ID: 1083332848

View in Genome Browser
Species Human (GRCh38)
Location 11:61907007-61907029
Sequence CATTTTGCAGATGGGCAACC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1157
Summary {0: 1, 1: 0, 2: 18, 3: 147, 4: 991}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083332837_1083332848 8 Left 1083332837 11:61906976-61906998 CCCCCAGGAGCCAGGAAAGGCCC 0: 1
1: 1
2: 9
3: 66
4: 475
Right 1083332848 11:61907007-61907029 CATTTTGCAGATGGGCAACCAGG 0: 1
1: 0
2: 18
3: 147
4: 991
1083332840_1083332848 5 Left 1083332840 11:61906979-61907001 CCAGGAGCCAGGAAAGGCCCAGG 0: 1
1: 0
2: 5
3: 78
4: 628
Right 1083332848 11:61907007-61907029 CATTTTGCAGATGGGCAACCAGG 0: 1
1: 0
2: 18
3: 147
4: 991
1083332832_1083332848 28 Left 1083332832 11:61906956-61906978 CCATGAGAGTTCTGGGACCGCCC 0: 1
1: 0
2: 1
3: 5
4: 93
Right 1083332848 11:61907007-61907029 CATTTTGCAGATGGGCAACCAGG 0: 1
1: 0
2: 18
3: 147
4: 991
1083332835_1083332848 11 Left 1083332835 11:61906973-61906995 CCGCCCCCAGGAGCCAGGAAAGG 0: 1
1: 0
2: 2
3: 37
4: 417
Right 1083332848 11:61907007-61907029 CATTTTGCAGATGGGCAACCAGG 0: 1
1: 0
2: 18
3: 147
4: 991
1083332838_1083332848 7 Left 1083332838 11:61906977-61906999 CCCCAGGAGCCAGGAAAGGCCCA 0: 1
1: 2
2: 4
3: 47
4: 394
Right 1083332848 11:61907007-61907029 CATTTTGCAGATGGGCAACCAGG 0: 1
1: 0
2: 18
3: 147
4: 991
1083332839_1083332848 6 Left 1083332839 11:61906978-61907000 CCCAGGAGCCAGGAAAGGCCCAG 0: 1
1: 0
2: 6
3: 67
4: 524
Right 1083332848 11:61907007-61907029 CATTTTGCAGATGGGCAACCAGG 0: 1
1: 0
2: 18
3: 147
4: 991
1083332831_1083332848 29 Left 1083332831 11:61906955-61906977 CCCATGAGAGTTCTGGGACCGCC 0: 1
1: 0
2: 0
3: 4
4: 61
Right 1083332848 11:61907007-61907029 CATTTTGCAGATGGGCAACCAGG 0: 1
1: 0
2: 18
3: 147
4: 991
1083332842_1083332848 -2 Left 1083332842 11:61906986-61907008 CCAGGAAAGGCCCAGGCCTCACA 0: 1
1: 0
2: 1
3: 33
4: 262
Right 1083332848 11:61907007-61907029 CATTTTGCAGATGGGCAACCAGG 0: 1
1: 0
2: 18
3: 147
4: 991

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083332848 Original CRISPR CATTTTGCAGATGGGCAACC AGG Intronic
900419068 1:2547771-2547793 CATTTTAGAGATGAGCAAACGGG + Intergenic
901000738 1:6147695-6147717 CATTTTACAGATGGGAAAGCAGG - Intronic
901065582 1:6492680-6492702 TATTTTCCAGATGAGGAACCTGG + Intronic
901069425 1:6509761-6509783 CATTTTACAGATGTGGAATCGGG - Intronic
901355791 1:8647279-8647301 GATTGTGCAGATAGGCAACTAGG + Intronic
901736816 1:11317947-11317969 CATTTTGCAGGTGAGGAAACAGG + Intergenic
901813227 1:11779420-11779442 CATTTTACAGATAGGCAAATAGG - Intronic
902033033 1:13436568-13436590 CATTTTGCAGAAGGGCATGTGGG + Intergenic
902043733 1:13510516-13510538 CATTTTACAGATGAGGAAACGGG + Intronic
902115644 1:14118738-14118760 CATTTTACAGATGGGAAGACTGG + Intergenic
902180438 1:14684376-14684398 CATTTTGCAGATGGGAAAAACGG - Intronic
902376223 1:16031225-16031247 CATTTTCCCGATGGGGAAACAGG - Intronic
902381151 1:16052953-16052975 CATTTTCCAGATAGGGAAACGGG - Intronic
902397142 1:16138554-16138576 CATTTTGCCGATGAGAAAACAGG - Intronic
902541915 1:17161990-17162012 CATTTTACAGATGAGGAAGCCGG + Intergenic
902718022 1:18286007-18286029 CGTTTTGCAGATGAGGAAACAGG + Intronic
902731729 1:18374174-18374196 CGTTTTGCAGATGGGAAACCAGG - Intronic
902756769 1:18553982-18554004 CATTCTGCAGATGGGAATACTGG + Intergenic
902838039 1:19059245-19059267 CATTTTATAGATGAGCAAACAGG - Intergenic
902895504 1:19477026-19477048 CATTTTGCAGATAAGGAAACCGG - Intronic
903026918 1:20435910-20435932 CATTTTACAGATGGAGAAACTGG - Intergenic
903229000 1:21910481-21910503 TATTTTGCAGATGAGAAAACTGG - Intronic
903232379 1:21929819-21929841 CATTTTGAAGATGGGTCACCAGG - Intronic
903335375 1:22620964-22620986 CATTTTACAGATGTGAAAACTGG + Intergenic
903404780 1:23087203-23087225 CACTTTGCAGATTGGGAAACAGG + Exonic
903474117 1:23607637-23607659 CTTTTTGCAGATGGGGAAAGAGG - Intronic
903803202 1:25985225-25985247 TATTTTTCAGCTGGGCAAACAGG - Intronic
904031303 1:27535092-27535114 TATTTTACAGATGGGGAAACTGG - Intronic
904032854 1:27543990-27544012 CCTTTTGCAGATGGGGAATCAGG + Intronic
904093888 1:27962910-27962932 CATTTTACAGATGGGGAAACAGG - Intronic
904129471 1:28265059-28265081 CATTTTACAGATGAGGAACAAGG - Intronic
904270168 1:29344606-29344628 CATTTTACAGATGAGAAAACAGG + Intergenic
904318097 1:29679206-29679228 CATTTTGCAGATGAGCAAATAGG + Intergenic
904328263 1:29741457-29741479 CATATTGCAGATGAGGAAACTGG + Intergenic
904466129 1:30708526-30708548 CATTTCACAGATGGGCAAACAGG + Intergenic
904473593 1:30750758-30750780 CATTTTACAGATGAGGAAACAGG - Intronic
904473909 1:30752280-30752302 CATTTTGCAGATGGGAAAACAGG - Intronic
904597850 1:31657942-31657964 CATTTTACAGATGAGGAAACGGG - Intronic
904763926 1:32827436-32827458 CATTTGGCAGATAGGGAATCGGG - Intronic
904771445 1:32883550-32883572 CATTTTACAGATAGGAAAACTGG - Intergenic
904908170 1:33913583-33913605 CATTTTTCAGATGTGGAAACAGG + Intronic
904962497 1:34345391-34345413 CATTTTACAGATGTGCAAATTGG + Intergenic
905272008 1:36793465-36793487 CATTTTACAGATGAGGAAACAGG + Intergenic
905614368 1:39384446-39384468 CATTTTACAGATGAGGAAGCTGG + Intronic
905646389 1:39627319-39627341 CACTTTGCAGATGGGGAGACAGG - Intronic
905710343 1:40097042-40097064 CATTTTGCAGATGCGAACCCAGG + Intronic
905790852 1:40788545-40788567 CATTTGACAGATGGGGAAACTGG + Intronic
905805767 1:40876305-40876327 CATTTTACAGATGAGGAAACAGG - Intergenic
905970223 1:42136308-42136330 CATTTTACAGATGTGGAAACAGG + Intergenic
905985756 1:42280071-42280093 CATTTTACAGATGAGGAAACTGG - Intronic
906041608 1:42792384-42792406 CATTTTACAGATGGGGGAACAGG + Intronic
906559792 1:46748089-46748111 TATTTTCCAGATGGGGAAACTGG + Intergenic
906674217 1:47681527-47681549 CATTTTACAGATGAGGAAACTGG - Intergenic
906799564 1:48724252-48724274 CATTTTGCAGATGAAGAAGCTGG + Intronic
907312533 1:53547182-53547204 CATTTTGCAGATGGGAAGACTGG + Intronic
907447839 1:54520294-54520316 CATTTTACAGATAAGCAAACAGG + Intergenic
907455773 1:54574576-54574598 CATTTTACAGATGAGGAAACCGG + Intronic
907550752 1:55302737-55302759 CATTTTACAGATGAGGAACTGGG - Intergenic
907575260 1:55520553-55520575 CATTTTTCAGATGTGGAAACTGG - Intergenic
907712796 1:56899871-56899893 CATCTTACAGATGGGAAAACTGG + Intronic
907724125 1:57002850-57002872 CATTTTACAGATGAGGAAACTGG - Intronic
907798172 1:57738335-57738357 TATTTTGCAAATGGGGAAACTGG - Intronic
908597800 1:65707126-65707148 TATTTTACAGATGGGGAAACTGG - Intergenic
909339366 1:74514587-74514609 CATTTTGAAGATGGGAAAACTGG + Intronic
909352518 1:74671487-74671509 AATTTTACAGCTGGGCCACCAGG - Intronic
909492509 1:76241058-76241080 CATTTTGCAAGTGAGTAACCTGG - Intronic
910045055 1:82903413-82903435 AATTTTGTAGATGGGGAAACAGG - Intergenic
910160409 1:84266452-84266474 CATTTTACAGATGAGAAAGCAGG - Intergenic
910429893 1:87150197-87150219 CATTTTTCAGCTGGGGCACCAGG + Intronic
910474034 1:87587419-87587441 CATTTTGCTAATGGGAAAACTGG + Intergenic
910743499 1:90547873-90547895 CATTTTACAGATGAGGAAACTGG - Intergenic
910865822 1:91787344-91787366 CATTTTACAGATGAGGAAACAGG + Intronic
911093281 1:94034957-94034979 CATTTTGCAGATGGGGAAACAGG + Intronic
911098705 1:94077004-94077026 CAATTTGCAGATGAGAAGCCAGG - Intronic
911196910 1:95004095-95004117 CATTTTACAGATAAGAAACCTGG + Intronic
911199972 1:95034566-95034588 CACTTTGCAGATGAGGAATCTGG + Intronic
911244578 1:95502712-95502734 CATTTTGCAAGTGAGCAAACTGG + Intergenic
911840320 1:102674640-102674662 CATTTTGTAGATGGGAGAACTGG + Intergenic
912264070 1:108137793-108137815 CATTTTTCAGATGAGCAACTGGG - Intronic
913046924 1:115081641-115081663 CACTTTGCAGATGAGGAAGCTGG - Intronic
913219234 1:116646019-116646041 CATTTTGCAAAAGGCCAGCCTGG + Intronic
913327323 1:117638273-117638295 CATTTTGCAGATAAGGAAACTGG - Intergenic
913996682 1:143656455-143656477 AATTTTGCAGCTGGGCCACCAGG + Intergenic
914256928 1:145967896-145967918 CATTTTACAGATGAGGAAACAGG + Intronic
914326341 1:146620595-146620617 CATTTTACACATGGGGAAACTGG + Intergenic
914343869 1:146781749-146781771 CATTTTGGAGATGAGGAAGCTGG + Intergenic
914804722 1:150983628-150983650 CATTTTCCAGATGAGGAAACTGG + Intronic
915070067 1:153259507-153259529 CATTCTTGAGATGGGCAGCCTGG - Intergenic
915390333 1:155537453-155537475 CATTTTATAGATGGGCAAACAGG + Intronic
915457269 1:156049128-156049150 TATTTTGCAGATGAGCAAATAGG + Intronic
915723333 1:157999958-157999980 CATTTTACAGATGGACAAACAGG + Intronic
915731033 1:158054599-158054621 CACTTTACAGATGGGGAAACAGG + Intronic
915985449 1:160459705-160459727 CATTTTACACATGGGAAAACAGG + Intergenic
915997633 1:160580325-160580347 TATTTTGCAGATGGAGAAACTGG + Intergenic
916200405 1:162265679-162265701 CATTTTACAGATGAGAAAACTGG + Intronic
916314981 1:163438963-163438985 CATTTTGCTGATGGGGAAATTGG + Intergenic
916601001 1:166293468-166293490 CATTTTACAGATGAGGAAACTGG - Intergenic
916841175 1:168602803-168602825 CATTTTGCAGATGAAGAAACTGG + Intergenic
917588424 1:176452261-176452283 AATTTTACAGCTGGGCCACCGGG - Intergenic
917679956 1:177355577-177355599 CATTTTGTATATGGGGAAACAGG + Intergenic
917680952 1:177366754-177366776 TATTTTACAGATGGGAAAACTGG + Intergenic
918086132 1:181246960-181246982 AATTTTACAGCTGGGCCACCGGG - Intergenic
918175942 1:182045340-182045362 AATTTTACAGCTGGGCCACCGGG + Intergenic
918226657 1:182489776-182489798 CATTTTACAGATGAGAAAACTGG - Intronic
918944498 1:191045069-191045091 CATTTTATAGATGAGGAACCTGG + Intergenic
919035808 1:192308044-192308066 AATTTTACAGCTGGGCCACCAGG + Intergenic
919844665 1:201634322-201634344 CACTTTGCAGATGAGGAAACTGG + Intronic
919965546 1:202520204-202520226 TATTTTACAGATGGAAAACCTGG + Intronic
919975231 1:202606205-202606227 CATTTAACAGATGGGGAAACAGG + Intronic
920113700 1:203604640-203604662 CATTTTGCAGATGGAGAAACTGG - Intergenic
920228184 1:204453023-204453045 CCTTTTACAGATGGACAACTGGG - Intronic
920350452 1:205334803-205334825 CATCTTGCAGATGAGAAAACTGG - Intergenic
920547627 1:206831706-206831728 CATTTTACAGATGAGTAAACAGG + Intronic
920735036 1:208526056-208526078 CATTTTACAGATGAGGAAACAGG - Intergenic
921058701 1:211564371-211564393 CATTTTACAGATGGGTAAACTGG + Intergenic
921180652 1:212629083-212629105 CATTTTGCAGATCAACAAACTGG + Intergenic
921522987 1:216179986-216180008 CATGTTGCAGATGGGAAAGTGGG - Intronic
921554045 1:216575613-216575635 CATTTTACAGATGAGAAAACCGG + Intronic
921788112 1:219257492-219257514 AATTTTACAGCTGGGCCACCAGG + Intergenic
921788959 1:219267672-219267694 CATTTTACAGATGAGAAAACAGG + Intergenic
