ID: 1083333964

View in Genome Browser
Species Human (GRCh38)
Location 11:61912241-61912263
Sequence CGCCCCGGGGAGCCAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 426}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083333964_1083333971 -8 Left 1083333964 11:61912241-61912263 CCAGGGCCTGGCTCCCCGGGGCG 0: 1
1: 0
2: 4
3: 53
4: 426
Right 1083333971 11:61912256-61912278 CCGGGGCGGTGCCTTGGCACAGG 0: 1
1: 0
2: 1
3: 5
4: 140
1083333964_1083333976 24 Left 1083333964 11:61912241-61912263 CCAGGGCCTGGCTCCCCGGGGCG 0: 1
1: 0
2: 4
3: 53
4: 426
Right 1083333976 11:61912288-61912310 AGATTCACGCTCAGCCTTTGCGG 0: 1
1: 0
2: 3
3: 9
4: 126
1083333964_1083333973 -6 Left 1083333964 11:61912241-61912263 CCAGGGCCTGGCTCCCCGGGGCG 0: 1
1: 0
2: 4
3: 53
4: 426
Right 1083333973 11:61912258-61912280 GGGGCGGTGCCTTGGCACAGGGG 0: 1
1: 0
2: 0
3: 14
4: 329
1083333964_1083333972 -7 Left 1083333964 11:61912241-61912263 CCAGGGCCTGGCTCCCCGGGGCG 0: 1
1: 0
2: 4
3: 53
4: 426
Right 1083333972 11:61912257-61912279 CGGGGCGGTGCCTTGGCACAGGG 0: 1
1: 0
2: 0
3: 4
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083333964 Original CRISPR CGCCCCGGGGAGCCAGGCCC TGG (reversed) Intronic
900104395 1:976158-976180 AGCTCCTAGGAGCCAGGCCCGGG - Exonic
900145699 1:1157927-1157949 CCACCCAGGGTGCCAGGCCCCGG - Intergenic
900164501 1:1239381-1239403 CGCCCCCAGGGGCCAGGCCAGGG + Intergenic
900207876 1:1439353-1439375 CGGCCCGGTGAGGCAGGGCCGGG + Exonic
900307660 1:2019139-2019161 GGTCCCGGAGAGCCAGACCCCGG + Intergenic
900546974 1:3234668-3234690 GGCCCCTGGGAACCAGGCCCTGG - Intronic
900645543 1:3707137-3707159 AGCCCCAGGGAGCCAGGCAGTGG - Intronic
900654222 1:3747142-3747164 GGCCCCGGGGACCCAAGGCCGGG + Intergenic
901058365 1:6460199-6460221 AGCCCCAGCCAGCCAGGCCCTGG + Exonic
901067123 1:6499461-6499483 CTCCCAGGGGAGCCAGGACCAGG - Intronic
901420796 1:9149967-9149989 AGCCCCGTGGAGCCAGGCGTGGG - Intergenic
901653482 1:10756113-10756135 CGCCCCTCGGAGCCAGGCAGAGG + Intronic
901762240 1:11478867-11478889 CGCCCGCGGGCGCCAGGGCCGGG + Intergenic
901887232 1:12231031-12231053 CGCCTCGGGGAGGGACGCCCAGG + Intronic
903153247 1:21428107-21428129 GGGCCCGGGGAGCCGGGGCCGGG + Intergenic
903181728 1:21608346-21608368 CGCTCCTGTGGGCCAGGCCCGGG + Exonic
903472675 1:23598448-23598470 CTCCATGGGGTGCCAGGCCCAGG - Intronic
903994946 1:27299882-27299904 AGCCCTGGGGAGACTGGCCCAGG - Intronic
905038030 1:34929913-34929935 CTCCCCGGGGACCCAGGAACAGG + Intergenic
905206298 1:36344504-36344526 AGCCCCTGGGAGCCAGGCATGGG + Intronic
905513156 1:38540188-38540210 CGGCCCGGGGAGACAGGCGAGGG - Intergenic
905684965 1:39901582-39901604 CGTCCCGGGAAGCCGGGCCCCGG + Intronic
905734627 1:40316829-40316851 CTCCCCGGGCTGCCAGGACCGGG + Intronic
905883047 1:41476889-41476911 GGCCCCGGGGACCCTGGCCAGGG - Intergenic
905971578 1:42145934-42145956 CGACTCGGGGAGGCGGGCCCGGG - Intergenic
907272960 1:53301339-53301361 TGCCCTGAGGAGCCAGGCCGAGG - Intronic
908842928 1:68296627-68296649 GCCCTCAGGGAGCCAGGCCCAGG - Intergenic
909629885 1:77759926-77759948 GGGCCACGGGAGCCAGGCCCAGG + Intergenic
910916989 1:92299407-92299429 GGCCCCGGGAACCCAGGCCTGGG + Intronic
910963404 1:92784920-92784942 CGACCCGTGGAGCCAGGAGCGGG - Intronic
912514728 1:110210619-110210641 CGCTCTGGGGAGCCGGGCTCTGG - Intergenic
913201967 1:116502284-116502306 TGGCCCTGGGAGCAAGGCCCAGG + Intergenic
913323339 1:117605958-117605980 CTCCCGGGGGAGCCAGGGGCGGG - Exonic
914803138 1:150974692-150974714 AGGCGCGGGGAGCCAGGCCTCGG - Exonic
915908985 1:159900447-159900469 CGGCCCCAGGAGCCTGGCCCAGG + Intergenic
917491670 1:175503595-175503617 GGCCCCGGGCAGGCAGGTCCTGG + Intronic
920761453 1:208787101-208787123 CCCTCCGGGGAGACAGGCTCTGG - Intergenic
922478316 1:225921971-225921993 CGCCACGGGCACCCATGCCCTGG - Exonic
922739437 1:228007056-228007078 CGCCGGGGGGGGCCGGGCCCTGG - Exonic
922765261 1:228153060-228153082 GCCCCCAGGGAGCCAGGCCCGGG - Intronic
923171644 1:231422224-231422246 CGTCCCGGGCGGCCCGGCCCAGG + Exonic
924172446 1:241356762-241356784 CGCCCCCGGGAGCCCCGCGCCGG - Intronic
1062860122 10:804415-804437 CTCCCTGAGGAGCCAGGGCCGGG - Intergenic
1062874351 10:932314-932336 CACACCCGGGACCCAGGCCCCGG + Intergenic
1062874393 10:932403-932425 CACCCCCGGGACCAAGGCCCCGG + Intergenic
1062874452 10:932529-932551 CCCACCGGGGACCCAGGCCCCGG + Intergenic
1062874490 10:932611-932633 CCCACCCGGGACCCAGGCCCCGG + Intergenic
