AGCCCCTCCATTTTGCAGATGGG + Intronic
949761521 3:7476186-7476208 ATTACTCCCATTTTGCAGATGGG - Intronic
950082860 3:10235737-10235759 AAGCCTCCCATTTTACAGAAGGG + Intronic
950389861 3:12688068-12688090 AGCCCCCACATTTGGCAGATGGG + Intergenic
952568722 3:34687339-34687361 AGGCCCCACATTTTGGAGGAGGG - Intergenic
952890232 3:38035009-38035031 AACTCTCACATTTTGCAAATGGG + Intergenic
952936355 3:38401386-38401408 AGACCTCACTTGTTGCAGGTTGG + Intronic
953251025 3:41245992-41246014 AGCCTTTTCATTTTGCAGATGGG + Intronic
954066750 3:48112773-48112795 AAGCGTTTCATTTTGCAGATTGG + Intergenic
954413729 3:50382771-50382793 AAGCCTGTCATTATGCAGATGGG - Intronic
955520557 3:59771540-59771562 TCGCCTCCCACTTTGCAGATGGG + Intronic
955921734 3:63964320-63964342 AGGCCTCACATTTTGCACAGGGG - Intronic
956027238 3:64996281-64996303 AGGCCTCACTTTTCACAGCTTGG - Intergenic
956825688 3:72995528-72995550 AGCCCTGACATTTTACAAATGGG - Intronic
962093478 3:132269617-132269639 AGGCATCACATAGTTCAGATAGG - Intronic
962417243 3:135194169-135194191 AGGCCCCACATTTTGATGAAGGG + Intronic
965430997 3:168588487-168588509 AGCCCTCTCATCTTGTAGATTGG + Intergenic
967316366 3:188154612-188154634 AGTCCTCCCATTTTACAGTTGGG + Intronic
967477462 3:189938272-189938294 AAGCCTAACAGTTTGCAGAGTGG + Intergenic
968888735 4:3354063-3354085 ATGGCTCACATTTTTCAAATTGG + Intronic
969316054 4:6381851-6381873 AGGCCCCACTTTTTGCATGTGGG + Exonic
969375610 4:6761484-6761506 AGCCCTCTCCTTTTTCAGATGGG - Intergenic
970764753 4:19534229-19534251 AGGCCTAATATTCTGCAGCTGGG + Intergenic
971357195 4:25905868-25905890 AGACGTCTCATTTTCCAGATTGG - Intronic
972670502 4:41210309-41210331 AGCTCTCTCATTTTACAGATGGG + Intronic
973755264 4:54067687-54067709 AGGCCTGACATTATCCAGTTTGG - Intronic
974534954 4:63162876-63162898 ATGATTCACATTTTGCATATTGG + Intergenic
975376481 4:73652039-73652061 TGGCCTAAAATGTTGCAGATGGG - Intergenic
978265568 4:106820366-106820388 AAGCCTCATATTTTGCTGGTGGG - Intergenic
980091908 4:128451637-128451659 AGTCCTCTCATTTCACAGATGGG + Intergenic
982397090 4:154924554-154924576 AGGCCTGACATTTTCCAACTTGG + Intergenic
983769546 4:171532269-171532291 AGGCCTGACATTTTGCAATTTGG - Intergenic
984856229 4:184198392-184198414 AGGGCTCCCATTTCGCAGGTGGG - Intronic
988247093 5:28700559-28700581 AGGCCTCATTTTTTGTAGCTTGG + Intergenic
989686996 5:44101066-44101088 AGGGCTAAAATTTTCCAGATTGG + Intergenic
990173410 5:53080692-53080714 ATGTCTGACATTTTACAGATGGG + Intronic
991550021 5:67825702-67825724 AGTACTCACATCTTGCAGGTGGG - Intergenic
992834436 5:80626039-80626061 AAGTCTCACTTTTTCCAGATTGG - Intergenic
992879383 5:81091146-81091168 ATGCCTCCCATTTCACAGATGGG - Intronic