922324164 1:224512953-224512975 CACGTTGCAGATGGGTAAACAGG - Intronic
922336229 1:224620266-224620288 CATTTCGCAGATGAGGAAACTGG + Intronic
923437270 1:233979230-233979252 CATTTTACAGATGAGAAAACTGG - Intronic
923649270 1:235858273-235858295 CATTTTACAGATGAGGAAACTGG - Intronic
924086049 1:240453048-240453070 CATTTTACAAATGGGGAAACAGG - Intronic
924296972 1:242597444-242597466 AATTTTACAGCTGGGCCACCAGG - Intergenic
924462697 1:244273452-244273474 CATTTTACAGATGAGAAAACAGG - Intergenic
924632301 1:245752412-245752434 CATTCTTCAGATGGGGAACCTGG - Intronic
1063075643 10:2713590-2713612 CATTTTGCAGTAAGGCTACCAGG + Intergenic
1063417226 10:5883797-5883819 CATTTTACAGATGGGAACACTGG + Intronic
1063537975 10:6903734-6903756 CATTTTACAGATGAGCAACGAGG - Intergenic
1063604371 10:7509262-7509284 CCTTTTACAGATGGGCAAACAGG + Intergenic
1063673208 10:8116581-8116603 CATTTTACAGATGGGAAAACTGG + Intergenic
1063965614 10:11343974-11343996 CATTTTGCAGGAGAGCAAACGGG + Intergenic
1064164230 10:12972988-12973010 CATTTTGCAGATGAGGAAACAGG - Intronic
1064342719 10:14501178-14501200 CATTTTACAGATGAGAAAACTGG + Intergenic
1064860149 10:19817155-19817177 CAGTTCGCCGATGGGAAACCCGG + Exonic
1064949813 10:20836003-20836025 CATTTTGCAGATGAGTAAACTGG - Intronic
1065004833 10:21370103-21370125 TATTTTGCAGATGAGAAAACTGG - Intergenic
1065240433 10:23698621-23698643 CATTTTGCAGATGAGAAAACTGG + Intronic
1065499713 10:26367523-26367545 AATTTTACAGCTGGGCCACCAGG - Intergenic
1065984485 10:30936190-30936212 CATTTTGCAAATGAGCAAATCGG - Intronic
1066622627 10:37374457-37374479 CATTTAACAGATTGGCAAACAGG + Intronic
1067013934 10:42741296-42741318 AATTTTACAGCTGGGCCACCGGG + Intergenic
1067045450 10:42982791-42982813 CATTCTGAAGATGGGCAATAGGG - Intergenic
1067105514 10:43363457-43363479 CATTTTACGGATGAGCAAACAGG - Intergenic
1067135334 10:43602578-43602600 CATTTTGCAGATGAGGAAATTGG - Intergenic
1067699577 10:48559222-48559244 CAGTTTGCAGACGGGCACCTAGG + Intronic
1067793468 10:49304566-49304588 CAGTTTGCATATGGAGAACCTGG + Intronic
1067940298 10:50649592-50649614 CATTTAGCAGATGAGAAAACAGG - Intergenic
1068777400 10:60883003-60883025 CATTTTACAGATGAGGAAACAGG + Intronic
1069413981 10:68181735-68181757 CTTTTTGCTGATGGGCAAAGTGG - Intronic
1069694850 10:70379198-70379220 CCTTATGCAGATTGGCCACCTGG - Intronic
1069717519 10:70530457-70530479 CATTTTGCAGAGGAGGAAACAGG + Intronic
1069988024 10:72297534-72297556 CATTTTACAGATGAGGAAACAGG - Intergenic
1070772188 10:79088926-79088948 CATTTTGCAGAGGAGGAAGCTGG + Intronic
1071685643 10:87752513-87752535 CATTTTACAGATGAGAAACTGGG + Exonic
1072563740 10:96600220-96600242 CATTTTGCAGATGTAGAAACTGG - Intronic
1072620055 10:97073791-97073813 CATGTTGCAGATGAGAAAACTGG - Intronic
1072636364 10:97181070-97181092 CGTTTTACAGATGGGGAAACTGG + Intronic
1072662028 10:97369134-97369156 CATTTTACAGATGGAGAAACTGG - Intronic
1072720686 10:97779095-97779117 CATTTTACAGATGAGGAAACTGG - Intergenic
1072921812 10:99583169-99583191 CATTTTGCAAGTGGGAGACCTGG + Intergenic
1073790503 10:106935415-106935437 CATTTTGCAGGTAGGAAGCCAGG - Intronic
1074101807 10:110359715-110359737 CACTTTACAGATGAGAAACCGGG + Intergenic
1074213323 10:111359241-111359263 TATTTTCCAGATGGGAAAACAGG + Intergenic
1074307859 10:112295817-112295839 CATCTGGCAGATGTGCAACATGG + Intronic
1074667567 10:115747401-115747423 CATCTTGCAGGTGGGAAAACTGG + Intronic
1074784466 10:116826922-116826944 CATATTACAGATGGGGAAACTGG + Intergenic
1074856751 10:117479619-117479641 CATTTTACAGATGAGGAAACAGG + Intergenic
1074978364 10:118599171-118599193 CATTTTACAGATGAGAAAACTGG + Intergenic
1075016717 10:118915063-118915085 CATTTTACAGATGGGAAAACAGG + Intergenic
1075320976 10:121491543-121491565 CATTTTACAGGTGGGGAAGCTGG + Intronic
1075329570 10:121563759-121563781 CCTCTTGGAGCTGGGCAACCTGG - Intronic
1075464882 10:122643644-122643666 CATTTTGCAGATGAGAAGCATGG - Exonic
1076307144 10:129473457-129473479 TATTTTGCATATGAGGAACCCGG + Intronic
1077715687 11:4577748-4577770 CATTTTGCAGATGGACAGAGGGG - Exonic
1078127191 11:8578899-8578921 CATTTTACAGATGAGGAAACTGG - Intronic
1078352608 11:10607005-10607027 CATTTTGCAGATGAGCACGCTGG - Intronic
1078469127 11:11573037-11573059 CATTTTACAGATGAGAAACCTGG + Intronic
1078538827 11:12197299-12197321 CATTTGGCAGATAGGAAAACTGG - Intronic
1078547648 11:12257645-12257667 CATTTTACAGATGAGGAAACTGG - Intronic
1078563831 11:12396511-12396533 CATTTTGCAGATGAGGAGACTGG - Intronic
1078707532 11:13759491-13759513 TATTTTACAGATGGGTAAACGGG + Intergenic
1078852654 11:15178657-15178679 CATTTTCCAGATGTGAAAACTGG + Intronic
1079032362 11:16995130-16995152 CATTTTTCAGATGAGGAAACAGG + Intronic
1079138888 11:17794438-17794460 CATTTTACAGATGAAGAACCAGG + Intronic
1079157984 11:17966418-17966440 CATTTTATAGATGGGAAAACTGG - Intronic
1079329465 11:19521737-19521759 CATTTTCCAGATGAGGAAGCAGG + Intronic
1079405837 11:20144890-20144912 CATTTTACAGATGAGTAAACAGG - Intergenic
1080010098 11:27450186-27450208 AATTTTGAAGATGGGCAATAGGG + Intronic
1080308937 11:30867357-30867379 CATTTTACAGACGGGAAAGCTGG - Intronic
1080311879 11:30904113-30904135 CATTTTGCAGATGGAAAAACAGG + Intronic
1080700610 11:34640960-34640982 CATTTTGCATATGAGAAAACTGG + Intronic
1080865716 11:36193134-36193156 CATTTTACAGATGAGGAAACTGG - Intronic
1081031548 11:38090290-38090312 AATTTTGCAGCTGGGCCTCCAGG - Intergenic
1081581892 11:44358133-44358155 CATTTTGCAGATGGAGAAACTGG + Intergenic
1081585894 11:44383414-44383436 CCTTTTGCAGGTGGGCTTCCTGG - Intergenic
1081694231 11:45098514-45098536 CACTTTACAGGTGGGAAACCAGG + Intronic
1081990927 11:47337228-47337250 CATTTTACAGATGAGGAAACAGG - Intronic
1082013205 11:47464882-47464904 CGTTTTACAGATGAGCAAACAGG - Intergenic
1082282196 11:50281862-50281884 AATTTTACAGCTGGGCCACCGGG - Intergenic
1082810290 11:57475457-57475479 CATTTTACAGATGAGGAAACAGG + Intronic
1083332848 11:61907007-61907029 CATTTTGCAGATGGGCAACCAGG + Intronic
1083361034 11:62108330-62108352 CATTCTGCAGATGGGGACACTGG + Intergenic
1083629742 11:64089406-64089428 CATGTTACAGATGGGGAATCTGG - Intronic
1083737352 11:64689052-64689074 CATTTTCCAGACGGGGAAGCTGG - Intronic
1083756267 11:64793320-64793342 CATTTCACAGATGGGAAAACAGG + Intronic
1084055180 11:66627326-66627348 CAATTTGCAGTTTGGAAACCTGG + Exonic
1084147554 11:67273141-67273163 CATTTTACAGCTGGGGAAACTGG + Intronic
1084313047 11:68327605-68327627 CATTTTACAGATGGGGAGACTGG - Intronic
1084539467 11:69776870-69776892 CATTTTGCAAATGGGGAGTCAGG - Intergenic
1084586250 11:70064448-70064470 GATTTTTCAGATGGGCGCCCTGG + Intergenic
1084949480 11:72656836-72656858 CATTTTAGAGATGGGGAAACAGG - Intronic
1085035066 11:73294853-73294875 CATTTTACAGATGGGGAATCTGG + Intronic
1085077522 11:73604935-73604957 CATTTTACAGATGTGGAAACAGG - Intergenic
1085143104 11:74167069-74167091 CATTTTACAGATGGGGAAACAGG + Intronic
1085170709 11:74447449-74447471 CCTTTTGCAGATGAGGAAACTGG - Intergenic
1085212990 11:74798745-74798767 AATTTTAAAGATGGGCATCCAGG - Intronic
1085273035 11:75281547-75281569 CATCTTGCAGATGAGGAAGCTGG + Intronic
1085304794 11:75479225-75479247 CATTTTGCCGATGACAAACCTGG + Intronic
1085316909 11:75550854-75550876 CACTTTGCAGGTGGGCATCTAGG + Intergenic
1085625203 11:78066473-78066495 CCTTTTGCAGATGAGAAAACTGG + Intronic
1085725699 11:78952818-78952840 CATTTTATAGATGGGCAACTGGG + Intronic
1085783026 11:79426415-79426437 CATTTTCCAGAGGGGCAACAGGG - Intronic
1085849875 11:80107918-80107940 CATTCTACAGATGGGAAAACAGG + Intergenic
1085863751 11:80263398-80263420 CATTTTGCAGAAAGGAAACCAGG + Intergenic
1086514619 11:87597502-87597524 CATTTTGCAGATGAGGAGACAGG + Intergenic
1086547326 11:88013008-88013030 CATTTTGCACATGAGAAAACAGG - Intergenic
1087015057 11:93546557-93546579 CATTTTACAGATGAGAAAACTGG + Intergenic
1087019259 11:93585878-93585900 CATTTTACAGATGAGAAAACTGG + Intergenic
1087249803 11:95885248-95885270 CATTTTGCAAATGTACAATCTGG - Intronic
1087681260 11:101220399-101220421 AATTTTACAGCTGGGCCACCAGG + Intergenic
1088023403 11:105148138-105148160 GATTCTGCAGCTGGGCCACCTGG - Intergenic
1088374533 11:109125659-109125681 CATTTTACAGATGGAAAAACAGG + Intergenic
1088765290 11:112969567-112969589 CATTTTACAGATGGGGAAACAGG - Intronic
1088816422 11:113424048-113424070 CATTTTGCAGTTGATAAACCAGG - Intronic
1089335578 11:117720706-117720728 CATTTTACAGATGAGGAAACTGG - Intronic
1089534597 11:119153193-119153215 CATTTTACAGATGAGGGACCTGG + Intronic
1089920898 11:122208648-122208670 CATTCTTCAGATGGGGAAACAGG + Intergenic
1090051464 11:123383413-123383435 CATTTTACAGATGAGGAAACTGG - Intergenic
1090207232 11:124892178-124892200 CATTTTACAGATGAGAAAACTGG - Intronic
1090258639 11:125303304-125303326 ACTTTTGCAGATGAGCAAACGGG + Intronic
1090620930 11:128560468-128560490 CATTTTACAGAAGAGCAAACAGG + Intronic
1090719360 11:129458094-129458116 CATTTTGCAGAGGGGTAAACTGG + Intergenic
1091138036 11:133210415-133210437 AATTCTGCAGTGGGGCAACCTGG - Intronic
1091206748 11:133826772-133826794 CATTTTACAGATAGGAAAACTGG + Intergenic
1091407263 12:216950-216972 CATTTTACAGACGGGAAACTGGG + Intergenic
1091653929 12:2330514-2330536 CATTTTACAGGTGGGAAAGCTGG + Intronic
1091808084 12:3370460-3370482 CATTTTAAAGATGGGGAAGCGGG - Intergenic
1091992291 12:4965154-4965176 CATTTTGCAGCTGAGAAAGCTGG + Intergenic
1093735111 12:22612547-22612569 AATTTTGCAGCTGGGCCACCAGG + Intergenic
1093861030 12:24167848-24167870 CAGTTTGCAGAAGGGCAAGGTGG + Intergenic
1094397816 12:30026808-30026830 CCTTTTGCAGATGGTCAAATTGG - Intergenic
1094597928 12:31882300-31882322 CATTTTACAGATAAGGAACCAGG + Intergenic
1094787519 12:33865783-33865805 CAATTTGAAGCTGGGCAATCTGG - Intergenic
1095464372 12:42475383-42475405 CATTTAACAGATGGGGAAACTGG + Intronic
1095472048 12:42547553-42547575 CATTTTACAGATAGGAAAACTGG - Intronic
1096139049 12:49227104-49227126 CATTTCACAGATGGGAAACAGGG + Intronic
1096518662 12:52172006-52172028 CACTTTCCAGATGGGGAAACAGG + Intronic
1096539538 12:52297443-52297465 CATTTTCCAGATGGGGGACTCGG - Intronic
1096578296 12:52568468-52568490 CATTTTGCAGATGGGGCCCTAGG + Intronic
1096831943 12:54321570-54321592 CATTTTACAGATGAGCAACATGG - Intronic
1097185746 12:57195450-57195472 CACTTTGCAGATGGGGAAGCCGG + Intronic
1097665486 12:62473252-62473274 CATTTTACAGATGAGGAAACTGG + Intronic
1097721528 12:63026610-63026632 CATTTTACAAATGGGGAAACTGG - Intergenic
1097915597 12:65017622-65017644 CATTTTACAGATGAGAAAGCAGG - Intergenic
1097991737 12:65842233-65842255 CCTTTTGCAGATGAGGAAACTGG - Intronic