1063119844 10:3097570-3097592 CCCCCCAGGCACCCAGGCCCTGG - Intronic
1063907792 10:10798656-10798678 AGCCGCGGGGCGCCAGGGCCCGG + Intergenic
1064441136 10:15354568-15354590 ACGCCTGGGGAGCCAGGCCCGGG + Intronic
1065533637 10:26697772-26697794 CGGCCGGGGGAGCCGGGCCCGGG - Exonic
1067039319 10:42940618-42940640 AGCACCGGAGACCCAGGCCCTGG + Intergenic
1067723022 10:48743864-48743886 CACCCAGGGATGCCAGGCCCAGG - Intronic
1068955359 10:62815617-62815639 CGCCCCGGCGCGCCCAGCCCCGG - Intronic
1069677001 10:70255490-70255512 CGCCCCCGGGGGCCGGGCCCGGG + Exonic
1069955517 10:72048644-72048666 CGCCTCTGGCAACCAGGCCCAGG - Intergenic
1070579871 10:77711258-77711280 CGTCCCAGCGAGCCAGGGCCTGG + Intergenic
1070587872 10:77780113-77780135 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1070610144 10:77927034-77927056 GGCCCCGGTGAGCCGGGCCGGGG - Intergenic
1070956890 10:80469799-80469821 AGGCTGGGGGAGCCAGGCCCTGG + Intronic
1071299785 10:84247806-84247828 GGCCCTGGGCAGCCAGGCCAAGG + Intronic
1071568673 10:86684693-86684715 GGCCCCGGCCAGCCTGGCCCTGG - Intronic
1072709676 10:97707776-97707798 AGCACCGTGGAGCCAGGCCCAGG - Intergenic
1072726113 10:97815238-97815260 CGCCCCTGGGAGCAAAGGCCTGG - Intergenic
1075065308 10:119285363-119285385 AGCCTTGGGGAGCCTGGCCCAGG - Intronic
1075238744 10:120758082-120758104 TGCCCCTGGGTGCCTGGCCCTGG + Intergenic
1076498299 10:130914001-130914023 CTCCCCAGGGAGCCTGGGCCTGG - Intergenic
1076750003 10:132537762-132537784 CGCCCCGCGGAGCCGAGCCCGGG - Intergenic
1076793276 10:132787571-132787593 GCCCCCGCGGAGCCTGGCCCGGG + Intergenic
1076884226 10:133254314-133254336 TCCCCTTGGGAGCCAGGCCCTGG + Intergenic
1077228189 11:1447394-1447416 TGCCCCAGGCAGCCAGGCCTGGG - Intronic
1077254114 11:1572885-1572907 CGTCCTGGGGAGCCCGCCCCCGG - Intergenic
1077454748 11:2671848-2671870 TGCCCCAGGGAGCCAAGCCCTGG + Intronic
1077465877 11:2733436-2733458 CGCCCAGGGAAGCCAAGCCGTGG - Intronic
1077501468 11:2911468-2911490 CACCCTGGAGAGACAGGCCCTGG - Intronic
1077900158 11:6481250-6481272 CCCCTCAGGGCGCCAGGCCCGGG + Exonic
1078022075 11:7664676-7664698 GGGCCTTGGGAGCCAGGCCCTGG + Intergenic
1079935226 11:26608586-26608608 GTCCCTGGGGACCCAGGCCCAGG + Intronic
1082824441 11:57567687-57567709 CGCCCCGGGGACCCCACCCCCGG + Exonic
1083309652 11:61777713-61777735 ACCTGCGGGGAGCCAGGCCCGGG - Exonic
1083333964 11:61912241-61912263 CGCCCCGGGGAGCCAGGCCCTGG - Intronic
1083636493 11:64123572-64123594 CTCCCCAGGGAGCCAAGCCAGGG - Intronic
1083718842 11:64593985-64594007 CGCCCTGGGGACCCAAGCCCTGG - Intronic
1083904852 11:65662829-65662851 CGCCCCCGGGACCCCGGCCATGG - Exonic
1084128724 11:67118313-67118335 ACCCCCGGGGAGCCGAGCCCAGG + Intergenic
1084164240 11:67367533-67367555 CGCACAGGGGACCCAGGGCCTGG - Exonic
1084192230 11:67504474-67504496 CCCCCCGGAGCGCCAGGCTCCGG + Intronic
1084611161 11:70203760-70203782 GGGCCGGGGGAGCCAGGGCCTGG + Intronic
1084757984 11:71251481-71251503 CGGCCCCGGGCGCCAGGCGCGGG - Intronic
1084935231 11:72583379-72583401 TTCCCCGGGGACCCAGGGCCAGG - Intronic
1084974541 11:72789640-72789662 CGGTCCTGGGAGCCAGCCCCTGG - Intronic
1085300501 11:75455675-75455697 GCCCACGGGGAGCCAGGCTCTGG + Intronic
1085464039 11:76712364-76712386 CGCCCAGGGCGCCCAGGCCCCGG + Intergenic
1085485637 11:76860853-76860875 CCCCTCGGGGAGGCAGGGCCGGG + Exonic
1085533113 11:77203238-77203260 TGCCCAGGGGAGCCAGGGACCGG + Intronic
1086322372 11:85664490-85664512 GGCCCCGGCGAGCTAAGCCCGGG + Exonic
1087713745 11:101583523-101583545 CTCCCCCGGGAGCGGGGCCCAGG - Exonic
1089179173 11:116569143-116569165 GGTCCCGCAGAGCCAGGCCCAGG - Intergenic
1089199391 11:116714730-116714752 GGCCTCTGGCAGCCAGGCCCTGG - Intergenic
1089262417 11:117232182-117232204 CGCCCGCGGGAGCCGGACCCCGG - Exonic
1089353918 11:117837529-117837551 CGCCCGGGGATTCCAGGCCCAGG - Exonic
1090398755 11:126435333-126435355 CACCCTGGCCAGCCAGGCCCTGG - Intronic
1091784112 12:3231891-3231913 CCCCACTGAGAGCCAGGCCCAGG - Intronic
1091843685 12:3638344-3638366 GGAACCGGGGAGCCAGGGCCTGG - Exonic
1094607214 12:31959374-31959396 CGGGTCGAGGAGCCAGGCCCAGG - Intronic
1096469812 12:51869068-51869090 CTCCTCGTGGAGCCAGGCCTTGG - Intergenic
1096717415 12:53499680-53499702 CGTCCCGGGGGGCCAGGGGCGGG - Intronic
1097357757 12:58621094-58621116 GGCCCCAGGGACCCAGACCCAGG + Intronic
1099202143 12:79690115-79690137 CTCCCGGGGGGGCCGGGCCCGGG + Exonic
