ID: 1083333964

View in Genome Browser
Species Human (GRCh38)
Location 11:61912241-61912263
Sequence CGCCCCGGGGAGCCAGGCCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 484
Summary {0: 1, 1: 0, 2: 4, 3: 53, 4: 426}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083333964_1083333973 -6 Left 1083333964 11:61912241-61912263 CCAGGGCCTGGCTCCCCGGGGCG 0: 1
1: 0
2: 4
3: 53
4: 426
Right 1083333973 11:61912258-61912280 GGGGCGGTGCCTTGGCACAGGGG 0: 1
1: 0
2: 0
3: 14
4: 329
1083333964_1083333972 -7 Left 1083333964 11:61912241-61912263 CCAGGGCCTGGCTCCCCGGGGCG 0: 1
1: 0
2: 4
3: 53
4: 426
Right 1083333972 11:61912257-61912279 CGGGGCGGTGCCTTGGCACAGGG 0: 1
1: 0
2: 0
3: 4
4: 189
1083333964_1083333971 -8 Left 1083333964 11:61912241-61912263 CCAGGGCCTGGCTCCCCGGGGCG 0: 1
1: 0
2: 4
3: 53
4: 426
Right 1083333971 11:61912256-61912278 CCGGGGCGGTGCCTTGGCACAGG 0: 1
1: 0
2: 1
3: 5
4: 140
1083333964_1083333976 24 Left 1083333964 11:61912241-61912263 CCAGGGCCTGGCTCCCCGGGGCG 0: 1
1: 0
2: 4
3: 53
4: 426
Right 1083333976 11:61912288-61912310 AGATTCACGCTCAGCCTTTGCGG 0: 1
1: 0
2: 3
3: 9
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083333964 Original CRISPR CGCCCCGGGGAGCCAGGCCC TGG (reversed) Intronic