993514604 5:88814970-88814992 AGGCTTCACATTTTTTATATGGG + Intronic
994758339 5:103821811-103821833 AGGCTTCACCTTTTGAAGAAAGG + Intergenic
996549897 5:124719392-124719414 AGGCCACACATTTCGCAGTGTGG - Intronic
997472959 5:134126944-134126966 TGGCCTCCCTTTTTGCAGATGGG + Intronic
997587688 5:135053320-135053342 GGGCCCCAGATTTTGAAGATGGG + Intronic
999121520 5:149213183-149213205 AAGCCTCACGTTTTTAAGATTGG - Intronic
999448288 5:151659006-151659028 AGCCCTCTCATTTCCCAGATGGG - Intergenic
999504670 5:152182306-152182328 AGGACATCCATTTTGCAGATAGG - Intergenic
999976773 5:156919666-156919688 AAGCTCCACATTTTACAGATGGG + Intronic
1000164308 5:158632898-158632920 ATAACTCTCATTTTGCAGATGGG - Intergenic
1000707685 5:164531685-164531707 AGGCATCAAATTTTGCATAATGG + Intergenic
1001070929 5:168584508-168584530 AGTCATCTCATTTTGCAGATGGG - Intergenic
1001197278 5:169685117-169685139 AGCACTCGCATTATGCAGATGGG - Intronic
1001256106 5:170184455-170184477 ATGCTTCCCATTTTACAGATAGG - Intergenic
1001268650 5:170294041-170294063 AACCCTCACATTTTGCAGATGGG + Intronic
1001743753 5:174074213-174074235 TCGCCACCCATTTTGCAGATTGG - Intronic
1003674400 6:8189717-8189739 AGCCCTGACTTTTTGCAGCTTGG + Intergenic
1004234943 6:13866804-13866826 ACCACTCCCATTTTGCAGATGGG - Intergenic
1006039612 6:31243649-31243671 AAGCCTCACATTTTGCCCAAAGG + Intergenic
1008130372 6:47714159-47714181 AAGACTCACATTTTGCAAGTGGG - Exonic
1015161871 6:130161693-130161715 ATGCCTCACACTTTACTGATGGG + Intronic
1018231833 6:161682734-161682756 AGGCCTCGCGTCTTGCAGAGCGG - Intronic
1019861057 7:3658425-3658447 AGGGCTCACATTCTGCTGAGTGG + Intronic
1019914362 7:4123209-4123231 TGGCCTCTCTTTTTGCAGACAGG + Intronic
1020228648 7:6299894-6299916 AGGCCTCATATGTTGCTGAAGGG + Intergenic
1021925193 7:25527810-25527832 AGCCATCACATTTTACAGAACGG + Intergenic
1026233806 7:68508867-68508889 ATGCCTCACATTTTGAATCTAGG + Intergenic
1026297529 7:69067907-69067929 AGACCTCTCATTCTGCAGAGAGG - Intergenic
1031241831 7:119254707-119254729 AATCCTCCCATTTTGCAGATAGG + Intergenic
1031520929 7:122764880-122764902 AGGCTTCAGATTTTGTAGATGGG - Intronic
1032311969 7:130796190-130796212 ATGGTTCACATTTTGCAGATTGG + Intergenic
1032873198 7:136008778-136008800 AGCCATTCCATTTTGCAGATTGG - Intergenic
1033184291 7:139212302-139212324 ATGATTCCCATTTTGCAGATGGG + Intergenic
1034586417 7:152097383-152097405 AGCCCTCACATGTTGCTGGTGGG + Intronic
1035312646 7:157979551-157979573 GGAGCCCACATTTTGCAGATAGG + Intronic
1035667489 8:1389642-1389664 AGACCTCAGATTGTGCAGAATGG + Intergenic
1037785207 8:21898864-21898886 AGGCCTATCATTCTGCAGATGGG + Intergenic