1101962086 12:109258235-109258257 AGCACCAGTGAGCCAGGCCCTGG - Intronic
1102453018 12:113055742-113055764 TGCCCCGGGGAGGCAGGCGTGGG + Intergenic
1102905417 12:116670951-116670973 CTCCCCTGGCACCCAGGCCCTGG + Intergenic
1103534661 12:121626489-121626511 CGCGCCGGGGGTCCAGGCCCCGG + Intergenic
1103700631 12:122847194-122847216 TGCCCCACGGAGCCAGGGCCGGG + Intronic
1103711773 12:122918085-122918107 CACCCCGGGCAGCCAGGCCTGGG - Intergenic
1104674168 12:130701505-130701527 AGCCCAGGGGAGCCGGGCACAGG + Intronic
1104718357 12:131031097-131031119 GGCCCCGGGGAGCCAGGGGCTGG + Intronic
1104874679 12:132025746-132025768 CGCCCTGGGAAGCAAGCCCCCGG + Exonic
1105029793 12:132874527-132874549 AGCGCGGGGAAGCCAGGCCCCGG + Intronic
1105029827 12:132874633-132874655 AGCGCGGGGAAGCCAGGCCCCGG + Intronic
1105029863 12:132874739-132874761 AGCGCGGGGAAGCCAGGCCCTGG + Intronic
1105447782 13:20472693-20472715 TGCCCCAGTGAGCCAGTCCCAGG - Intronic
1105472126 13:20703868-20703890 CGCCCCGCGGAGCCAGAGGCCGG - Intronic
1106555162 13:30803118-30803140 CGCCCTGGGGTGGCAGGCACCGG + Intergenic
1107467563 13:40664876-40664898 CGCCCCGCGCGGCCAGGCGCCGG + Intronic
1108688969 13:52845992-52846014 CCGCCCGGGGAGCCGGGCCCAGG - Exonic
1112006134 13:95255329-95255351 CTCCCCTTGGAGCCAGGCCATGG - Intronic
1112232377 13:97602193-97602215 GGACCCGCAGAGCCAGGCCCAGG - Intergenic
1112290724 13:98142846-98142868 CGCCGCGCGGAGCCCGGCCCTGG + Intronic
1112323996 13:98431354-98431376 CTCCCCGGGGAGCCCCTCCCTGG - Intronic
1113082905 13:106535833-106535855 CGCCCGCGGGAGCCAGGGGCGGG - Intergenic
1113672312 13:112183400-112183422 CGTCCCGAGGGGCCAGCCCCGGG - Intergenic
1113765201 13:112876829-112876851 CACCGCTGGGAGCCAGCCCCCGG - Intronic
1113808742 13:113124487-113124509 AGCCCCGGAGAGCCAGGGCCAGG + Intronic
1113841773 13:113364743-113364765 CCCACCGGCGAGCCAGGCCTGGG + Intergenic
1118749432 14:68795452-68795474 TGCCCCGCGGGGACAGGCCCTGG - Intronic
1118846007 14:69548247-69548269 CGCCAGGGGGCGCCAGGCACCGG + Intergenic
1119652983 14:76396881-76396903 CGCCTCATGGAGCCAGGCCGAGG + Intronic
1121547589 14:94773080-94773102 AGCCGCGCGGAGGCAGGCCCCGG + Intergenic
1122124159 14:99570289-99570311 GGCCACTGTGAGCCAGGCCCTGG + Intronic
1122162240 14:99793165-99793187 CCCCGCGGGGAGCGCGGCCCGGG - Intronic
1122273617 14:100579814-100579836 CGCCCCTGGCTGCCAGGCCCTGG + Intronic
1122833896 14:104421652-104421674 ACCCCGGGGAAGCCAGGCCCAGG + Intergenic
1122922567 14:104886046-104886068 CCCCCAGGGGAGCCCGGCACCGG - Exonic
1124168635 15:27352616-27352638 TGCCCCGGGGAGGCAGGCCAAGG + Intronic
1126639695 15:50812198-50812220 CTCCCCGCGGGGCCAGGCTCAGG + Intergenic
1126780392 15:52134671-52134693 CGATCCTGGGAGCCAGGCCAGGG - Intronic
1127647545 15:60973667-60973689 CGACCCTTGTAGCCAGGCCCAGG + Intronic
1128802389 15:70505052-70505074 CCCCCCGGCGAGGCAGTCCCAGG + Intergenic
1129266393 15:74395734-74395756 AGCCCAGGAGAGCCAGCCCCAGG + Intergenic
1129382666 15:75177971-75177993 GGCCCCAGTGAGCCAGGCCCTGG + Intergenic
1129452525 15:75658997-75659019 CTCCCCAAGGAGCCATGCCCTGG + Exonic
1129733398 15:77944563-77944585 CGCACCAGGAAGCCAGGGCCCGG + Intergenic
1129778794 15:78255474-78255496 AGACCTGGGGAGCCAGGCCTGGG - Intergenic
1130411738 15:83653872-83653894 CGCCGTGTGGGGCCAGGCCCGGG - Intergenic
1130517022 15:84633541-84633563 CGTCCCGGGCGGCCCGGCCCAGG - Intergenic
1131694067 15:94856391-94856413 GGTCCGGGGGAGCCAGGCCAGGG + Intergenic
1132502279 16:289861-289883 TGCACCTGGCAGCCAGGCCCTGG - Intronic
1132544742 16:527975-527997 CGGCCCGGGCAGCGCGGCCCCGG - Exonic
1132553602 16:563568-563590 CGCCCTGGGGAGTCCGACCCCGG + Exonic
1132571591 16:646689-646711 CGTCCCGGCCAGCCGGGCCCAGG - Intronic
1132626734 16:894945-894967 CGCCCCGGGGCTCCCTGCCCAGG - Intronic
1132660773 16:1060596-1060618 CGCCCCGGGGGTACAGGCACCGG + Intergenic
1132723172 16:1327048-1327070 AGCCCAGGGGAGCCAGGGACAGG - Intergenic
1132827860 16:1913959-1913981 CACCCCGCAGAACCAGGCCCTGG + Intronic
1132989683 16:2786408-2786430 TGCTCCAGGGAGCCCGGCCCAGG + Intronic
1133136684 16:3717332-3717354 TGCTCCGGGGAGCGAGGCGCCGG - Intronic
1134136626 16:11680738-11680760 GGCCCTGGGCAGCCAGGCTCTGG - Intronic
1135776067 16:25258139-25258161 CTTCCCCGGCAGCCAGGCCCCGG - Intergenic
1136245826 16:28975209-28975231 AACCCCGGGGTGCCAGGCACTGG - Exonic
1136453949 16:30370091-30370113 CGCCCCGGGGTTCCCGGGCCGGG - Exonic