1098393035 12:69989591-69989613 CATTTTACAGATGAGGAAACTGG - Intergenic
1098460193 12:70724362-70724384 CATTTTACAGATGAGAAAACTGG - Intronic
1098741114 12:74174847-74174869 AATTTTACAGCTGGGCCACCAGG + Intergenic
1099062077 12:77924233-77924255 CGTTTTGCCCATGGGCCACCTGG - Intronic
1099094677 12:78358928-78358950 CATTTTGCAGATGAGAAAATTGG - Intergenic
1099411892 12:82340394-82340416 CATTTTACAGATGGGTAAACTGG + Intronic
1099498614 12:83382936-83382958 CATTTTTAAGATGGCCAAGCAGG - Intergenic
1100087482 12:90929419-90929441 AATTTTACAGCTGGGCAGCCAGG + Intronic
1100850704 12:98707743-98707765 CCTTTTGCAGATGAGGAAACAGG + Intronic
1101187392 12:102293395-102293417 CATTTTGCAGATGGAGAAATGGG + Intergenic
1101331582 12:103761740-103761762 CATTTTGCAGATGAGAAAATTGG - Intronic
1101363388 12:104048871-104048893 CATTTTACAGATGAGGAACTAGG + Intronic
1101708736 12:107245185-107245207 CATTTTATAGATGAGCAAACTGG - Intergenic
1102016258 12:109649877-109649899 CATTTTACAGATGAGGAAACTGG - Intergenic
1102208110 12:111104594-111104616 CATTTTATAGATGAGGAACCAGG - Intronic
1102430656 12:112880444-112880466 CATTGTACAGATGGGGAAACAGG + Intronic
1102591016 12:113956846-113956868 CATTTTACAGATGAGGAAACAGG - Intronic
1102602523 12:114042834-114042856 CATTTTACAGATGGGGAGACTGG + Intergenic
1102719997 12:115007795-115007817 CATTTTGCAGATGGAGAAATAGG - Intergenic
1102916096 12:116753616-116753638 CATTTTACAGATGAGGAAACTGG + Intronic
1102931854 12:116868435-116868457 CATTGTACAGATGGAGAACCTGG - Intronic
1102973689 12:117190824-117190846 CATATTACAGATGGGGAAACAGG + Intergenic
1103006340 12:117423333-117423355 CATTTTCCAGATCAGCAGCCAGG + Intronic
1103037150 12:117665770-117665792 CATTTTACAGATGAGGAAACAGG + Intronic
1103127979 12:118441027-118441049 CATTATACACATGGGTAACCAGG + Intergenic
1103128132 12:118442559-118442581 CATTTTACAGATGAGGAAACTGG + Intergenic
1103239658 12:119402541-119402563 CATTTTACAGATGAGAAAACAGG - Intronic
1103320132 12:120087664-120087686 GTTTCTGCAGTTGGGCAACCAGG + Intronic
1103718690 12:122961792-122961814 CATTTTGCAAATGAGGAAACAGG - Intronic
1103828886 12:123762879-123762901 TATTTTACAGATGAGCAAACTGG + Intronic
1104277871 12:127346570-127346592 AATTTTGCAGCTGGGCCACCGGG + Intergenic
1104308969 12:127636599-127636621 CATTTTGCAGATAAGAACCCTGG + Intergenic
1104371747 12:128229538-128229560 CATTTTGCAGTTGGGGAAACAGG + Intergenic
1104398815 12:128458948-128458970 CAGTTTGTAGCTGGGCCACCTGG - Intronic
1105897718 13:24731322-24731344 AATTTTACAGCTGGGCCACCAGG + Intergenic
1106183962 13:27392126-27392148 CATTTTACAGATGAGGAAACTGG + Intergenic
1106716197 13:32390920-32390942 CACTTTACAGATGGGGAAACTGG + Intronic
1107420053 13:40237788-40237810 AATTTTGTAGATGTGCAGCCAGG + Intergenic
1107427775 13:40311456-40311478 CATTTTACAGATGAGGAAACTGG - Intergenic
1107965258 13:45592111-45592133 CATTTCACAGATGAGCAACTTGG - Intronic
1108620748 13:52181708-52181730 CATTTTACAGCTGGGGAAACAGG + Intergenic
1108666003 13:52631270-52631292 CATTTTACAGCTGGGGAAACAGG - Intergenic
1108759323 13:53543725-53543747 CATTTTATAGATGAGGAACCTGG - Intergenic
1108960478 13:56221741-56221763 AATTTTACAGCTGGGCCACCGGG + Intergenic
1109197216 13:59391375-59391397 CATTTTGCAGATGTGGAAACAGG - Intergenic
1109236628 13:59829483-59829505 CATTTTTCAGATGAGGAAACAGG - Intronic
1110125371 13:71935659-71935681 AATTTTCCAGATGAGAAACCTGG + Intergenic
1111099122 13:83558128-83558150 CATTTTGCAGATGAAGAAGCTGG + Intergenic
1111162379 13:84412507-84412529 CATTTTGTAGATGAGCAAACTGG - Intergenic
1112273258 13:97990505-97990527 CATTTTGCAGACTTGCTACCGGG + Exonic
1112350996 13:98632950-98632972 CATTTTGCAGTTGAGAAAACAGG + Intergenic
1112565007 13:100545304-100545326 CCTTTTGCAGATGGGGAAGCTGG + Intronic
1112809284 13:103199095-103199117 CACTCTGTAGATGGGCAAGCGGG + Intergenic
1113054510 13:106253639-106253661 CATTTTACAGAGGGGAAACTAGG - Intergenic
1114491846 14:23107411-23107433 TATTTTACAGATGGGAAAACTGG - Intergenic
1114724999 14:24926795-24926817 CTTTTTACAGATGAGCAACCAGG - Intronic
1115085128 14:29506522-29506544 AATTTTACAGCTGGGCCACCAGG + Intergenic
1115291847 14:31781031-31781053 CATTTTACAGGTGGGCCCCCTGG - Intronic
1115312541 14:31993986-31994008 CATTTTACAGATGAGGAAACTGG + Intergenic
1115394627 14:32894228-32894250 CATTTTGCAGATGGGAAAACTGG + Intergenic
1115406232 14:33020390-33020412 CATTTTGCAGATGAGTAAACTGG - Intronic
1115428509 14:33289175-33289197 CATTTTGCAGATGAGAAAGTGGG + Intronic
1116470693 14:45282320-45282342 AATTTTACAGCTGGGCCACCAGG - Intergenic
1116554673 14:46288064-46288086 AATTTTACAGCTGGGCCACCGGG + Intergenic
1116747902 14:48845199-48845221 CATTTTGCAGATGGCCTATCAGG + Intergenic
1117201477 14:53394323-53394345 AATTTTACAGTTGGGCCACCAGG + Intergenic
1117286528 14:54291081-54291103 TATTTTTCAGATGAGGAACCTGG + Intergenic
1117354266 14:54908519-54908541 CATTTTACAGAGGAGGAACCAGG - Intergenic
1118105102 14:62649825-62649847 CATTTTGCAGATGAGAAAACTGG - Intergenic
1118181664 14:63499810-63499832 CATTTTACAGATGAGGAAACTGG + Intronic
1118269455 14:64328762-64328784 CATTTTGTAGATGAGAAAACTGG + Intronic
1118461177 14:65988638-65988660 CATTTTGCAGGTGAGGAACCAGG - Exonic
1118508354 14:66442107-66442129 CATTTTACAGATGAGGAAGCAGG - Intergenic
1118752741 14:68818389-68818411 CATTTTTCAGATGTGAAAACGGG - Intergenic
1118775710 14:68972803-68972825 CATTTTGCAGATGAGAGAGCTGG - Intronic
1118823658 14:69361671-69361693 CATTTTGCAGATGTAGAAACAGG + Intergenic
1119216145 14:72870738-72870760 CATTTTACAGATGGAAAAACAGG + Intronic
1119392029 14:74297311-74297333 CATTTTACAGAAGGGGAACCTGG + Intronic
1119533142 14:75377542-75377564 CATTTTACAGATGAGGAAACTGG - Intergenic
1119566592 14:75634356-75634378 CATTTTGCAGATGAAGAAACAGG - Intronic
1119656983 14:76424310-76424332 CTTTGTGCAAATGGGCAGCCTGG - Intronic
1119689723 14:76662145-76662167 CATGTTACAGATGGGAAAACAGG - Intergenic
1119920786 14:78444243-78444265 CATTTTACAGATGAGGAAACAGG + Intronic
1120445258 14:84587375-84587397 CATCTTGCAGATGGACAAGGGGG - Intergenic
1120590517 14:86368531-86368553 CCTTTTGAAGATAGGCACCCTGG - Intergenic
1120831568 14:89001788-89001810 CATTTTGCAGATGAGGAAACTGG - Intergenic
1120914471 14:89698551-89698573 CACTTTACAGATGGGGAGCCTGG + Intergenic
1121127838 14:91418832-91418854 CATTTCGCAGCTGGGCCAACTGG + Intergenic
1121319861 14:92985901-92985923 CATTTTACAGATAGGAAAGCTGG + Intronic
1121449684 14:93999172-93999194 CCTGCTGTAGATGGGCAACCCGG + Intergenic
1121559386 14:94863421-94863443 CATTTTACAGATGAGAAAACCGG - Intergenic
1121572898 14:94960939-94960961 CATTTTACAGATGAGAAAACAGG - Intergenic
1121936003 14:98019411-98019433 CATTTTACAGATGAGGAAACTGG - Intergenic
1122140819 14:99661973-99661995 CATTTTCCAGATGGGAAAGCTGG - Intronic
1123098588 14:105778317-105778339 GATTTTACAGCTGGGCAGCCGGG + Intergenic
1123990403 15:25679438-25679460 CAGCTTGCAGATGGACAAGCGGG - Exonic
1124490890 15:30154549-30154571 CATTTAACAGATGGGGAAACAGG + Intergenic
1124580168 15:30946353-30946375 CATTTTACAGGTTAGCAACCTGG + Intronic
1124597816 15:31104879-31104901 CATTTTGCAGCTGGGCATGGTGG - Intronic
1124657547 15:31521422-31521444 CACTTTGCAGATGTGGGACCCGG - Intronic
1124752643 15:32383782-32383804 CATTTAACAGATGGGGAAACAGG - Intergenic
1125169780 15:36753310-36753332 CATTTTGCAAATGGGAAACCTGG + Intronic
1125339197 15:38657877-38657899 TATTTTGCAGATGAGGAAGCAGG + Intergenic
1125588841 15:40842272-40842294 CATTTTACAAATGAGCAAACAGG - Intergenic
1125744002 15:41986872-41986894 CATGTTACAGATGGGGAAACAGG - Intronic
1125874117 15:43129022-43129044 AATTTTACAGCTGGGCCACCGGG - Intronic
1126067251 15:44835506-44835528 CATTTTACAGATGAGGAAACAGG + Intergenic
1126092578 15:45065043-45065065 CATTTTACAGATGAGGAAACAGG - Intronic
1126109222 15:45166053-45166075 CATTTTGCAGATGAGAAAACAGG - Intergenic
1126458191 15:48887389-48887411 CATTTTACAGATGAGGAAACTGG - Intronic
1126519024 15:49568549-49568571 CATTTGACAGATGAGAAACCCGG - Intronic
1127281973 15:57500468-57500490 CATTTTCCAGATGAGCAAACTGG - Intronic
1127607395 15:60600961-60600983 CATTTTACAGATGAGGAAACTGG + Intronic
1127965810 15:63922044-63922066 CATCTTAGAGATGGGCATCCTGG + Intronic
1128040778 15:64571582-64571604 CATTTTACATATGGGTAAACTGG + Intronic
1128093106 15:64932277-64932299 CATTTTGCAGATGAGAAAACTGG + Intronic
1128229452 15:66024621-66024643 CATCTTGCAGATGTGAAAACTGG + Intronic
1128246830 15:66138724-66138746 CATTTTGCAGAAGAGGAAGCTGG - Intronic
1128341485 15:66825538-66825560 CACTTTACAGATGGGAAAACTGG - Intergenic
1128349075 15:66877101-66877123 CATTTTGCAGATGAGAAATCAGG - Intergenic
1128410737 15:67394367-67394389 CATTTTACAGATGAGGAAACAGG + Intronic
1128457588 15:67840856-67840878 CATTTTGCAGTTTAGCAAACAGG + Intergenic
1128757799 15:70195306-70195328 CATTTTACAGATGGTGAAACGGG + Intergenic
1129052642 15:72795524-72795546 CATTTTACAAATGGGAAACTGGG - Intergenic
1129165922 15:73777415-73777437 CATTTTGCAGGTGAGGAAACTGG + Intergenic
1129755411 15:78095115-78095137 CATTTTACAGATGAGGAAACGGG - Intronic
1130079267 15:80717671-80717693 CATTTTGCAGCTGGGCACAATGG - Intronic
1130575709 15:85091326-85091348 CATTTTGCAGGTGAGGAAACTGG + Intronic
1130736347 15:86554179-86554201 CATTTTGCAGATGAGGAAACAGG - Intronic
1130755688 15:86760642-86760664 CTTTTTGCAGAGGGGAAAACAGG - Intronic
1130834991 15:87641276-87641298 CGTTTAGCAGATGAGCAAGCAGG + Intergenic
1131057655 15:89385139-89385161 AATTTTGCAGATGGGAAAACTGG - Intergenic
1131303554 15:91221297-91221319 CATTTTACAGATGAGGAAACTGG + Intronic
1132096059 15:98985747-98985769 CATTTTGCAGATGAGGAAAGGGG - Intronic
1132338472 15:101063654-101063676 TGTTTTGTAGATGGGCAAACTGG - Intronic
1132348048 15:101120587-101120609 CAGTTTTCAGATGTGAAACCTGG - Intergenic
1133013720 16:2929393-2929415 CATTTTCCAGATGGGGAAAGTGG + Intronic
1133457828 16:5958524-5958546 CCTTTTTCAGATGGGGAAACTGG - Intergenic
1133549164 16:6837311-6837333 CATTTTGTAGATGTGCCACCTGG + Intronic
1134048343 16:11118382-11118404 CATTTTACAAATGGGAAAACTGG + Intronic
1134068839 16:11248185-11248207 CATTTTGCAGATGAGGAAACTGG - Intergenic
1134069581 16:11252614-11252636 CGTTTTACAGATGGGAAAACAGG - Intronic
1134069623 16:11252880-11252902 CATTTTACAGATGGGAAAACGGG - Intronic
1134335227 16:13293025-13293047 CAGTTTGCAGGGGGGAAACCTGG - Intergenic
1134387033 16:13782955-13782977 AATTTTACAAATGGGAAACCTGG + Intergenic
1134599409 16:15521668-15521690 CATTTTGCACATTGGAAACCAGG - Intronic
1135023384 16:18981034-18981056 CATTTTACAGATGAGAAAACAGG + Intergenic