1037914033 8:22761187-22761209 AGCCATCACATCTTGCAGGTGGG + Intronic
1039122618 8:34165194-34165216 AGGATTCACATTTTGTAAATGGG - Intergenic
1040572176 8:48620835-48620857 CGGCCTCACATACTGCAGACGGG + Intergenic
1042937851 8:74078481-74078503 AGGATTCACAGTATGCAGATTGG + Intergenic
1046339833 8:112839167-112839189 AGGGCTCATATTTTAGAGATGGG + Intronic
1046346406 8:112933894-112933916 AGGCCCCACAGGTTGCAGACAGG + Intronic
1047391077 8:124451820-124451842 AGCTCTCAAATATTGCAGATAGG + Exonic
1047501320 8:125443969-125443991 ACTCCTCCCATTTTACAGATGGG + Intergenic
1047662479 8:127052534-127052556 ATGCCCCACATTTTGCTGTTTGG - Intergenic
1047928538 8:129703982-129704004 CAGCCCCACATTTTACAGATTGG + Intergenic
1050666931 9:7949232-7949254 AGTCCCCACATTTTGCTGGTTGG + Intergenic
1050667300 9:7954355-7954377 AGGTCTTTCATTTTGCAGAGTGG + Intergenic
1052444741 9:28545801-28545823 AGCCTTTACATTTTACAGATTGG + Intronic
1052662720 9:31456307-31456329 AAGCCCCACATGTTGTAGATAGG - Intergenic
1052959897 9:34286467-34286489 AGAATTCACATTTTACAGATGGG + Intronic
1057743585 9:97733803-97733825 AGGCCCCACATCTTGAAAATGGG + Intergenic
1058097093 9:100874824-100874846 AGGCCCAACATTTTGGAGACTGG + Intergenic
1058946067 9:109857470-109857492 AGGCCTCCTTTTTTGGAGATTGG + Intronic
1059612288 9:115911568-115911590 AGGCCTCTCATTTTAGAGATGGG - Intergenic
1059969326 9:119648822-119648844 TGGCCTCTCATTTTGCAGATGGG + Intergenic
1061300945 9:129704677-129704699 AGACCCCTCATTTTGCTGATAGG - Intronic
1061514765 9:131082587-131082609 AGTGCCCCCATTTTGCAGATGGG + Intronic
1061709834 9:132480089-132480111 AGCCCCCTCATTTTGCAGATGGG + Intronic
1061895151 9:133643306-133643328 ATCCCTCCCATTTTACAGATGGG + Intronic
1062382679 9:136294987-136295009 AGGCACCCCATTTTACAGATGGG - Intronic
1185969182 X:4642913-4642935 AGGCCTCACCTTCAGCACATGGG - Intergenic
1186799850 X:13081964-13081986 AGTGATTACATTTTGCAGATGGG + Intergenic
1191688975 X:63920721-63920743 GGTCCTCATATTTTACAGATGGG - Intergenic
1192362956 X:70450649-70450671 GTGCCTCACATCCTGCAGATTGG - Exonic
1195118498 X:101724470-101724492 AAGCCTCATATATTGCTGATGGG - Intergenic
1196002807 X:110804828-110804850 AGGTCTTACATTTTACAGACGGG - Intergenic
1196515030 X:116600395-116600417 ATGCCTAAGATGTTGCAGATGGG - Intergenic
1197998332 X:132404967-132404989 AGGCCTCACATTTAGCTCAGTGG - Intronic
1198055183 X:132987148-132987170 AAACCACACATTTTACAGATGGG - Intergenic
1198450832 X:136766139-136766161 AGGCCTTACATTTTGGAGAGAGG + Intronic
1198657800 X:138933631-138933653 AGGCCACACATTTTACTGTTTGG - Intronic
1199748472 X:150791818-150791840 AAGCCCCACATTTTGCCTATAGG - Intronic