1137324988 16:47425238-47425260 GGACCCGTGGAGCCAGGCACGGG + Intronic
1137619419 16:49866729-49866751 GCCCCTGGGAAGCCAGGCCCTGG - Intergenic
1137655365 16:50153974-50153996 CGCCCGGCGGGCCCAGGCCCCGG - Exonic
1139664596 16:68447398-68447420 CGCCCCGGGGACCGAGCCTCTGG - Intronic
1139890659 16:70251555-70251577 CGCCCGGGGGAGCGCGGCGCCGG + Exonic
1141879491 16:86848325-86848347 CTCCCCGAGGAGCCAGGGCCTGG + Intergenic
1142017112 16:87755427-87755449 GGCCCCGGGGACCCAGCCCATGG - Intronic
1142101005 16:88271174-88271196 CTCTCCGGGAAGCCAGGCCTGGG - Intergenic
1142230249 16:88896785-88896807 CGCCCCGGCCAGCCTGGGCCTGG + Intronic
1142231526 16:88902337-88902359 CGCCCAGCGCAGCCAGGCCTCGG - Intronic
1142236342 16:88924341-88924363 GGCCCCAGGGAGGCAGGGCCAGG - Intronic
1142260382 16:89040009-89040031 CTCCCCGAGGGGCCTGGCCCTGG + Intergenic
1142345934 16:89553996-89554018 CTCCCCGGGGAGGGAGTCCCTGG + Intronic
1142640176 17:1280899-1280921 CCCTCGGGGGAGCCTGGCCCCGG - Intronic
1142685582 17:1575349-1575371 CCCCCCGGGGACCCGGGGCCTGG - Exonic
1142876147 17:2853218-2853240 CCACCCGGGGACCCGGGCCCGGG + Intronic
1143030463 17:3964471-3964493 CGCCCCGGGGAGGGAGTCCCGGG - Intergenic
1143321234 17:6070466-6070488 AGCCCCGGGGAGCCAGGCGGCGG + Intronic
1143584113 17:7842891-7842913 CGCACCCGGGACCCAGGCGCTGG - Intronic
1143837085 17:9701250-9701272 CGCCCTGGGGGTCCATGCCCCGG + Intronic
1144519147 17:15942839-15942861 TGCCCAGGGGTGCCATGCCCAGG - Intergenic
1145034819 17:19533770-19533792 GGCCCCCGGGCGCCAGGCGCGGG + Intronic
1145066850 17:19767073-19767095 AGTGCCGGGGAGCCAGGCCTTGG - Intergenic
1145252881 17:21305925-21305947 TGCCCAGGGAAGCCTGGCCCAGG + Intronic
1146054344 17:29573752-29573774 GACCCCGGGGAGCCAGCCCCAGG + Exonic
1146058697 17:29593540-29593562 CGCCCCGCGGCCCCGGGCCCCGG + Exonic
1146654451 17:34626802-34626824 CCCGCCGGGGGGCCGGGCCCGGG + Intronic
1146723903 17:35142204-35142226 CGCCGCGGGGCGCTAGGGCCCGG - Intronic
1147331218 17:39700446-39700468 CGCTCAGGGCAGCCGGGCCCTGG + Intronic
1147466468 17:40614912-40614934 TTCCCGGGGGAGCCAGGCCAAGG - Intergenic
1147683973 17:42276195-42276217 GGGCCGGGGGAGCCAGGCCGGGG - Intronic
1147879807 17:43646250-43646272 CTCCTCGGGGACCCCGGCCCGGG - Intronic
1148562540 17:48614211-48614233 CGCCCCGGCCTGCCAGGCCTTGG + Intronic
1148899493 17:50865821-50865843 CGCCCCGGGCCGCCCGTCCCCGG + Intronic
1149082021 17:52668560-52668582 TGCACAGAGGAGCCAGGCCCTGG + Intergenic
1150790406 17:68197501-68197523 CGCCCCTGGAAGCCACGCCCAGG + Intergenic
1151979214 17:77498925-77498947 GCCCTCGGGGAGCCAGGCCTGGG - Exonic
1152072522 17:78140966-78140988 TGGCCCGGGGAGCCAGGGCATGG - Exonic
1152365720 17:79855340-79855362 CACCCGGGGCAGCCAAGCCCAGG + Intergenic
1152545798 17:80999593-80999615 TGCGCCGGGAAGCCAGGCCAAGG - Exonic
1152577599 17:81149642-81149664 CGGCCATGGGAGCCAAGCCCAGG - Intronic
1152581172 17:81166184-81166206 AGCCCCGCGGCGCCAGGGCCGGG - Intergenic
1152640071 17:81445594-81445616 CGCACCCGGGAGCCAGGCCCGGG - Exonic
1152861402 17:82698569-82698591 CGCCCTGGGCAGCCCGGTCCGGG - Exonic
1152931371 17:83111807-83111829 CGCGCAGGGCAGCCAGGTCCCGG + Intergenic
1203162345 17_GL000205v2_random:63484-63506 CGCCCCGGAGAACCGGGGCCTGG - Intergenic
1153031031 18:712774-712796 CGCCCCCGGGAGCCCGGAGCTGG - Intergenic
1156569735 18:38239654-38239676 CACCCCAGGGAGCCTGCCCCAGG - Intergenic
1157580643 18:48771995-48772017 CTCCCTGGGGAGCCAGGGACAGG - Intronic
1157794213 18:50559960-50559982 GGCGCTGGGGAGCCGGGCCCTGG - Intergenic
1157833744 18:50879600-50879622 CTCGCCCGGGAGCGAGGCCCTGG + Intronic
1158092222 18:53727646-53727668 TGCGCAGGGCAGCCAGGCCCTGG + Intergenic
1160227653 18:77023750-77023772 CACCCTGGGGAGGCTGGCCCTGG + Intronic
1160679838 19:407614-407636 CGCCCAGGACAGCCAGGCCAAGG - Exonic
1160842999 19:1154791-1154813 CTCCCCTGGGTGCCGGGCCCGGG - Intronic
1161470707 19:4455637-4455659 AGCCCAGGGGAGACAGGCCACGG - Intronic
1161758405 19:6151842-6151864 AGCCCAGGGGTCCCAGGCCCAGG - Intronic
1161911546 19:7198170-7198192 CGCTCCGGGGAATCCGGCCCCGG + Intronic
1161957787 19:7506187-7506209 CGCCCCATGGAGCCCCGCCCCGG + Intronic
1161957833 19:7506279-7506301 CGTCCCGGGAAGCCCAGCCCTGG + Intronic
1162921344 19:13905185-13905207 AGCCCCGGGGACCCAGACTCTGG + Intronic
1163152754 19:15424751-15424773 GGCCCCCGGGTGCCAGCCCCAGG + Exonic