1135106781 16:19656583-19656605 CACTTTACAGATGGGGAAACAGG - Intronic
1135167392 16:20151617-20151639 CATTTTACAGATGAGCAATAGGG + Intergenic
1135436342 16:22429081-22429103 CATTTTACAGATGGGGAAAAAGG - Intronic
1135458735 16:22622632-22622654 CATTTTACAGATGAGGAAACAGG + Intergenic
1135911481 16:26565526-26565548 CATTTTGCAGATGGAAAAACTGG + Intergenic
1136068473 16:27774383-27774405 CATTTTACAGATGGGAAAACAGG + Intronic
1136106664 16:28034921-28034943 CATTGTACAGATGGACAAGCTGG - Intronic
1136369357 16:29826258-29826280 CATTTTGTAGATGAGGAAACAGG + Intronic
1136391611 16:29968840-29968862 CATTTTACAGATGAGGAAACAGG + Intronic
1137267760 16:46883313-46883335 CATTTTGCACATGGAGAATCTGG + Intergenic
1137491706 16:48938478-48938500 CATTTTCCAGATGAGGAAACAGG + Intergenic
1137772171 16:51025170-51025192 CAATTTGCAGATGGAAAAACTGG + Intergenic
1137934349 16:52619898-52619920 CATTTTATAGATGGGGAAACAGG - Intergenic
1138101215 16:54253623-54253645 CATTTTACAGATGGGAAAACTGG - Intronic
1138108926 16:54307782-54307804 CATTTTACAGATGTGGAAACTGG - Intergenic
1138156712 16:54712391-54712413 CACTGTGCAGATGGCCAAGCTGG + Intergenic
1138184588 16:54966655-54966677 CCTTTTACAGATGGGAAAACTGG - Intergenic
1138206168 16:55126757-55126779 CATTTGGCAGATGGGACAGCAGG - Intergenic
1138290492 16:55842557-55842579 CATCTTGTAGATGCGCTACCTGG + Intergenic
1138481503 16:57306265-57306287 CATTTTACAGATGGCGAAACTGG - Intergenic
1138553605 16:57759934-57759956 CATTTTGCAGATGAGGAAACTGG - Intronic
1138723327 16:59107998-59108020 CATTTAGCAGATGAGAAAACAGG + Intergenic
1138740290 16:59300652-59300674 CCTTTTGCAGATGGGACTCCTGG - Intergenic
1138946450 16:61856745-61856767 CATTTTACAGATGTGCAAATTGG + Intronic
1139014184 16:62669726-62669748 AATTTTATAGATGGGCTACCAGG - Intergenic
1139187719 16:64826604-64826626 CATTTTACAGATGAGGAAACTGG - Intergenic
1139314782 16:66059010-66059032 CACTTTACAGATGGGGAAACTGG + Intergenic
1139461414 16:67125626-67125648 CATTTTGCAGATGTGGACCCTGG + Intronic
1139990124 16:70933586-70933608 CATTTTGGAGATGAGGAAGCTGG - Intronic
1140007224 16:71090354-71090376 CATTTTACACATGGGGAAACTGG - Intronic
1140858185 16:78996387-78996409 CATTTTACAGGTGGGGAAGCTGG - Intronic
1141220109 16:82061397-82061419 CATTTTAAAGATGGGGAAACTGG + Intronic
1141291876 16:82725471-82725493 CATTTTTCAGATGAGAAAGCTGG - Intronic
1141391942 16:83672138-83672160 CATTTTACAGATGAGGAAACTGG - Intronic
1141556022 16:84837206-84837228 CATTTTTCAGATGGCAAGCCAGG + Intronic
1141640582 16:85338744-85338766 CATTTTACAGATGAGGAAGCTGG + Intergenic
1142250285 16:88988864-88988886 CATATTGCAGATGGGAAGCCAGG + Intergenic
1142980052 17:3666478-3666500 CATTATTCAGATGGGGACCCAGG + Intronic
1143091147 17:4449768-4449790 CATTTTACAGATGGCAAACTGGG + Intronic
1143247050 17:5495843-5495865 CATTTGGCAGATGAGGAAACAGG - Intergenic
1143271255 17:5676693-5676715 CATTTTGTAGATGAGAAACTGGG + Intergenic
1143301138 17:5911484-5911506 CATTCTGCAGATGAGGAAACAGG + Intronic
1143319957 17:6061764-6061786 CATTTTGCAGATGAGAAAACTGG - Intronic
1143707297 17:8707769-8707791 CATTTTGCAGATGAGCAAACAGG + Intergenic
1144278626 17:13701669-13701691 CATTTTCCAGATGAGGAAACTGG + Intergenic
1144414154 17:15030696-15030718 CATTTTACAGATGCAAAACCTGG + Intergenic
1144582282 17:16465768-16465790 CAGTCAGCAGCTGGGCAACCAGG - Intronic
1144594944 17:16561026-16561048 CATTTTGCAGCTGGGCACGGTGG + Intronic
1144836110 17:18157568-18157590 CATTTTACAGATGAGGAAACAGG - Intronic
1144845808 17:18218391-18218413 CATTTCGCAGATGAGAAAACAGG + Intergenic
1145000663 17:19302297-19302319 CATTCTGCAGATGAGAAAACAGG + Intronic
1145227941 17:21146486-21146508 CATTTTGCAGATGAGGAAACTGG + Intronic
1145770966 17:27492799-27492821 CATTTTGTACATGGGGAACTCGG - Intronic
1146267893 17:31465118-31465140 CATCTTACAGATGGGGAAACAGG + Intronic
1146442725 17:32911064-32911086 CATTTTACAGATGTGGAAGCAGG - Intergenic
1146531537 17:33611350-33611372 CATCTTACAGATGAGCAATCTGG - Intronic
1146795223 17:35775625-35775647 CATTTTGCACATAGGGAAACAGG - Intronic
1146819317 17:35971875-35971897 CATTTTGCAGAAGAGGAAACTGG + Intergenic
1146829515 17:36056275-36056297 CAATTGGCAGATGGGGAAACAGG - Intergenic
1147027487 17:37600667-37600689 CATTTTATAGATGGGGAAACTGG - Intronic
1147177748 17:38666917-38666939 CATTTTGCAGATGAGAAAACTGG - Intergenic
1147305355 17:39560316-39560338 AACCTTGCTGATGGGCAACCTGG - Intronic
1147314951 17:39615613-39615635 CATTTTACAGATGAGGAAGCAGG - Intergenic
1147605113 17:41770022-41770044 CACTTTACAGATGGGAAAACTGG + Intronic
1147746041 17:42695288-42695310 CATTTTACAAATGGGGAAACAGG - Intronic
1147917166 17:43895471-43895493 CATTTTGGAGATGGGTACTCAGG + Intronic
1148319836 17:46741189-46741211 CATTTTGCAGATGAGAAACCTGG - Intronic
1148338762 17:46860530-46860552 CATTTTACAGATGAGAAAACTGG - Intronic
1148593300 17:48832570-48832592 CATTTTGCTGATGAGGAAACAGG + Intronic
1148694120 17:49548919-49548941 CATCCTGCAGATGGGGAAGCAGG - Intergenic
1149450964 17:56749777-56749799 CATTTTACAGATAGGGAAGCAGG - Intergenic
1150107792 17:62475235-62475257 CAGTTTTCAGATGAGGAACCTGG + Intronic
1150409842 17:64934279-64934301 CATTTTACAGACGGGAAAGCTGG + Intergenic
1150416924 17:64995484-64995506 CATTTTGCCGATGGTCAGTCAGG + Intergenic
1150794743 17:68228441-68228463 CATTTTGCCGATGGGCAGTCAGG - Intergenic
1150931238 17:69587707-69587729 CATGTTGCAGAAGATCAACCAGG + Intergenic
1151143384 17:72016645-72016667 CATTTTGCAGATAGACAGCGGGG - Intergenic
1151220400 17:72607292-72607314 CATTTTGCAGATGAGGAAACTGG + Intergenic
1151255680 17:72874555-72874577 CATTTTGCAGGTGAACAGCCTGG + Intronic
1151296736 17:73191925-73191947 CATTTTACAGATGGGGAAACGGG - Intergenic
1151314702 17:73314511-73314533 CACTTTACAGATGGGGAAGCTGG - Intergenic
1151329298 17:73397470-73397492 CCTTTTGCAGATGAGGAAACCGG - Intronic
1151369508 17:73639138-73639160 CATTTTACAGATGAGAAAACTGG + Intronic
1151429499 17:74052890-74052912 CATTTCACAGATGGGTAAACAGG + Intergenic
1151554299 17:74838877-74838899 CATTTTGCAGATGGGCCCCCGGG + Exonic
1151641375 17:75397692-75397714 CATTTTACAGATGAGAAAACTGG - Intronic
1151916455 17:77121703-77121725 CATTTTACAGATGAGGAAACGGG + Intronic
1152014827 17:77743728-77743750 CATTTTGCAGAAGGGCAGATGGG + Intergenic
1152316213 17:79581888-79581910 GCTTTAGCAGAGGGGCAACCTGG - Intergenic
1153264739 18:3259124-3259146 CATTTTACAGATGAGGAAACTGG - Intergenic
1155024957 18:21932939-21932961 CATTTTGCACATGAGAAAACAGG + Intergenic
1155349538 18:24892931-24892953 CATTTTACAGATAGGGAATCTGG - Intergenic
1155853144 18:30797543-30797565 CATTTTACAGATGAGAAAACTGG - Intergenic
1155996736 18:32338442-32338464 CATTTTACAGATGAGGAAACGGG - Intronic
1156368522 18:36451649-36451671 CAGTATTCAGAAGGGCAACCTGG + Intronic
1156740134 18:40316008-40316030 CATTTTGCAGATGAGGAGCCTGG - Intergenic
1157121511 18:44915826-44915848 CATTTTACAGATGAGGAAACAGG + Intronic
1157130319 18:45001253-45001275 CATTTTACAGATGGGGAAACAGG - Intronic
1157214361 18:45770461-45770483 CATTCTGCAGATGTGGAAACTGG + Intergenic
1157270278 18:46269655-46269677 AATTTTACAGATGGGAAAACTGG + Intergenic
1157578522 18:48759630-48759652 CATTTTACAGATGAGTAACTGGG - Intronic
1158412069 18:57215289-57215311 CATTTTGCAGATGGAAGAACAGG - Intergenic
1158611410 18:58944065-58944087 CATTTCACAGATGGGACACCAGG - Intronic
1158627989 18:59088428-59088450 CATTTTCCAGATGGGCTGCAAGG + Intergenic
1158690927 18:59659839-59659861 CAATTTACAGATGAGCAAACGGG - Intronic
1158957864 18:62558419-62558441 CATTTTGCACATGAGCACACTGG + Intronic
1159507527 18:69356330-69356352 CATTTTACAGATGAGCAAACTGG - Intergenic
1159853611 18:73557419-73557441 CATTTTTTAGATGAGAAACCTGG + Intergenic
1160244590 18:77146854-77146876 CAATTTGCAGAAGGGTCACCTGG - Intergenic
1160397927 18:78585410-78585432 CACTGTGCAGATGGACAAACTGG - Intergenic
1160620134 18:80164726-80164748 AATTTTACAGCTGGGCCACCAGG + Intronic
1160855266 19:1214502-1214524 CATTCTACAGATGGGGAAACGGG - Intronic
1161733961 19:5978848-5978870 CATTTTACAGATGGGTAACCTGG - Intergenic
1161808147 19:6456988-6457010 CATTTTGTAGAGGGGGAAACGGG + Intronic
1161838314 19:6662954-6662976 CATTCTACAGATGAGGAACCTGG - Intronic
1161858554 19:6780230-6780252 CATTTTACAGATGAGAAACCAGG - Intronic
1161995453 19:7708592-7708614 CATTTTACAGATGAGGAAACTGG - Intergenic
1162199010 19:9007887-9007909 CATTTTGCAGAAGAGAAAACAGG - Intergenic
1162307455 19:9883876-9883898 CGTTTTACAGATGGGGAAACTGG - Intronic
1162726551 19:12693072-12693094 CATTTTACAAATGGGGAAACTGG + Intronic
1162875511 19:13618184-13618206 CATTTTACAGATGAGGAAACTGG - Intronic
1163003022 19:14380942-14380964 CATTTTCCAGATGAGGAAACAGG - Intronic
1163941605 19:20500322-20500344 AATTTTACAGCTGGGCCACCAGG + Intergenic
1164091852 19:21961199-21961221 AATTTTGCAGCTGGGCCTCCAGG + Intronic
1164448772 19:28340958-28340980 TATTTTACAGATGGGGAACCTGG + Intergenic
1164709477 19:30345153-30345175 TATTTTGCAGATGAGGAAACTGG + Intronic
1164775750 19:30852324-30852346 CATTTTCCAGCTGGTCAACTTGG - Intergenic
1165791359 19:38494575-38494597 CATCGTGCAGATGGGCCCCCAGG + Exonic
1165943379 19:39426642-39426664 CATTTTGTAGATGAGAAAACCGG - Exonic
1166514225 19:43433875-43433897 CATTTTAAAGATGGGGAAGCTGG - Intergenic
1166708889 19:44924655-44924677 CATTGTACAGATGGGGAAACAGG - Intergenic
1166795453 19:45423100-45423122 CATTTCACAGATGGGGAAACTGG + Intronic
1167023496 19:46896723-46896745 CATTTTACAGATGAGAAAACAGG - Intergenic
1167333434 19:48870275-48870297 CATTTCACAGATGGGGAAACAGG - Intergenic
1167632537 19:50634459-50634481 CATTTTACAGATGAGAAAACAGG + Intronic
1167850097 19:52194738-52194760 CATTTTGCAGATGAGGAATCTGG - Intronic
1168307649 19:55444045-55444067 CATTTTACAGATGGGGGACTTGG - Intergenic
925729449 2:6907605-6907627 CATTTTGCTGATGAGGAAACTGG - Intergenic
926088504 2:10035149-10035171 CATTTTACAGATGAGAAAACAGG + Intergenic
926411536 2:12608218-12608240 CACTTTGGAGATACGCAACCTGG - Intergenic
926684605 2:15689424-15689446 CATTCTGGAGATGGGCAAACCGG + Intergenic
926918023 2:17911865-17911887 CGTTTTGCAGATGGAGAAACTGG - Intronic
927513631 2:23659622-23659644 CATTTTCCAAATGGGGAAACAGG - Intronic
927530158 2:23789806-23789828 CATTTTACAGATGGGGAAACTGG + Intronic
928190774 2:29165104-29165126 CATTTTGCAGATGAAGAAACGGG + Intronic
928220599 2:29399869-29399891 CATTTTACAGATGAGAAAACAGG + Intronic
928413617 2:31073163-31073185 CATTTTGCAGACGAGGACCCTGG - Intronic
928590054 2:32805191-32805213 CATTGTGCAGATGAACAAACTGG - Intronic