1163282470 19:16325833-16325855 CGGCGGGGGGCGCCAGGCCCAGG - Exonic
1163370418 19:16898024-16898046 CGCCCCGGGCCTCCTGGCCCGGG - Intronic
1163423258 19:17226852-17226874 CTCACCGGGGGCCCAGGCCCAGG - Exonic
1163550587 19:17964519-17964541 CGCCCCCGGGACTCATGCCCTGG - Intronic
1163597060 19:18226363-18226385 CCCCGAGGGGAGCCGGGCCCGGG + Intronic
1164160606 19:22623493-22623515 CCCCGCGGGGAGCCCAGCCCAGG + Intergenic
1165062827 19:33213087-33213109 AGCCCCCGGGCGCCAGGCCCAGG - Intronic
1165420047 19:35718049-35718071 CCCCGCGCGGAGCCAGGCCCGGG - Exonic
1165828492 19:38719026-38719048 CTGCAGGGGGAGCCAGGCCCGGG - Intronic
1165932664 19:39370002-39370024 GGCCCTGGGGAGGCAGGGCCAGG + Exonic
1165943677 19:39428605-39428627 CGCCGCTGGGAGCCTGGGCCAGG - Intergenic
1166060791 19:40324106-40324128 GGCCCCGGTGGGCCAGGCCTAGG + Intronic
1166333413 19:42091493-42091515 AGCCCCGGGGAGCCCTGGCCTGG - Exonic
1166677422 19:44748490-44748512 CGCCTGGGGCAGCCAGGCCTCGG - Intronic
1166746278 19:45143361-45143383 TGCCCAGGGGTGCCAGGCCGAGG + Intronic
1166782888 19:45351558-45351580 CGCCGCTGGGAACCAGGGCCAGG + Exonic
1166811344 19:45516323-45516345 TGCCCTGGGGAGCCAGGCGAGGG + Intronic
1168076403 19:53982774-53982796 CGCCCCCGGGACCCTGGCCAAGG + Exonic
1168239327 19:55081435-55081457 GACCCCGGGGACCCAGGTCCGGG - Exonic
1168277020 19:55284230-55284252 GGCCCGGGGGGGTCAGGCCCCGG - Exonic
1168435704 19:56315324-56315346 CGCCCGGGTGACCCAGGCTCGGG - Intronic
925730742 2:6917996-6918018 CGCCCGCGGGACCCTGGCCCGGG - Intronic
927137992 2:20111420-20111442 GCCCCCTGGGAGCCAGGCCCCGG - Intergenic
927156477 2:20224252-20224274 TGGCCCGGGGAGCCGGGCCAGGG - Intronic
927157550 2:20229998-20230020 CCCTACTGGGAGCCAGGCCCAGG + Intergenic
927929090 2:27032850-27032872 CGCTCAGGAGAGCCCGGCCCAGG + Intergenic
929936582 2:46297978-46298000 TGCCCCGCGCAGCCCGGCCCTGG - Intronic
932360255 2:71099168-71099190 CGCCCCTGAGAGGCAGGGCCTGG + Intergenic
934574067 2:95389558-95389580 CGCCCCGGGGAATTAGGCCGGGG - Intergenic
934763544 2:96868862-96868884 CGCCCCAGGGACCCTGGCCTGGG + Intronic
934976536 2:98806497-98806519 GATCCCGGGGAGCCAGGGCCGGG + Intronic
934978558 2:98822690-98822712 CCCCCGGTGGAGCCCGGCCCCGG - Exonic
935313345 2:101806939-101806961 CGCCAGGGCCAGCCAGGCCCAGG - Intronic
935329122 2:101963346-101963368 GGCCCCCGGGAGCCAGGACTGGG - Intergenic
935331437 2:101980374-101980396 CTCCCCTGGGTGCCTGGCCCTGG + Intergenic
935336817 2:102023925-102023947 CGCCCCGAGGAGCTGGGACCCGG - Intronic
937205013 2:120230846-120230868 CGCCACTGAGAGCCAGGCCCTGG + Intergenic
937986960 2:127642272-127642294 CCCCTCGGGGAGCCGTGCCCTGG - Intronic
938073134 2:128318736-128318758 GGGCCCGGGGAGCCGGGGCCGGG - Intergenic
938277351 2:130038055-130038077 CGACTGGGGGTGCCAGGCCCAGG - Intergenic
938328324 2:130428858-130428880 CGACTGGGGGTGCCAGGCCCAGG - Intergenic
938361623 2:130692636-130692658 CGACTGGGGGTGCCAGGCCCAGG + Intergenic
938438033 2:131299325-131299347 CGACTGGGGGTGCCAGGCCCAGG + Intronic
939629827 2:144517481-144517503 CGCCCAGGGGAGCCGGGCCAGGG + Intronic
939885933 2:147681902-147681924 TACCCCGGAGACCCAGGCCCAGG + Intergenic
941021086 2:160408060-160408082 CTCCCCGGGCCGCCCGGCCCCGG - Intronic
941812457 2:169768255-169768277 CGCCCAGGGGAGCCCGGCCAAGG - Intronic
944581618 2:201137296-201137318 CTCCCAGGGCAGCCTGGCCCAGG + Intronic
944716053 2:202376732-202376754 CGTCTCGGGGAGCCCGGACCGGG + Intergenic
945066252 2:205949846-205949868 CCCCCAGGGAAGCCTGGCCCAGG + Intergenic
945225579 2:207529389-207529411 CGCCCCCGGGTCCCAGGCCCCGG + Intergenic
946250090 2:218406426-218406448 CGCCCGGCAGAGCCAGGCGCCGG - Intergenic
947909025 2:233789679-233789701 GGCCACGGGGGGCCTGGCCCAGG + Intronic
948465805 2:238151067-238151089 CTCCCCGGGGACCCTGGCCCTGG - Exonic
948847254 2:240688930-240688952 CGCCCCAGAGGACCAGGCCCAGG + Intergenic
948908024 2:240989104-240989126 TCCCCATGGGAGCCAGGCCCGGG + Intronic
1169214740 20:3786525-3786547 CGCCCCGGGGCGGGGGGCCCGGG + Exonic
1170567354 20:17614667-17614689 AGCCCCGGGGAGGCAGGACCGGG - Intronic
1172117881 20:32583047-32583069 CCCCTCGGGGAGCCCGGTCCCGG + Intronic
1172714206 20:36951186-36951208 CGCCTCGGGGAGTCAGTCCCGGG + Intronic
1173336587 20:42116973-42116995 TTCCCCAGGGACCCAGGCCCAGG - Intronic
1173874136 20:46359108-46359130 CGCCCAGTGGGGCCAGGTCCTGG - Intronic
1174388067 20:50198509-50198531 CTCCCCGTGGCTCCAGGCCCTGG - Intergenic
1174404061 20:50292518-50292540 CTCCCAGGGCAGCCTGGCCCAGG - Intergenic
1174476887 20:50801971-50801993 CCCCCTGGGGACCCAGGCCCTGG - Intronic
1174606859 20:51767796-51767818 CGCCCCTGGGTCCCAGCCCCAGG - Intronic
1175314778 20:58039711-58039733 CTCCCCCGGGAGCCAAGCCCTGG - Intergenic
1175367742 20:58467331-58467353 CGCCCCAGGCAGCCAGGCCCGGG + Exonic
1176038129 20:63050191-63050213 CGCTCAGGGAAGCCCGGCCCAGG + Intergenic
1176086047 20:63296007-63296029 CGCCCCGGCCTGTCAGGCCCTGG - Intronic
1176178998 20:63740900-63740922 GGCCCCAGCGAGCCAGGCCAGGG - Intronic
1176379771 21:6106403-6106425 CACCCCGGGCAGGCAGGCGCTGG + Intergenic
1177187957 21:17819080-17819102 CGTCTCGGGGAGCCGGGTCCTGG + Intronic
1179451843 21:41473417-41473439 CGCTCCCGGGGGCCTGGCCCTGG - Exonic
1179578289 21:42321360-42321382 GGCCCCAGGGAGCCAGGCCAGGG - Intergenic
1179626894 21:42653933-42653955 CGCCCCGCCGCGCCCGGCCCCGG - Intronic
1179722950 21:43325708-43325730 CAGCCCGGGGAGCCAGTGCCTGG - Intergenic
1179743703 21:43431834-43431856 CACCCCGGGCAGGCAGGCGCTGG - Intergenic
1180831963 22:18911101-18911123 GTCCCTGGGGAGCCAGGCTCAGG + Intronic
1180842084 22:18964170-18964192 AGTCCCGAGGAGCCAGGCCCTGG - Intergenic
1180908257 22:19431147-19431169 CGCTCCTGGGAGCCAGGCCGCGG + Intronic
1180921650 22:19524462-19524484 CGGGCCGGGGGGCCGGGCCCGGG - Exonic
1180932943 22:19605879-19605901 CGTCCCTCGGAGGCAGGCCCTGG - Intergenic
1180947670 22:19705547-19705569 AGCCCCTGGGAGCCAGGCCTGGG - Intergenic
1181059413 22:20274711-20274733 AGTCCCGAGGAGCCAGGCCCTGG + Intronic
1181067879 22:20315241-20315263 GTCCCTGGGGAGCCAGGCTCAGG - Intronic
1183208119 22:36433276-36433298 GGCCACGCTGAGCCAGGCCCTGG - Intergenic
1183412839 22:37665586-37665608 AGCCTCGGGACGCCAGGCCCTGG + Exonic
1183481760 22:38069147-38069169 GGCCCCGGGGACTCAAGCCCAGG + Intronic
1184088588 22:42280792-42280814 GCCCCCTGGGAGCCAGGCTCTGG + Intronic
1184461532 22:44640548-44640570 CTCCCGTGGGAGCCAGGGCCAGG + Intergenic
1184759497 22:46536781-46536803 CGCCCCGCAGAGCCGGGCACCGG + Exonic
1184866194 22:47202974-47202996 CGTCCCGGTCAGCCAGGCTCAGG + Intergenic
1185051189 22:48555145-48555167 AGCCCCTGTGTGCCAGGCCCTGG - Intronic
1185055257 22:48575853-48575875 CGCCGCGGCGGGCCAGGCTCGGG - Intronic
1185226429 22:49656384-49656406 AGCCCCGGAGAGGCAGGGCCTGG + Intronic
1203282041 22_KI270734v1_random:136372-136394 GTCCCTGGGGAGCCAGGCTCAGG + Intergenic
949559258 3:5187570-5187592 CGCCCCGCGAGGCCGGGCCCAGG + Intergenic
950118120 3:10464328-10464350 CTCCCAGGGGACACAGGCCCAGG + Intronic
950161492 3:10764294-10764316 CCCCCGGGCCAGCCAGGCCCGGG + Intergenic
950433492 3:12965383-12965405 GGCCCCTGGGAGCCAGCCCAAGG + Intronic
950548777 3:13654344-13654366 GGCCCCTGGGAGACAGACCCTGG + Intergenic
950620334 3:14200416-14200438 GGCCCCTGGGAGCCACGCCTTGG + Exonic
950831531 3:15879768-15879790 CTCCCAGGGCAGCCTGGCCCAGG - Intergenic
952316834 3:32238880-32238902 CGCCCTGGGGACACAGGCGCGGG - Exonic
954782960 3:53074038-53074060 GGCCCAGGTGAGCCAGGCTCTGG + Intronic
955530247 3:59865523-59865545 CTCCCCTTGGAGCCAGGGCCTGG + Intronic
959398265 3:105868661-105868683 GGCCCGGGGTAGCCAGGCGCGGG - Intronic
960964985 3:123098394-123098416 CACTCCTGGGAGTCAGGCCCAGG - Intronic
961475366 3:127142586-127142608 ATCCCCCTGGAGCCAGGCCCTGG - Intergenic
963127233 3:141827332-141827354 ACCCCGGGGGAGCCAGCCCCAGG + Intergenic
963870662 3:150410288-150410310 AGCCCCAGGGAGCGGGGCCCGGG + Exonic
966009309 3:175055582-175055604 CGCCATGAGGAGCCTGGCCCAGG - Intronic
968235686 3:197029143-197029165 CGCCCCGGGGAGTCAGGGCCCGG - Intronic
968428262 4:537274-537296 CAGCCCGGGGTGCCAGCCCCTGG - Intronic
968471600 4:785084-785106 CGGCCCGGGGCGCCATGCGCTGG + Exonic
968607018 4:1540332-1540354 GGCCTGGGGAAGCCAGGCCCCGG + Intergenic
968659805 4:1794260-1794282 CACCACGGGGAGCCAGGCTGGGG + Intronic
968664781 4:1815151-1815173 AGCCCCGGAGACCCTGGCCCAGG - Intronic
968727817 4:2256413-2256435 CATCCCCGGGAGGCAGGCCCTGG - Intronic
968756533 4:2418854-2418876 CGGCCCGGGACGCCAAGCCCTGG - Intergenic
968808850 4:2791236-2791258 AGACCTGGGGAGCCAGGCCCAGG + Intergenic
968904763 4:3446089-3446111 CGCCCCGGGGAGGCTGGCTCAGG - Exonic
969295039 4:6264802-6264824 CATCCCTGGGAGCCAGGCCCAGG - Intergenic
969841898 4:9888949-9888971 TGCCCCTGGGTGCCAGGCACTGG + Intronic
974077674 4:57182482-57182504 TGCCCGGGGGAGACATGCCCAGG + Intergenic