929103971 2:38345837-38345859 CATTTTCCAGATGAGAAAACAGG - Intronic
929430626 2:41883331-41883353 CATTTTACAGATGAGAAAACTGG - Intergenic
930024137 2:47020184-47020206 CATTTTGCAGATGAGGACCTTGG + Intronic
930026714 2:47033637-47033659 CTTTTGGCAGATGAGCAAACAGG - Intronic
930299764 2:49600627-49600649 CATTTTTCAGATGAGAAAACTGG + Intergenic
930300714 2:49612207-49612229 AATTTTACAGCTGGGCCACCGGG - Intergenic
930358907 2:50353539-50353561 CATTTTCCAGATGAGGAAACTGG - Intronic
930666434 2:54103628-54103650 CATTTTACAGATGAGAAAACTGG - Intronic
930736773 2:54787668-54787690 CATTTTGCTCATGGGGAACTTGG + Intronic
930856241 2:56021861-56021883 CCTTTTACAGCTGGGGAACCAGG - Intergenic
931358811 2:61560210-61560232 CATTTTACAGATGGGGAGGCTGG - Intergenic
932316559 2:70788187-70788209 CATTTTGCAGATGAACAAACAGG - Intronic
932484274 2:72073158-72073180 AATTTTGCAGCTGGGCTGCCAGG + Intergenic
932501321 2:72185347-72185369 CACTGTGCAGCTGGGCAAACAGG + Intronic
932609686 2:73189650-73189672 CATTTTACAGATGAGGAAACTGG - Intergenic
933694917 2:85210492-85210514 CAGTTTGCAGATTGTCTACCTGG + Intronic
934476064 2:94594462-94594484 CACTTTGCAGACGGGCAAGTGGG - Intronic
934690685 2:96356558-96356580 CATTTTACAGATGAGGAAACAGG + Intronic
935124854 2:100214422-100214444 CATTTTTCAGATGAAAAACCTGG + Intergenic
935434762 2:103017947-103017969 CATTTTCCAGATGGGCATTTGGG + Intergenic
935824127 2:106926617-106926639 AATTTTACAGCTGGGCCACCAGG + Intergenic
935914085 2:107930090-107930112 CATTTTACAGATGAGGAAGCAGG - Intergenic
935984422 2:108658960-108658982 CATTTTACAGATGGCAAAACAGG - Intronic
936136859 2:109902608-109902630 CATTTTACAGATGGCAAAACAGG - Intergenic
936207838 2:110468877-110468899 CATTTTACAGATGGCAAAACAGG + Intronic
936532126 2:113283705-113283727 CATCTTGCAGATGAGGAAACTGG + Intergenic
937000778 2:118465346-118465368 CATTTTCCAGATGAGTAAACTGG - Intergenic
937019351 2:118635937-118635959 CATTTTGTAGATGGGAAAATAGG - Intergenic
937204695 2:120227967-120227989 CATTTGACAGATGGGGAAACAGG + Intergenic
937236446 2:120434211-120434233 CATTTTGCAGGTGAGGAAACTGG + Intergenic
937285325 2:120747330-120747352 CAATTTGCAGATGGGTAAGCAGG + Intronic
938100423 2:128494295-128494317 CATTTTACAGATGGAGAAACAGG + Intergenic
938247464 2:129789959-129789981 TATTTTGCAGATGTGGAAGCTGG - Intergenic
938763313 2:134444094-134444116 CATTTTACAGATGAGAAAACTGG - Intronic
938842566 2:135177238-135177260 AATTTTACAGCTGGGCCACCAGG + Intronic
939633058 2:144548825-144548847 CATTTTACAGATGGGAAAATAGG + Intergenic
939644773 2:144684108-144684130 CATGTAGTAGCTGGGCAACCCGG + Intergenic
939697643 2:145346497-145346519 CAGTTTGCAGTTGGCCAACAAGG - Intergenic
939966743 2:148617679-148617701 CGTTTTACAGATAGGAAACCTGG + Intergenic
940299701 2:152164137-152164159 AATTTTACAGCTGGGCCACCAGG - Intronic
940613447 2:156020605-156020627 CATTTTTCAGATGAGGAAACGGG + Intergenic
941442470 2:165555378-165555400 CATTTTACAGATGAGGAAACTGG + Intronic
941625775 2:167828787-167828809 CATTTTGCAGATTAGGAAACGGG + Intergenic
942066898 2:172280034-172280056 CATTTTACAGATGAGGAAACTGG - Intergenic
942445124 2:176072457-176072479 CATTTTACAGAGGGGTAAACTGG - Intergenic
942532639 2:176928234-176928256 CATTTTACAGATAGGCAAACTGG + Intergenic
943942967 2:194022685-194022707 AATTTTACAGCTGGGCCACCAGG + Intergenic
944210327 2:197200175-197200197 CATTGTGCAGAAGGACAACTTGG - Intronic
944666001 2:201960297-201960319 CATTTTGCAGAAGAGAAAACTGG - Intergenic
944849489 2:203703606-203703628 CATTTTACAGATGAGAAAACTGG - Intergenic
944933179 2:204541353-204541375 CATTTTGTAGATGAGGAAACTGG - Intergenic
945063506 2:205928714-205928736 CATTTTGCAGATTTGGAAACAGG - Intergenic
945428575 2:209737515-209737537 CATTTTACAGATGAGGAAACTGG + Intergenic
946450031 2:219771855-219771877 CATTTTCCAGTTGGGACACCTGG - Intergenic
947316307 2:228863057-228863079 TATTTTGCAAATGGGGAAACTGG + Intronic
947527278 2:230886375-230886397 CATTTTACAGAAGGGCAAGTTGG - Intergenic
947785206 2:232811941-232811963 CATTTTATGGATGGGCAAACTGG + Intronic
948447061 2:238040994-238041016 CATTTTCCAGATGGGGAAAGTGG - Intronic
1168812964 20:718213-718235 CATTTTGCAAATGAGGAAACAGG - Intergenic
1169056128 20:2622949-2622971 CATTATACAGATGGGGAAACTGG + Intronic
1169231438 20:3891428-3891450 CATTTTACAGATGAGAAAACTGG + Intronic
1169264653 20:4160501-4160523 CATTTTACAGATGAGGAAACAGG - Intronic
1169409700 20:5357210-5357232 CATTTTCCAAATGGGCAAACAGG - Intergenic
1169555680 20:6746984-6747006 CATTTTGCAAATGAGGAAACTGG + Intergenic
1169857726 20:10122153-10122175 CATTTTACAGATGGGTAACCTGG - Intergenic
1169869298 20:10234244-10234266 CATTTTGCAGATATGAAAACTGG + Intronic
1170028587 20:11919126-11919148 CATTTTGTGGTTGGGCCACCAGG + Exonic
1170382118 20:15772347-15772369 CATTTTGTAGATGAGAAAACTGG + Intronic
1170477795 20:16733434-16733456 CATTTTGCAGATGAAGAAACAGG + Intronic
1170508003 20:17048353-17048375 CATTTTGCAGATGAGGAGACTGG - Intergenic
1171506259 20:25636654-25636676 CATTTTGGAGATCAGTAACCAGG + Intergenic
1171986066 20:31662008-31662030 CATTTTGTAGAGGGGAAAGCTGG + Intergenic
1172020520 20:31910617-31910639 CACTTTGCAGATGGGAAAACTGG - Intronic
1172056548 20:32158249-32158271 CATTTTATAGATGGGCAACTGGG - Intronic
1172124784 20:32619057-32619079 CATTTTACAGATGAGGAAACTGG - Intergenic
1172272363 20:33661994-33662016 CATTTTGCAGATGAGAAAACAGG + Intronic
1172611830 20:36258280-36258302 CATTTTGCTGATGGGAAAATGGG + Intronic
1172754581 20:37274175-37274197 CACTTTGCAGATGGGGAAACTGG + Intergenic
1172803269 20:37593258-37593280 CATCTTGCAGATGAGGAAACAGG + Intergenic
1172843428 20:37915575-37915597 CATTTTACAGATGAGGAAACCGG + Intronic
1172879799 20:38192493-38192515 CATTTTACAGATGAGCACGCAGG - Intergenic
1172886317 20:38233509-38233531 CATTTTGCTGATGAGGAAACTGG + Intronic
1172962473 20:38808198-38808220 CATTTTGCAGATGGGAAAACTGG + Intronic
1172986051 20:38990871-38990893 CATTTTACAAATGAGCAATCAGG + Intronic
1173315814 20:41942171-41942193 CATTTTACAGATGAGAAAACTGG - Intergenic
1173353398 20:42265107-42265129 CATTTTGCAGATGAGAAAATGGG + Intronic
1173426134 20:42945246-42945268 CATTTTGCAGGTGAGGAAACTGG + Intronic
1173503239 20:43568281-43568303 CATTATACAGATGGGGAGCCTGG - Intronic
1173560427 20:44001285-44001307 CATTTTGCAGATGAGGGACATGG - Intronic
1173608321 20:44348199-44348221 CATTTTGCAGATGAAGAAACAGG - Intronic
1173858836 20:46268809-46268831 CATTATATAGATGGGCAAACTGG + Intronic
1173908261 20:46644607-46644629 CATTTTTCAGCTGGGGAACTGGG + Intronic
1174459966 20:50675608-50675630 CATTTTGCAGTTGAGGAAACAGG + Intronic
1174519767 20:51120435-51120457 CATTTTACAGATGAGGAAACAGG + Intergenic
1174883975 20:54311278-54311300 CATTTTACAGATGAGAAAACTGG - Intergenic
1175328625 20:58147519-58147541 CATTTTGCAGAAGGGAGAACTGG - Intergenic
1175443326 20:59005405-59005427 CAGTTTGCAGATGAGGAAGCAGG - Intronic
1176885488 21:14250182-14250204 AATTTTACAGCTGGGCCACCAGG - Intergenic
1177782682 21:25637851-25637873 CACTTTGCAGATGAGAAAACTGG - Intergenic
1179152445 21:38820664-38820686 CATTTTACAGATGGGGAAATTGG + Intronic
1179393105 21:41011704-41011726 ATTTTTCCAGATGGACAACCGGG + Intergenic
1180641332 22:17301818-17301840 TATTTTGCTAATGGGCAAACAGG + Intergenic
1180713487 22:17856001-17856023 CATGTTGCACATGGGGAAACAGG - Intronic
1180820526 22:18824075-18824097 CATTTTGCAAAAGGCCAGCCTGG + Intergenic
1181206750 22:21258547-21258569 CATTTTGCAAAAGGCCAGCCTGG + Intergenic
1181536279 22:23547781-23547803 AATTTTACAGCTGGGCCACCGGG - Intergenic
1181808509 22:25389911-25389933 CATTTTACAGATGGGGAGACTGG + Intronic
1181892703 22:26077863-26077885 CCTTTTACAGATGGGGAAACTGG + Intergenic
1181945444 22:26513264-26513286 CATTTTGCAGAAGAGAAAACAGG - Intergenic
1181979049 22:26753090-26753112 CATTTTACAGATGAGCAAACTGG + Intergenic
1181987860 22:26813582-26813604 CATTTTACAGATGGAGAAACCGG + Intergenic
1182279277 22:29208682-29208704 CATTTTACAGAGGGGGAAACAGG - Intronic
1182628031 22:31662537-31662559 CATTTTACGGATGGGGAAACTGG + Intergenic
1182753851 22:32662590-32662612 CATTTTACAGATGAGGAACTTGG - Intronic
1183202001 22:36391804-36391826 CATTTTGCAGATAAGGAAACAGG - Intergenic
1183218674 22:36497755-36497777 CATTTTGCAGATGAGGAAGAAGG + Intronic
1183346501 22:37311194-37311216 CATTTTACAGATGGGGAAAACGG + Intronic
1183415288 22:37678290-37678312 CATTGTACAGATGAGCAAACAGG + Intronic
1183431687 22:37769614-37769636 CATTTTACAGATGAGCTACTGGG - Intronic
1183445991 22:37855483-37855505 CATTTTACAGATGAGGACCCAGG - Intronic
1183471186 22:38007561-38007583 CATTTTGCAGACGTGAAAGCGGG - Intronic
1183670713 22:39270773-39270795 CATTTTACAGGTGGGGAAACAGG - Intergenic
1183950742 22:41351388-41351410 CATTTTGCAGATGGACAAAGTGG + Intronic
1184036502 22:41920568-41920590 CATTTTGCAGATGGGAAGAGGGG + Intergenic
1184109393 22:42386052-42386074 CACTTTACAGATGAGCAAACAGG + Intronic
1184400850 22:44273200-44273222 CATTATGCACAGGGGCAAGCTGG + Intronic
1184421025 22:44382996-44383018 CATTTTGCAGATGAGGACACGGG - Intergenic
1184448702 22:44570111-44570133 CATTTTGGAGACTGGAAACCTGG - Intergenic
1184473487 22:44708644-44708666 CATTTTGCAGATGAGCAAACAGG + Intronic
1184617758 22:45649629-45649651 CATTTTGCAGGTGAGGAACTTGG + Intergenic
1184670345 22:46009004-46009026 CATTTTACAGATGAGAAAGCCGG - Intergenic
1184800220 22:46754448-46754470 CATTTTACAGGTGGGAAAACGGG + Intergenic
1184860854 22:47172717-47172739 CATTTTGCAGAGGAGGAAGCTGG + Intronic
1184867675 22:47210450-47210472 CATTTTGCAGATGGGCCGAATGG + Intergenic
1203220174 22_KI270731v1_random:36876-36898 CATTTTGCAAAAGGCCAGCCTGG - Intergenic
1203270652 22_KI270734v1_random:49950-49972 CATTTTGCAAAAGGCCAGCCTGG + Intergenic
949211835 3:1512262-1512284 CATTTTGCAGAGGTGAAAACTGG - Intergenic
949571027 3:5293424-5293446 CATTTTACAGATGAGAAAACAGG - Intergenic
949647147 3:6108867-6108889 CATTTTGCAGATGAGGGAACTGG - Intergenic
949866904 3:8554231-8554253 CATTTCGCAGATGAGGACCCTGG + Intronic
950077900 3:10200193-10200215 CATTTTACAGATGGGGAGGCCGG + Intronic
950104129 3:10377551-10377573 CACTTTGCAGCTGGGCCAGCGGG + Intronic
950143370 3:10630655-10630677 CATTTTACAGATGAGGAAACTGG - Intronic
950185935 3:10945572-10945594 CATTTTACAGATGTGCACACAGG + Intergenic
950258179 3:11522965-11522987 CATTTTACAGATGAGAAAACAGG - Intronic
950283899 3:11729929-11729951 CATTATGCAGATGAGAAAACAGG + Intergenic
950326825 3:12118454-12118476 CATTTTACAGATGAGGAAACAGG + Intronic
950463221 3:13138078-13138100 CATTTTGCATATGGAGAAACAGG - Intergenic
950549288 3:13656452-13656474 CATTTTACAGATGGGGAGCCTGG - Intergenic
950563624 3:13750747-13750769 CATTGTGCAGATGGGGAAGTTGG - Intergenic
950887971 3:16377299-16377321 CATTTTACAGCTGAGCAAACTGG - Intronic
951240750 3:20283440-20283462 AATTTTACAGCTGGGCCACCAGG - Intergenic
951526823 3:23661305-23661327 CATTTTACAGATGAGAAAACAGG + Intergenic
951845962 3:27084850-27084872 CATTTTACAGATGAGAAAACAGG - Intergenic
952308291 3:32164584-32164606 CATTTTACAGATGGGCAAACAGG + Intronic
952330741 3:32362461-32362483 CATTTTGCAGATGAAGAAACTGG + Intronic
952350367 3:32530007-32530029 CATTTTGCAGATGAGGAAATGGG - Intronic
952682767 3:36114120-36114142 CATTTTACAGATGAACAAACAGG + Intergenic
952818496 3:37466011-37466033 CATTTTACAGATAGGGAAGCAGG - Intronic
952948041 3:38494332-38494354 AATTTTACAGGTGGGCAAACAGG + Intergenic
952970371 3:38647047-38647069 CGTTTTGCAGATGGTGAAACTGG - Intronic
953153363 3:40345252-40345274 CTTTTTTCACATTGGCAACCTGG + Intergenic
953689739 3:45107650-45107672 CACTTTACAGATGAGCAACTGGG + Intronic
953735877 3:45493561-45493583 CATTTTTCAGATGAGTAACTAGG - Intronic
953846631 3:46432571-46432593 AATTTTACAGCTGGGCCACCAGG - Intergenic
953882093 3:46695891-46695913 CATTTAGCAGATAGGAAAACTGG - Intergenic
953955019 3:47225197-47225219 CATATTTCAGAAGGTCAACCAGG + Intergenic
954070842 3:48141775-48141797 CATTTTCCAGATGGACAGACAGG - Intergenic
954427662 3:50451867-50451889 CATTTTGCAGGTGGGATACTGGG + Intronic
954450668 3:50569650-50569672 CATAGTGCAGATGGGGAAACAGG + Intronic
954565244 3:51594419-51594441 CATTTTACAGATGGGGAAACTGG + Intronic
954649021 3:52148806-52148828 CATTTTGCAGATGAGGAAATGGG - Intronic
954792353 3:53142786-53142808 CATTTTATAGATGGGGAAACAGG - Intergenic
954807248 3:53227686-53227708 CATTTTACAGATAGGAAAACAGG + Intronic
955011979 3:55026439-55026461 GAGTTTGCAGATGAGTAACCAGG + Intronic
955026815 3:55175571-55175593 CTTTTTGCAGATGAGAAAACAGG + Intergenic
955216298 3:56987294-56987316 CATCTTGCAGATGAGGAATCTGG + Intronic
955689551 3:61577932-61577954 CATTTCACAGATGGGTAAACAGG - Intronic
956184294 3:66547666-66547688 CCTTTTGCAGATGAGCAGACTGG - Intergenic
956870090 3:73408248-73408270 TATTTTGCAGATGAGAAAACTGG - Intronic
957238476 3:77625981-77626003 CATTTATCAGGTGGGTAACCTGG - Intronic
957659907 3:83136056-83136078 CATTTTACAGAATGGCAGCCAGG + Intergenic
958116825 3:89231575-89231597 CATCATGCAGATGGATAACCTGG + Intronic
958575096 3:95939120-95939142 CATTTTACAGATGATGAACCTGG - Intergenic
958756395 3:98254542-98254564 AATTTTACAGCTGGGCCACCAGG + Intergenic
959885989 3:111500766-111500788 CACTTTGCAGCTTGGCAACTAGG - Intronic
959981216 3:112519773-112519795 CATTTTGTAGATGTGGAACCTGG + Intergenic
960151246 3:114251083-114251105 CATTTTGCAGATGAGGAAATGGG - Intergenic
961595146 3:128009965-128009987 CATTTTACAGATGGGGCAACAGG - Intergenic
962503920 3:136026912-136026934 CATTATTCACATGGGGAACCGGG - Exonic
962616069 3:137127919-137127941 CATTTTACAGATGAGGAAACTGG - Intergenic
962923510 3:139971869-139971891 CATTTTGCAGATGGTGACACTGG - Intronic
963020706 3:140870386-140870408 CATTTTACAGATGAGAAACTGGG + Intergenic
963514991 3:146298401-146298423 CATTTTACAGATGGAAAAACTGG + Intergenic
963664068 3:148159828-148159850 AATTTTGAAGCTGGGCATCCAGG - Intergenic
963861838 3:150319432-150319454 CATTTTACAGATGGAGAAACTGG + Intergenic
964180190 3:153874344-153874366 AATTTTACAGTTGGGCCACCAGG + Intergenic
964390373 3:156190583-156190605 CATTTTGCAGATGAGGAACCAGG - Intronic
964679909 3:159327192-159327214 GACTTTGGAGCTGGGCAACCAGG + Intronic
965071544 3:163922158-163922180 CACTTTGAAGATGGCCAAGCAGG + Intergenic
965614428 3:170578561-170578583 CATTTTACAGATGAGAAACCTGG - Intronic
965810295 3:172584807-172584829 CCTTTTGCAAATGGGAAAACGGG - Intergenic
965942335 3:174200169-174200191 CATTTTACAGATGAGGAAACAGG - Intronic
966243693 3:177782314-177782336 CATTTTGCAGCTGAGAAAACAGG - Intergenic
966412400 3:179657098-179657120 CATTTTACAGATGGAGAAACTGG - Intronic
967216653 3:187216430-187216452 CCTTTTACAGGTGAGCAACCTGG - Intergenic
967230700 3:187335061-187335083 TATTTTACAGATGAGCAAACAGG + Intergenic
967296149 3:187967122-187967144 CATTTTACAAATGAGCAACTAGG - Intergenic
967389456 3:188941246-188941268 CATTTTGCACAAGGGGAAGCGGG + Intergenic
967398240 3:189030826-189030848 CATTTTACAGATGAGGAAACTGG + Intronic
967511877 3:190322259-190322281 GAGTTTGCAGGTGGGCAACCCGG + Exonic
967539773 3:190652871-190652893 CATTTTGCATATGATCTACCTGG + Intronic
967702353 3:192607983-192608005 CATTTTACAGATGAGAAAACTGG + Intronic
967786465 3:193502271-193502293 CATTTTGTAGATGAGAAAACAGG + Intronic
967934758 3:194718053-194718075 CATTTTACAGATGAGCAAACAGG + Intergenic
968854400 4:3108497-3108519 CAGTGTACAGATGGGCAAACTGG - Intronic
969095359 4:4728744-4728766 CATTTTGCTGATGAGGAGCCAGG - Intergenic
969118975 4:4893050-4893072 TATTTTGCAGATGGGGAAATGGG - Intergenic
969175437 4:5395357-5395379 CATTTTGCAGATGAGGAAGTAGG - Intronic
969364364 4:6685629-6685651 CATTTTACAGATGAGAAAACTGG + Intergenic
969838912 4:9866136-9866158 CATTTTACAGATGAGAAAGCTGG - Intronic
969846414 4:9923518-9923540 CATTTTGCAGATGGACAGAGGGG + Intronic
970057936 4:11996442-11996464 AATTTTACAGCTGGGCCACCCGG + Intergenic
970362261 4:15321875-15321897 CCTTTTGCAGATGAGGAAACCGG + Intergenic
970419016 4:15887575-15887597 GACTTTGCAGATGGGAAAACAGG - Intergenic
970474986 4:16412955-16412977 CATTTTACAGATGAGGAAACTGG + Intergenic
971071070 4:23092326-23092348 CATTTTGCAGATGAGGAAATTGG - Intergenic
971312166 4:25534756-25534778 CATTTTACAGATGGTAAAACAGG - Intergenic
971326531 4:25648786-25648808 CATTTTGCAGATGAGGAGTCTGG - Intergenic
971332217 4:25691346-25691368 AATTTTACAGCTGGGCCACCGGG + Intergenic
972670503 4:41210317-41210339 CATTTTACAGATGGGAAAACAGG + Intronic
972708292 4:41567629-41567651 CATTTTATAGATGAGGAACCTGG + Intronic
973799953 4:54467545-54467567 AATTTTACAGCTGGGCCACCGGG - Intergenic
973876286 4:55222914-55222936 CATTTTACAGATGAGGACCCTGG - Intergenic
974999218 4:69199115-69199137 AATTTTACAGCTGGGCTACCGGG - Intronic
975016235 4:69424480-69424502 AATTTTACAGTTGGGCCACCGGG + Intergenic
975509571 4:75178821-75178843 CATTTTGAAGATAGGGAAGCAGG + Intergenic
975601549 4:76105368-76105390 CATTTTACAGATGTGAAAGCAGG - Intronic
975691814 4:76972900-76972922 CATTTTACAGATGAGAAAACAGG + Intronic
975729075 4:77320064-77320086 AATTTTACAGCTGGGCCACCAGG + Intronic
975839347 4:78457172-78457194 CCCTTTGCTGATGGGCAACCTGG + Intronic
976570843 4:86608677-86608699 CATTTTGCATCTAGGCAATCTGG + Intronic
976741770 4:88364078-88364100 AATTTTACAGCTGGGCTACCAGG + Intergenic
978401015 4:108330648-108330670 CATCAGGCAGATGGGAAACCTGG + Intergenic
978545267 4:109865174-109865196 CATTTTGCCGATGAGAAAACAGG + Intronic
978594274 4:110359895-110359917 CATTTTACAGATGAGGAAACTGG + Intergenic
978818913 4:112942460-112942482 CATTTTGTAGATGAGAAAACTGG + Intronic
979773086 4:124554161-124554183 CATTCTGAAGGTGGGCAACTTGG + Intergenic
981228667 4:142326866-142326888 CATTTTACAGATGAGAAAACTGG + Intronic
981404394 4:144351323-144351345 CATTTTACAGATGAGAAAACAGG + Intergenic
981565291 4:146094856-146094878 CATTTTGCATTTGTGCAACAAGG - Intergenic
981573388 4:146177126-146177148 TATATTGCAGATGAGGAACCTGG + Intronic
981689679 4:147493813-147493835 ATTTTTGCAGAAGAGCAACCTGG + Intronic
981936874 4:150248626-150248648 CATTTTGCAGATAAGGAAACTGG - Intronic
982054496 4:151534208-151534230 CATTTTACAGATGAGAAAACTGG - Intronic
982063021 4:151623682-151623704 CATTTTGCAGAGGAGGAAACAGG + Intronic
982070828 4:151692974-151692996 CATTTTGCAGAGGCGCACACTGG + Intronic
982166129 4:152615059-152615081 CATTTTGCAGATAGGGAAACTGG - Intergenic
982191213 4:152857489-152857511 CATTTTACAGATGAGAAAACTGG - Intronic
982766467 4:159354668-159354690 CATTTTACAGATGAGGAAACAGG - Intronic
983357839 4:166686969-166686991 CATTTTACAGATGAGGAAACAGG - Intergenic
983759476 4:171387286-171387308 AATTTTACAGCTGGGCCACCAGG + Intergenic
983884906 4:172969958-172969980 AATTTTACAGCTGGGCAGCCAGG + Intronic
984581714 4:181517477-181517499 CATTTTGCAGAGGTACAGCCTGG - Intergenic
984827506 4:183939787-183939809 CATCTTGCAGATGAGGAAACTGG - Intronic
984833145 4:183994646-183994668 CATTTTACAGATGAGGAAACGGG + Intronic
984959034 4:185076645-185076667 CATTTTACAGATGAGAAAACTGG + Intergenic
984999539 4:185470704-185470726 CATTTTGCAGATAAGGAAACGGG - Intronic
986375050 5:7122509-7122531 CATTTTGCAGATAAGAAAGCTGG - Intergenic
986592997 5:9390927-9390949 CATTTTGCAGATGTGGAGACAGG + Intronic
986681830 5:10240551-10240573 CACTTTGCAGATGAGAAAACAGG - Intronic
987024461 5:13910294-13910316 CATTTTGCAGAGGAGGAAACTGG - Intronic
987577302 5:19746365-19746387 CATTTTTAAGATGTGCAAACTGG - Intronic
988446478 5:31291500-31291522 CATTTTGCAGATAAGAATCCTGG + Intronic
988540735 5:32106536-32106558 CATTTTGCAGATGAGAAAACTGG + Intronic
988586447 5:32511629-32511651 CATTTTGCAGATGAGGAAACTGG + Intergenic
988734851 5:34010163-34010185 AATTTTACAGCTGGGCCACCAGG + Intronic
988875091 5:35435727-35435749 CATTTTGCAGATGAAGAAACTGG - Intergenic
989026530 5:37074688-37074710 CATTTTGCAGCTGGGCACCATGG + Intergenic
989096820 5:37789475-37789497 CATTTTACAGATGGGGAAGCTGG + Intergenic
989164210 5:38418760-38418782 CATTTTACAGATGAGGAAACTGG + Intronic
989193741 5:38695684-38695706 CATTCTGCAGATGGGGAAAGAGG - Intergenic
989844207 5:46119670-46119692 CATTTTGCAAATGGACAATTGGG - Intergenic
990219050 5:53566503-53566525 CATTTTTCAGATGAGGAAACAGG + Intronic
990704595 5:58514249-58514271 AATTTTACAGCTGGGCCACCGGG - Intergenic
991123305 5:63041527-63041549 CATTTTACAGATGGGAAAATTGG - Intergenic
992620296 5:78585820-78585842 CATTTTACAGATGGGGAGACTGG + Intronic
994066916 5:95554046-95554068 CATATTGCAGATAGGAAAACAGG - Intronic
994659788 5:102640126-102640148 CATTTTGCAGGTGAGGAAACAGG + Intergenic
995067130 5:107875160-107875182 CATTTTGGCTATGGGCAACCTGG + Intronic
995090126 5:108164739-108164761 CATTTTACAGATGAGAAACAGGG + Intronic
995458718 5:112379605-112379627 CCTTTTGCAGATGAGAAAGCAGG - Intronic
995751364 5:115456465-115456487 CATTTTACAGATGAGGAAACAGG + Intergenic
996667244 5:126073783-126073805 AATTTTACAGTTGGGCCACCAGG - Intergenic
997387886 5:133487994-133488016 CCTTTTGCAGATGGGAAAACTGG + Intronic
997397808 5:133578370-133578392 CGTTTTACAGATGGGCAAACTGG - Intronic
997658927 5:135575469-135575491 CATTTTACAGATGGCCAAACTGG - Intronic
997695111 5:135855471-135855493 CATTTTACAGATGAGAAAACAGG + Intronic
997728769 5:136147627-136147649 CATTTTACAGATGAGAAAACAGG - Intronic