975883566 4:78939264-78939286 CTCCCCGGGGAGGCGGGACCTGG - Exonic
985377855 4:189360846-189360868 CGCTCAGGGAAGCCAGGCCAGGG - Intergenic
985623337 5:968025-968047 CACCCAGGGAAGCCAGCCCCAGG + Intergenic
985824390 5:2181774-2181796 CCCCCTGCGGTGCCAGGCCCTGG - Intergenic
985832182 5:2242021-2242043 GTCCCCGGGGAGCCAGGGCAGGG - Intergenic
986249956 5:6046388-6046410 AGAGCCGGGGAGCAAGGCCCTGG - Intergenic
986733553 5:10652270-10652292 TGGTCCGGGGAGCCAAGCCCTGG + Intergenic
992487600 5:77210902-77210924 CGCGCGGGGGAGCCCGGCCGAGG + Exonic
992641543 5:78772488-78772510 CGCCACAGGCAGCCAGGGCCGGG - Intergenic
992663546 5:78984710-78984732 CGCCCCGCGGACCCGCGCCCCGG - Intronic
995724583 5:115169934-115169956 CGCCCCGCGGTGCCCCGCCCAGG - Intronic
998159151 5:139803365-139803387 CCCCCAGGGGTGCCATGCCCAGG - Intronic
998583398 5:143403425-143403447 CGACCCGCGGAGCCCGGCGCGGG - Exonic
1001581292 5:172800269-172800291 CACCCTGATGAGCCAGGCCCTGG + Intergenic
1002440477 5:179261971-179261993 CCCCACAGGCAGCCAGGCCCTGG - Intronic
1002613765 5:180437618-180437640 GGCCCCTGGGAGCCAGGTCAAGG - Intergenic
1002919345 6:1555217-1555239 CGCCCCCTGGAGGCGGGCCCTGG + Intergenic
1004731839 6:18366516-18366538 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1005473927 6:26188950-26188972 CGCCGCGGCGAGCCAGGCGGCGG + Exonic
1005643990 6:27824229-27824251 CGCCGCGGCGAGCAAGGCGCCGG - Exonic
1005645207 6:27831401-27831423 CGCCGCGGCGAGCAAGGCGCCGG + Exonic
1006083531 6:31580999-31581021 CGCCAGGGGGCGCCCGGCCCCGG + Exonic
1007390395 6:41547011-41547033 CGCCAGGAGGAGCCGGGCCCGGG + Intronic
1007686578 6:43670690-43670712 CTCCTTGGGCAGCCAGGCCCAGG - Intronic
1011544471 6:88468729-88468751 TGCACAGGGCAGCCAGGCCCTGG - Intergenic
1014632310 6:123803076-123803098 AGCCCAGGGGAGCCAGGTGCTGG + Intergenic
1018613335 6:165663009-165663031 CGGGCCTGGGGGCCAGGCCCCGG + Intronic
1019047865 6:169162060-169162082 CGCCCCGCAGAGCCAGTCCGTGG + Intergenic
1019298533 7:291260-291282 CGCTCAGGGGCGCCTGGCCCCGG + Intergenic
1019506177 7:1392682-1392704 GCCCCCTGGGAGCCAGGGCCTGG + Intergenic
1019513224 7:1428869-1428891 GTCCCCGGGGAGCAGGGCCCTGG + Intronic
1019523184 7:1469577-1469599 CTCCCAGGTCAGCCAGGCCCCGG - Intergenic
1019538007 7:1538848-1538870 CGCACCTGGCTGCCAGGCCCTGG + Intronic
1019563012 7:1667254-1667276 CTCCCTGGGCAGCCTGGCCCCGG - Intergenic
1019578836 7:1750261-1750283 CTCCCCGGGGGGCCGGGGCCGGG - Intergenic
1019918657 7:4149485-4149507 CTCCCCGGGGAACGGGGCCCTGG + Intronic
1021313165 7:19117108-19117130 CGAGCCGGGCAGCCCGGCCCAGG - Exonic
1021411137 7:20330983-20331005 CGCCCCGCGAAGCCGGGCTCCGG + Intronic
1021848845 7:24788288-24788310 TGCCCCGAGGAGACAGGGCCTGG + Intergenic
1023870799 7:44262125-44262147 CGACCTTCGGAGCCAGGCCCAGG + Intronic
1023987259 7:45104083-45104105 TGCCCAGGTGAGCCAGGGCCTGG - Exonic
1023989887 7:45122382-45122404 AGCCCAGGGGCCCCAGGCCCAGG - Intergenic
1023992113 7:45134537-45134559 AGCCCAGGAGACCCAGGCCCCGG - Intergenic
1024589265 7:50867136-50867158 CTGCCCGGGAAGCCAGCCCCAGG - Intergenic
1026470123 7:70687987-70688009 CGCCACTGGGAGGCAGGCCGAGG - Intronic
1026840508 7:73667989-73668011 CGCCCCGGGCTGCCGGGCTCCGG - Exonic
1026840580 7:73668228-73668250 GGCCCCGCGGAGCCACCCCCGGG + Intronic
1027145032 7:75688382-75688404 CTCCCCTGGGAGCCCGGACCCGG - Intronic
1027271226 7:76520129-76520151 GGCCCTGGGGAGCCATGCCAGGG + Intergenic
1027320990 7:77010064-77010086 GGCCCTGGGGAGCCATGCCAGGG + Intergenic
1027361791 7:77416572-77416594 CGCCCCGGCGGGCCTGGTCCTGG - Intergenic
1029199006 7:98826351-98826373 CGCTCTTTGGAGCCAGGCCCTGG + Intergenic
1029645814 7:101855187-101855209 CGTCCCTTGGAGCCTGGCCCAGG + Intronic
1029667850 7:102007448-102007470 CGCCCCTGGGTGCCAGGGCCTGG + Intronic
1029704671 7:102269987-102270009 CCCCACAGGGGGCCAGGCCCGGG + Intronic
1029708387 7:102287015-102287037 GGGCCCGGGGAGCCCGGCCGCGG + Intronic
1032018183 7:128392789-128392811 CTCCCAGGGCAGCCTGGCCCCGG + Exonic
1032502822 7:132412831-132412853 CTCCCCGGTGCTCCAGGCCCTGG - Intronic
1033341524 7:140495836-140495858 GGACCCAGGGAGCCAGGCCAAGG + Intergenic
1033741883 7:144282426-144282448 TGCCGCGGAGAGCTAGGCCCGGG + Intergenic
1033752018 7:144367188-144367210 TGCCGCGGAGAGCTAGGCCCGGG - Exonic
1034155668 7:148954572-148954594 AGCCCCTGGAAGCCAGGCCCAGG + Intergenic
1034275197 7:149820949-149820971 GGCCCCGGGGAGCCAGCACCAGG + Intergenic