997732198 5:136189994-136190016 CATTTTGCAGATGAGGAAATAGG + Intergenic
997888111 5:137649691-137649713 CATTTTGCAGATGAGGAAGTTGG - Intronic
998404645 5:141867433-141867455 CATTTTGCAGATGAGAAACCGGG - Intronic
998499893 5:142623211-142623233 CATTTTGCAGATGAGGAAACTGG - Intronic
998560966 5:143171232-143171254 CATTTTACAGATGGGGAAACTGG + Intronic
998608998 5:143667277-143667299 CATTTTGCAGCTGAGAAAACAGG + Intergenic
998952000 5:147401849-147401871 CATTTAGCAGATAGGAAAGCAGG - Intronic
999083637 5:148867537-148867559 CATTTTACAGATGAGAAAGCAGG - Intergenic
999150555 5:149423584-149423606 CATTTTGCAGAAGGGAAAACTGG - Intergenic
999175828 5:149631025-149631047 CATTTTGCAGGTGGTAAAACAGG + Intronic
999185164 5:149701934-149701956 CATTTTGCAGATAAGAAAACTGG - Intergenic
999448284 5:151658998-151659020 CATTTCCCAGATGGGGAAACAGG - Intergenic
999452556 5:151689301-151689323 CTTTTTTCAGATGGGCAAGTCGG - Intergenic
999468247 5:151827543-151827565 CATTTTGCACATGAAGAACCTGG + Intronic
999511118 5:152252809-152252831 CATTTTGCAAATGAGAAGCCTGG - Intergenic
999664281 5:153896433-153896455 CATTTTACAGATGAGGAAACTGG - Intergenic
999702742 5:154243091-154243113 CATTTTGCAGATGGGAGAGAAGG - Intronic
999742519 5:154567062-154567084 CATTTTACAGATGAGGAAACAGG - Intergenic
1000203926 5:159038896-159038918 CATTTTGTAGATGGGGGCCCAGG - Intronic
1000205409 5:159053231-159053253 CATTTTACAGATGAGGAAACTGG - Intronic
1000254632 5:159526115-159526137 CATTTTACAAATGGGAAATCTGG + Intergenic
1000294753 5:159903506-159903528 CATTTTACAGATGAGGAAACTGG + Intergenic
1000605497 5:163323137-163323159 CATTTTGCTAATGAGCAAACAGG - Intergenic
1001163833 5:169345332-169345354 CATTTTACAGATGAGGAAACTGG - Intergenic
1001220202 5:169894191-169894213 CATTTTGCAGATGAGGGAACTGG + Intronic
1001222034 5:169908912-169908934 CATTTTGCAGATGAGAAAACAGG + Intronic
1001516304 5:172357550-172357572 CATTTTACAGATGAGGAAACAGG - Intronic
1001544953 5:172565312-172565334 CATTTTACAGATGGGAAAACAGG - Intergenic
1001550823 5:172601153-172601175 CATTTTACAGGTGGGGAAACAGG + Intergenic
1001560670 5:172666914-172666936 CATTTTACAGATGGGAAAATGGG - Intronic
1001875027 5:175192688-175192710 CATTTTACAGATGAGCAAAGAGG + Intergenic
1001901898 5:175438322-175438344 CATTTCACAAATGGGCAAACAGG + Intergenic
1001966302 5:175912089-175912111 CATTTTGCAGATGGAAAATGAGG - Intergenic
1002048474 5:176555421-176555443 CATTTTGCAGATGAGCAAACAGG - Intronic
1002087567 5:176785497-176785519 CATTTGACAGATGAGGAACCTGG - Intergenic
1002101739 5:176861311-176861333 CATTTTGCAGGTGAGGAAACAGG + Intronic
1002250645 5:177927114-177927136 CATTTTGCAGATGGAAAATGAGG + Intergenic
1002447913 5:179301430-179301452 CATTTTACAGATTGGGAAACAGG + Intronic
1002559142 5:180069677-180069699 CATTTTACAGATGAGCAAACAGG + Intronic
1002564720 5:180104347-180104369 CATTTGGCAGATGGGCAAAAAGG - Intronic
1002666489 5:180829478-180829500 AATTTTACAGCTGGGCCACCGGG - Intergenic
1003800873 6:9665464-9665486 CATTTTACAGATGGGAAAACTGG - Intronic
1003923348 6:10854360-10854382 AATTTTACAGCTGGGCCACCAGG - Intronic
1004900869 6:20192756-20192778 CATTTTGCAGATAAGGAATCAGG + Intronic
1005354147 6:24966576-24966598 CATTGTGCAGATATGCAACCAGG + Intronic
1005890911 6:30137042-30137064 CCCTTTGCAGAAGGACAACCAGG + Exonic
1006041926 6:31263281-31263303 AATTTTACAGTTGGGCCACCAGG + Intergenic
1006099579 6:31678097-31678119 CATTTTACAGATGAGGAAACAGG - Intronic
1006366351 6:33618387-33618409 CATTTAACAGATGAGCAAACAGG + Intergenic
1006410702 6:33871731-33871753 CATTTTACAGAAGGAAAACCTGG - Intergenic
1006804245 6:36778111-36778133 CATTTTACAGATGAGAAAACAGG + Intronic
1006811406 6:36822639-36822661 CACTTTACAGATGGGAAAACAGG + Intronic
1007228250 6:40329608-40329630 CATTTTGCTGATGAGAAACCAGG + Intergenic
1007283353 6:40729092-40729114 GAGTATGCAGCTGGGCAACCTGG + Intergenic
1007415502 6:41689086-41689108 CATTTTGCAGCTGAGAAAACTGG + Intronic
1008010109 6:46457401-46457423 CAATTTACAGATGGGAAAACAGG + Intronic
1008071842 6:47106098-47106120 CATTTTACAGATGAGAAAACTGG - Intergenic
1008476122 6:51937708-51937730 CATTTTACAGATGGAGAAACTGG - Intronic
1009564632 6:65297610-65297632 AATTTTGCAGATGAGAAAACAGG - Intronic
1009720136 6:67458091-67458113 AATTTTACAGCTGGGCCACCGGG + Intergenic
1010002337 6:70959669-70959691 CATTTTCCAGATGAGGAAACAGG - Intergenic
1010110957 6:72231017-72231039 CATTTTGCAGCTATGCCACCTGG + Intronic
1010144639 6:72652859-72652881 CATTTTCTAGATGGGAAAACTGG - Intronic
1011042867 6:83050397-83050419 CATTTTGCAGATGAGGAAACTGG + Intronic
1011590821 6:88969194-88969216 AATTTTACAGCTGGGCCACCAGG + Intergenic
1011603245 6:89079327-89079349 CATTTTACAGCTGGGGAAACAGG - Intergenic
1011608598 6:89128733-89128755 AATTTTACAGCTGGGCCACCGGG - Intergenic
1011725471 6:90206172-90206194 CATTTTACAGATGGGGAAATTGG + Intronic
1012138151 6:95584787-95584809 AATTTTACAGTTGGGCCACCGGG - Intronic
1012168619 6:95990337-95990359 AATTTTACAGCTGGGCCACCAGG - Intergenic
1012264943 6:97130266-97130288 CATTTTACAGATGAGAAAACTGG + Intronic
1012953849 6:105547438-105547460 CATTTTACAGATGGGAAAACAGG - Intergenic
1013230596 6:108158116-108158138 CATTTTACAGATGGGTAAAACGG - Intronic
1013287025 6:108690666-108690688 CATTTTCCAGAGGGGAAACTCGG + Intergenic
1013761974 6:113529443-113529465 CATTTGGAAGATGGCCAACATGG + Intergenic
1015084693 6:129275847-129275869 CATTTTGCAGAATGGGAAACAGG + Intronic
1015943262 6:138473430-138473452 CATTCTGCAGAGGGGCACGCAGG + Exonic
1016531322 6:145060712-145060734 CATTTTACAAATGGGCAAGATGG + Intergenic
1017574550 6:155787577-155787599 CATTTTGCAGATGGACAGGAGGG + Intergenic
1017641166 6:156495194-156495216 CATTTTGCAGATGAGAAAACTGG - Intergenic
1018185381 6:161261953-161261975 CATTTCACAGATGGGGAGCCTGG - Intronic
1018774956 6:167006056-167006078 CATGTTGCAGATAAGGAACCTGG - Intronic
1018791127 6:167148579-167148601 CATTTTACAGATAAGCAAACTGG - Intronic
1018977844 6:168579060-168579082 CATCCTGCAGATGGGGAAACAGG + Intronic
1019992248 7:4700433-4700455 CACTTTACAGATGGGCAAACAGG - Intronic
1020039752 7:4993037-4993059 CATTTTACAGATGGAGAAACAGG - Intronic
1020129618 7:5552339-5552361 CATTTTACAGATGAGAAAACAGG - Intronic
1021564605 7:22004483-22004505 CTTTTTGCAGATGAGAAAACAGG + Intergenic
1021800442 7:24300176-24300198 CATTTTACAGATGAGGAAACAGG + Intergenic
1022025677 7:26445620-26445642 CATTTTACAGATGAGGAAACTGG - Intergenic
1022069009 7:26892146-26892168 CATTTTTCAGATGAGTAAACTGG - Intronic
1022191893 7:28024540-28024562 CATTTTGAAGATGAGGAAACAGG + Intronic
1022233607 7:28439551-28439573 CAGTTTGCAGAGGAGGAACCTGG + Intronic
1022358104 7:29634899-29634921 CATTTTACAGATGAGGAAACAGG + Intergenic
1022368372 7:29747501-29747523 CATTTTACAGATGAGGAAACAGG + Intergenic
1023008886 7:35907494-35907516 CCTTTTGCAGATGAGGAAACAGG - Intergenic
1023095131 7:36652553-36652575 GACTTTGCAGTTGGGAAACCTGG + Intronic
1023603824 7:41909034-41909056 AATTTTGCAGCTGGGCTGCCAGG + Intergenic
1023827349 7:44018568-44018590 CATTTTCCAGATGAGGAAACAGG + Intergenic
1024214280 7:47233428-47233450 CATTTTACAGATGAGCAGACAGG - Intergenic
1024694914 7:51846023-51846045 AATTTTACAGTTGGGCCACCAGG - Intergenic
1025584247 7:62762137-62762159 CATTCTGCAGATGGACATTCGGG - Intergenic
1025834934 7:65085571-65085593 CACTTTCCAGATGGGGAAACGGG - Intergenic
1025904703 7:65775050-65775072 CACTTTCCAGATGGGGAAACGGG - Intergenic
1026367623 7:69665046-69665068 CATTTTGCAAATGGTAAAACAGG + Intronic
1026491986 7:70871254-70871276 CATTGTACAGATGGGAAAACAGG - Intergenic
1026788373 7:73316325-73316347 CACTTTACAGATGAGGAACCTGG + Intronic
1026836934 7:73645862-73645884 CATTTTACAGATGAGGAAACAGG - Intergenic
1028426059 7:90690368-90690390 CATTTTACAGATGTGAAACCTGG - Intronic
1028513038 7:91645768-91645790 CATTTTTCAAGTGGGAAACCTGG + Intergenic
1028776842 7:94687293-94687315 CATATGGCAGAAGGGCAAACAGG + Intergenic
1029738504 7:102478314-102478336 CATTTTCCAGATGAGGAAACAGG + Intronic
1029755634 7:102571977-102571999 CATTTTCCAGATGAGGAAACAGG + Intronic
1029773583 7:102671057-102671079 CATTTTCCAGATGAGGAAACAGG + Intronic
1029942954 7:104499268-104499290 CATTTTGCAAATGAGCAAATAGG - Intronic
1030383172 7:108836467-108836489 CATTTTACAGATGGAAAACTTGG - Intergenic
1030497605 7:110319271-110319293 AATTTTACAGATGAGGAACCTGG + Intergenic
1030848214 7:114449034-114449056 CATTTTGGAGATGAGGAAACTGG - Intronic
1031085573 7:117298843-117298865 CATTTTATAGATGAGGAACCAGG + Intronic
1031162145 7:118181082-118181104 CATTTTACAGATGGGGAAACAGG + Intergenic
1031343374 7:120633619-120633641 CATTTTACAGATGAGGAAACTGG + Intronic
1031446035 7:121855557-121855579 CATTTTGTAGATGACCAATCAGG - Intergenic
1031468467 7:122143012-122143034 CATTTTGCAGAATGGCCACCAGG + Intronic
1031602153 7:123723046-123723068 CATTTTATAGATGGGAAAACAGG - Intronic
1031789096 7:126077102-126077124 CATTTTGCAGATGGGCTTGTTGG - Intergenic
1031978622 7:128109605-128109627 AATTTTGCAGCTGGGCCGCCGGG + Intergenic
1032036838 7:128527775-128527797 CAGTTTTCAGATGAGGAACCTGG + Intergenic
1033234759 7:139629522-139629544 CATTTTCCAGATGGGGAAACAGG + Intronic
1034251811 7:149698269-149698291 AATTTTACAGCTGGGCCACCGGG - Intergenic
1034744169 7:153507672-153507694 CTTTTTGCAGATGAGGAAGCTGG + Intergenic
1034840957 7:154396249-154396271 CATTCTACAGATGAGAAACCAGG + Intronic
1034960284 7:155360459-155360481 CATTTTGCAGATGAGGCCCCGGG - Intronic
1035314505 7:157989753-157989775 CACTTCACAGATGGGAAACCGGG + Intronic
1035472804 7:159120965-159120987 CTTTTTGCAGAGGGTCAGCCAGG - Intronic
1036580039 8:10065318-10065340 CATTCTGAGGATGGGCCACCAGG - Intronic
1037132865 8:15427572-15427594 CATTTGGAAGAAGGCCAACCAGG - Intronic
1037517640 8:19649163-19649185 CATTTTGCAGATGAGAAAAATGG + Intronic
1038197653 8:25382834-25382856 TCTTTTCCAGATGGGCAACAGGG + Intronic
1038230020 8:25691104-25691126 CATTTTACAGATGAGGACCCTGG + Intergenic
1038777824 8:30546828-30546850 CATTTTACAGATGAGGAAACAGG + Intronic
1039183071 8:34888103-34888125 AATTTTACAGCTGGGCAGCCAGG + Intergenic
1039449832 8:37663554-37663576 CATTTGGCAGATGAGAAAACTGG + Intergenic
1039465438 8:37782180-37782202 TATTTTGGAGATTGGCAGCCGGG - Intergenic
1039580439 8:38661774-38661796 AATTTTACAGCTGGGCCACCAGG - Intergenic
1039756774 8:40531656-40531678 CATTGTTCAGATGGTAAACCTGG + Exonic
1040804021 8:51374240-51374262 CACTTTACAGATGAGGAACCTGG + Intronic
1040867200 8:52059962-52059984 CATTTTGCAGATTTACAACTAGG + Intergenic
1040892586 8:52332959-52332981 CATTTTGCAGCTGAGCATACTGG + Intronic
1040946966 8:52894231-52894253 CATTTTACAGATAGGAAACTTGG - Intergenic
1041271878 8:56116999-56117021 CATTTTGCAGATAAGGAAACAGG - Intergenic
1041714187 8:60919183-60919205 CATTTTCAAGGTGGGAAACCAGG - Intergenic
1041903056 8:63002961-63002983 CATTATGCAAATGGGAAAACGGG - Intergenic
1042501320 8:69512537-69512559 CATTTTACAGAAAGGCAATCTGG - Intronic
1042510461 8:69605873-69605895 CATTTTACAAATGGGCAGCTGGG + Intronic
1042552197 8:70004078-70004100 CATTTTGCAGATGGGAGAAAAGG + Intergenic
1042944611 8:74142631-74142653 CATTTTGCAGAACGGTAAACCGG - Intergenic
1043442640 8:80289823-80289845 CATTTTACAGATGAGAAAACAGG + Intergenic
1045652408 8:104353385-104353407 GATTTTGCAGCTGGGAATCCGGG - Intronic
1045873555 8:106952647-106952669 CATTTTACAGATGAGGAAACTGG - Intergenic
1045960411 8:107961442-107961464 CATTTTGCAAATAAGAAACCTGG + Intronic
1046031524 8:108787952-108787974 CATTTTACAGATGTGGAAACAGG + Intergenic
1046100824 8:109612153-109612175 CATTTTACAGATAGGAAAACTGG - Intronic
1046494612 8:114997311-114997333 AATTTTACAGCTGGGCCACCAGG - Intergenic
1046504786 8:115123562-115123584 CATTTTTCAGATGAGGAAACTGG + Intergenic
1047268143 8:123327907-123327929 AATTTTGCAGATAAGCAAACAGG + Intronic
1047646731 8:126877852-126877874 CATTTTACAGATGAGAAACTTGG - Intergenic
1047705697 8:127497353-127497375 CATTTTACAGGTGGGAACCCTGG - Intergenic
1047708370 8:127525152-127525174 CATTTTGCAGAGGAGGAAACAGG + Intergenic
1047713840 8:127577391-127577413 CATTTTGCAGATGAGAAAACAGG - Intergenic
1047754284 8:127906861-127906883 CATTTTACAGATGTGAAAACAGG + Intergenic
1047922220 8:129647024-129647046 AATTTTACAGCTGGGCCACCAGG + Intergenic
1047975563 8:130126944-130126966 CATTTTACAGATGAGGAAACTGG - Intronic
1047991793 8:130294053-130294075 CATTTTGCAGATGAGAAAATGGG + Intronic
1048202303 8:132384823-132384845 CATTTTACAGATGGGAAAGTGGG - Intronic
1048233933 8:132672582-132672604 CATTTTGCAGATGAGGAATCTGG - Intronic
1048395074 8:134006497-134006519 CATTTTTCAGATGAGAAAACAGG + Intergenic
1048602117 8:135929676-135929698 AATTTTGCAGCTGGGCCTCCAGG + Intergenic
1048721439 8:137330279-137330301 CATTTTACAGATGGCCAAACTGG - Intergenic
1048836659 8:138525127-138525149 CATTTTCCAGATGAGGAAACAGG - Intergenic
1048927468 8:139283934-139283956 CATTTTGCAAATGAGGAACCCGG + Intergenic
1049000734 8:139824246-139824268 CGTTTTGCAGATGAGGAAACTGG - Intronic
1049001305 8:139827096-139827118 CATTTTAGAAATGGGCAAACAGG - Intronic
1049139925 8:140944503-140944525 CATTTTACAGATGAGAAACTGGG - Intronic
1049971966 9:829453-829475 TATTTTGCAGCTGGGCCACGTGG + Intergenic
1050457694 9:5849388-5849410 CATTTTACAGATGAGCAACCTGG + Intergenic
1051340986 9:16110446-16110468 CACTTTGCAGATGGGTAAAATGG + Intergenic
1051393113 9:16588097-16588119 CATTTTACAGATGAGGAAGCGGG - Intronic
1051658331 9:19403818-19403840 AATTTTACAGCTGGGCCACCGGG - Intergenic
1051688109 9:19679756-19679778 CATCTTGCAGATGGCAAAACTGG + Intronic
1051748691 9:20319252-20319274 CAGTCTCCAGATGGGCAAGCAGG - Intergenic
1051810745 9:21047098-21047120 CATTTTACAGATGAGGAAACTGG + Intergenic
1052406018 9:28061843-28061865 CATTTTACAGATGTGAAAACTGG - Intronic
1053085119 9:35212976-35212998 CATTTTGCAGGTGAGAAACCTGG - Intronic
1053151425 9:35745907-35745929 CATTTTGTAGATGAGGAAACTGG - Intronic
1053295835 9:36912354-36912376 CATTTTACAGATGGGAAACTTGG + Intronic
1053305140 9:36979601-36979623 CATTTTGCAGATGAGAAAATGGG + Intronic
1053416190 9:37948252-37948274 CAATTTGCAGATGAGTAAACAGG - Intronic
1053825825 9:42023223-42023245 CATTTGGAAGAGGGGCAAGCCGG - Intronic
1054604738 9:67164170-67164192 CATTTGGAAGAGGGGCAAGCCGG + Intergenic
1054743463 9:68831403-68831425 CATTTTACAGATGAGAAAACAGG + Intronic
1054969478 9:71068658-71068680 CATGCTGAAGTTGGGCAACCTGG + Intronic
1055348621 9:75362190-75362212 AATTTTACAGCTGGGCCACCGGG + Intergenic
1055416853 9:76092682-76092704 CATTTTACAGATGAGCAAACTGG - Intronic
1055622665 9:78142674-78142696 AATTTTACAGCTGGGCCACCAGG - Intergenic
1056096696 9:83261885-83261907 CATTTTACAGATGAGGAAACTGG - Intronic
1056620063 9:88205110-88205132 CATTTGGCAGAAGGACACCCAGG + Intergenic
1057746472 9:97756033-97756055 CATTTTACAGATAGGGAAGCTGG - Intergenic
1057832154 9:98415724-98415746 CATTTTACAGATGAGGAAACTGG + Intronic
1057840094 9:98479367-98479389 CATTTTACAGATGAGAAACTGGG + Intronic
1057840430 9:98481648-98481670 CATTTTGCAGATGAGGAAACTGG - Intronic
1057859837 9:98632260-98632282 CATTTTGCAGATGAGGAAACTGG - Intronic
1057911032 9:99020906-99020928 CATTTTACAGATGGAGAAACTGG - Intronic
1057914500 9:99045395-99045417 CAATGTGCAGATGGGAAAACAGG - Intronic
1057942536 9:99297502-99297524 CATTTTGCAGGTGAGAAAACAGG + Intergenic
1058139134 9:101339550-101339572 CATTTTACAGATGAGGAAACGGG + Intergenic
1058616009 9:106828408-106828430 CATTTTGCAGATGAAAAGCCTGG + Intergenic
1059073273 9:111162803-111162825 CATTTTACAGATGAGCAGACAGG - Intergenic
1059348791 9:113650029-113650051 CATTTTGCAGATGGAAAAAAAGG - Intergenic
1059407514 9:114110623-114110645 CATTTTACAGATGAGGAAACGGG + Intergenic
1059451247 9:114372644-114372666 CATTTGGCAGATTGGGAAACTGG - Intronic
1059559931 9:115324339-115324361 CATTTTGCAGTTGAAGAACCTGG - Intronic
1059656058 9:116358488-116358510 CATTTTACAGATGGGGAAGCTGG + Intronic
1059825241 9:118020809-118020831 CATTTTACAGATGAGGAAACAGG - Intergenic
1060074454 9:120579349-120579371 CATTTTACAGATGGGAAAGCCGG + Intronic
1060174417 9:121486888-121486910 TCTTCTGCAGATGGGCAAACCGG - Intergenic
1060214617 9:121731292-121731314 CATTTTACAGATGTGAAAACAGG - Intronic
1060283784 9:122231063-122231085 CATTTTGCCGATGAGAAAACAGG - Intergenic
1060932442 9:127497503-127497525 CATTTTACAGATGGGAAAAATGG + Intronic
1060933032 9:127500808-127500830 CATTCTGCAGATGGGAAATGAGG + Intronic
1060968518 9:127724760-127724782 CTTCTTCCAGCTGGGCAACCTGG + Exonic
1061036257 9:128115857-128115879 CATCTTACAGATGAGGAACCTGG + Intergenic
1061063780 9:128264905-128264927 TATTTTGTAGATGGACAACACGG + Intronic
1061079170 9:128360093-128360115 TACTTTGCAGATGGGAAAACAGG - Intronic
1061271791 9:129547932-129547954 CATTTTACAGATGAGCTACCAGG - Intergenic
1061650290 9:132042371-132042393 CATTTTACAGATGAGAAAACAGG + Intronic
1061791727 9:133062722-133062744 CATTTTACAGAAGGGGAAACGGG + Intronic
1061795403 9:133083288-133083310 CATTTTACAGAAGGGGAAACGGG + Intronic
1062023026 9:134327962-134327984 CATTTTGCAGATGAGAAAACTGG + Intronic
1062176431 9:135165793-135165815 CATTTTGCAGATGAGGAGACTGG + Intergenic
1062436233 9:136547722-136547744 CATTTTGCGGAGGGGCGGCCTGG + Intergenic
1186300869 X:8198387-8198409 GATTTTGCAGAGGAGAAACCAGG - Intergenic
1187288580 X:17930474-17930496 CATTTTACAGATGGAGAAACTGG + Intergenic
1187562330 X:20414437-20414459 CACTTTGCAGATGAGTAACCTGG - Intergenic
1187573822 X:20532868-20532890 CATTTACCAGCTTGGCAACCTGG + Intergenic
1187710294 X:22046401-22046423 CACTTTGCAGAAGGACAAGCAGG + Intronic
1187717764 X:22120202-22120224 CATTTTCCAGATGAGGAAACAGG + Intronic
1187862602 X:23696593-23696615 CATTTTGCAGATGAGGAAACAGG - Intergenic
1189169017 X:38891187-38891209 CATTTTGTAGATGAGGAAACAGG - Intergenic
1190067218 X:47249610-47249632 CATTTTGCAGATAAGGAAGCAGG + Intergenic
1190755748 X:53400384-53400406 CATTTTGCAGATGGGGAAACAGG - Intronic
1190756997 X:53409805-53409827 CATTTTGCAGATGAGGAAACAGG - Intronic
1191011160 X:55760935-55760957 CATTTTGAAGATGGGGAAACTGG + Intergenic
1191147584 X:57184411-57184433 AATTTTACAGCTGGGCCACCAGG - Intergenic
1191688972 X:63920713-63920735 TATTTTACAGATGGGGAAACAGG - Intergenic
1191912750 X:66168424-66168446 CATTTTACAGATGAGAAAACTGG + Intronic
1192052120 X:67733809-67733831 CATTTTGCAGAAAGGAAAACTGG + Intergenic
1192357922 X:70421184-70421206 TATTTTGCAGATGAGGAAACTGG + Intergenic
1192539555 X:71956683-71956705 CATTTTACAGATGAGAAAACAGG + Intergenic
1192575619 X:72240915-72240937 CATTTTTCAGATGTGGAAACAGG + Intronic
1192658856 X:73021686-73021708 CACTTCCCAGATGGGCAGCCAGG + Intergenic
1192850574 X:74951853-74951875 CATTTTACAGATGAGAAAACTGG + Intergenic
1192929102 X:75785885-75785907 CATTTTACAGATGAGGAAACTGG + Intergenic
1193224681 X:78968686-78968708 AATTTTACAGCTGGGCCACCAGG + Intergenic
1193261361 X:79410333-79410355 CATTTGGCAGATAGGGAAGCTGG - Intergenic
1193278843 X:79624691-79624713 CATTTGGCAGATAGGGATCCAGG + Intergenic
1193796486 X:85881487-85881509 CATTTTACAGATGAGAAAACAGG + Intronic
1193872906 X:86823720-86823742 AATTTTACAGCTGGGCCACCGGG + Intronic
1193891915 X:87058084-87058106 CATTTTACAGATTGGCAAACTGG - Intergenic
1194690793 X:96981631-96981653 CATTTTGCAGATGAGCAAAGTGG + Intronic
1194945659 X:100063908-100063930 TATTTTGCAGATGAGCAATTAGG - Intergenic
1194959211 X:100215597-100215619 CATTTTGCAGATGAGTAAACTGG - Intergenic
1194983198 X:100461274-100461296 CATTTTACACATGAGCAAACTGG - Intergenic
1195128774 X:101835021-101835043 AATTTTACAGCTGGGCCACCGGG + Intronic
1195385153 X:104307014-104307036 CATTTTCCAAATGGGAAAACAGG - Intergenic
1195531104 X:105959244-105959266 CATTCTGGAGCTGGGCTACCTGG + Intergenic
1195636400 X:107120646-107120668 CATTTTACAGATGAGAAAACTGG - Intergenic
1195664603 X:107417400-107417422 CATTTTGCAGATAGAGAAACAGG + Intergenic
1197542119 X:127776802-127776824 AATTTTACAGCTGGGCCACCGGG - Intergenic
1197809798 X:130430943-130430965 CATTTTACAGATGAGCAAAGAGG - Intergenic
1198003856 X:132471024-132471046 CTTTTTACAGATGGGGAACATGG - Intronic
1198154052 X:133940461-133940483 CATTTTACAGATGTGGAAACTGG - Intronic
1198178409 X:134179840-134179862 CATTTTACAGATGAGGAAACTGG + Intergenic
1198399684 X:136256809-136256831 CATTTTACAGATGAGGAAGCAGG + Intergenic
1198427450 X:136533929-136533951 CATTTTACAGATGAGCAATTTGG - Intronic
1198822417 X:140662686-140662708 TGTTTTGCAGATGAGCAAACAGG + Intergenic
1198954205 X:142109629-142109651 CATTTTACAGATTGGAAACAAGG + Intergenic
1199113961 X:143968089-143968111 CATTTTACAGATGGGGAAGATGG + Intergenic
1199671195 X:150149743-150149765 CATTTTGCAGAGGTGGAAACTGG + Intergenic
1199799137 X:151232084-151232106 CATTTTACAGATGAGGAAACTGG + Intergenic
1199813114 X:151370718-151370740 CATTTTGCAGATGAGGAAAGTGG + Intergenic
1199848737 X:151710317-151710339 CATTTTACAGATGGAAAAGCTGG - Intergenic
1201518739 Y:14848520-14848542 CATTTTACAGATGAGGAAACTGG + Intergenic
1201706501 Y:16943407-16943429 AATTTTACAGCTGGGCCACCAGG + Intergenic
1202301162 Y:23416005-23416027 TATTTTACAGATGGAAAACCTGG + Intergenic
1202569649 Y:26254593-26254615 TATTTTACAGATGGAAAACCTGG - Intergenic