1034426817 7:151018346-151018368 CTCCCGGAGGAGCCCGGCCCCGG - Exonic
1034435598 7:151061453-151061475 CACCCCGTGGAGCCGGGGCCGGG - Intronic
1036454190 8:8893381-8893403 CGCCTCGGGGGGCCCGGCTCCGG + Exonic
1036492984 8:9244919-9244941 AGCCCCAGGGAGACTGGCCCGGG + Intergenic
1037490326 8:19391490-19391512 TGCCCCTAGGAGCAAGGCCCTGG + Intronic
1037720468 8:21439348-21439370 AGCCCCGGGGAGCCTACCCCGGG - Intergenic
1037887294 8:22601734-22601756 CTGCCCGGGGAGGCAGGCCCAGG - Exonic
1037957151 8:23068802-23068824 AGGCGCGGGGAGCCAGGCCTGGG - Exonic
1038493656 8:27987049-27987071 TGCCCCTGGGTGCAAGGCCCTGG - Intronic
1038554051 8:28494313-28494335 CACCCCTTGGAGCCAGGCGCCGG + Exonic
1041244900 8:55880310-55880332 GGCCCGGGGGAGCCAGGGCGCGG + Intronic
1042337151 8:67640609-67640631 CGCTCCTGGGAGCCAGGAACAGG - Intronic
1043279426 8:78445193-78445215 CGACCCGCTGAGCCAGGCACTGG - Intergenic
1044821899 8:96160773-96160795 CCGCCCGAGGAGCCGGGCCCCGG - Exonic
1047275539 8:123402302-123402324 CTCCCAGGGCAGCCTGGCCCAGG - Intronic
1047946625 8:129887171-129887193 TCCCCAGGGCAGCCAGGCCCTGG - Intronic
1048270416 8:133023678-133023700 CGCCCCAAGGAGCCTGGGCCTGG + Intronic
1049156858 8:141072718-141072740 AGCCCCGGCGAGCAAGGCCTGGG + Intergenic
1049312253 8:141939350-141939372 TGCCCCGGAGAGCCAGCACCCGG + Intergenic
1049406212 8:142452830-142452852 CGCCGCGGGGCTCCAGGCCCAGG + Intronic
1049488156 8:142877059-142877081 CGCCCGGGGGAGCCTGACCCTGG - Exonic
1049493042 8:142915082-142915104 CGCCCGGGGGAGCCTGACCCTGG - Exonic
1049585489 8:143430772-143430794 CCTCCCGGGGAGGCGGGCCCAGG - Intergenic
1049592515 8:143469021-143469043 GGCCCTGGGGAGCCTGGCCAGGG - Intronic
1049747625 8:144269731-144269753 CCCGCCGGGAAGCCAGGGCCCGG + Intronic
1049799729 8:144512178-144512200 GGCCCGGGAGCGCCAGGCCCTGG - Exonic
1052892769 9:33719674-33719696 CTCCCAGCTGAGCCAGGCCCTGG + Intergenic
1052941158 9:34132963-34132985 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1053199303 9:36141970-36141992 AGCCCTGGGGAGCCAGGCCCAGG + Intronic
1053489333 9:38487631-38487653 TGCCCCGCGCAGCCAGTCCCGGG - Intergenic
1057280831 9:93710346-93710368 GGCCCCGGGGAGGCATCCCCAGG - Intergenic
1057600339 9:96451127-96451149 CGCGCCGGGGACCCCCGCCCGGG - Intronic
1057669681 9:97076951-97076973 TGCCCCGCGCAGCCAGTCCCGGG - Intergenic
1057773245 9:97984713-97984735 CGCCAGTGGGAGCCAAGCCCCGG - Intronic
1057846604 9:98530953-98530975 CTGCCCTGGGAGCCTGGCCCGGG + Intronic
1059769723 9:117414401-117414423 CGCCCTGGGGATCCCTGCCCGGG - Intronic
1060419511 9:123457749-123457771 CCCGCCAGGGAGCCAGACCCAGG + Intronic
1061028115 9:128063592-128063614 TGCCCAGGAGCGCCAGGCCCAGG - Exonic
1061249227 9:129416728-129416750 ACCCCCCGGGAGCCAGGTCCAGG - Intergenic
1061486785 9:130924250-130924272 CTGCCCGGGGAACCCGGCCCCGG - Exonic
1061623005 9:131823946-131823968 CGCCGCGGAGAGCCCGGCGCCGG + Intergenic
1061710881 9:132486951-132486973 TGCCCCGGGGAGCGGGGACCAGG + Intronic
1061864961 9:133487439-133487461 CTCCCTGGGGACCCCGGCCCTGG - Intergenic
1061929084 9:133823021-133823043 GTCCCCTGAGAGCCAGGCCCTGG - Intronic
1061949115 9:133926361-133926383 CTCCCCAGGGCGCCAGCCCCCGG + Intronic
1061954272 9:133953493-133953515 GGCCCCAGTGTGCCAGGCCCAGG - Intronic
1061955437 9:133959042-133959064 AGCCCCAGGGGCCCAGGCCCAGG + Intronic
1062403205 9:136381490-136381512 CGGCTCTGGGAGCCAGGCCAGGG + Intronic
1062421024 9:136482861-136482883 CGGCCGGCGGAGCCAGGCCGTGG - Intronic
1062532165 9:137006789-137006811 GGCCCCAGGGAGGCAGGACCTGG - Intergenic
1062582898 9:137236259-137236281 CCAGACGGGGAGCCAGGCCCAGG - Exonic
1189658990 X:43277901-43277923 CTCCCAGGGCAGCCTGGCCCAGG + Intergenic
1190276857 X:48904621-48904643 AACCCAGAGGAGCCAGGCCCCGG + Exonic
1191025464 X:55908736-55908758 CGCCCCGTCGGCCCAGGCCCCGG + Intergenic
1195239511 X:102937324-102937346 CGCCCCGGGCAGCCCCGACCAGG + Exonic
1195298195 X:103500729-103500751 CGCCCCGGGCAGCCCCGACCAGG - Exonic
1195668418 X:107450119-107450141 CGCCCCCGGGAGCCGGGGGCAGG + Intergenic
1198812218 X:140547503-140547525 CACACCGGGTAGCCAGGCTCGGG - Intergenic
1199721321 X:150544577-150544599 GGCCTCGGTGAGCCAGGCCCTGG - Intergenic
1199976595 X:152898122-152898144 CGGGCCGGGGAGGCAGGCGCGGG - Intergenic
1200146629 X:153929736-153929758 GGCCCCGGGGAAGGAGGCCCTGG - Exonic
1200266606 X:154649525-154649547 CGCCCTCTGGAGACAGGCCCCGG + Intergenic