ID: 1083334391

View in Genome Browser
Species Human (GRCh38)
Location 11:61914268-61914290
Sequence ACTCCAACCTCCCAGGGGTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 240}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083334391_1083334398 -3 Left 1083334391 11:61914268-61914290 CCCAACCCCTGGGAGGTTGGAGT 0: 1
1: 0
2: 0
3: 23
4: 240
Right 1083334398 11:61914288-61914310 AGTGGTCTCATCTCATTCCTGGG 0: 1
1: 0
2: 0
3: 21
4: 175
1083334391_1083334400 15 Left 1083334391 11:61914268-61914290 CCCAACCCCTGGGAGGTTGGAGT 0: 1
1: 0
2: 0
3: 23
4: 240
Right 1083334400 11:61914306-61914328 CTGGGCCATCCATCAATGCCTGG 0: 1
1: 0
2: 2
3: 12
4: 111
1083334391_1083334397 -4 Left 1083334391 11:61914268-61914290 CCCAACCCCTGGGAGGTTGGAGT 0: 1
1: 0
2: 0
3: 23
4: 240
Right 1083334397 11:61914287-61914309 GAGTGGTCTCATCTCATTCCTGG 0: 1
1: 0
2: 2
3: 12
4: 137

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083334391 Original CRISPR ACTCCAACCTCCCAGGGGTT GGG (reversed) Intronic
900921204 1:5671732-5671754 AACCTAACCTCTCAGGGGTTAGG - Intergenic
901746666 1:11378258-11378280 ACCCCTACCTCCCAGGGATGGGG - Intergenic
903730962 1:25494896-25494918 ACCCCTTACTCCCAGGGGTTTGG - Intronic
903923401 1:26817342-26817364 ACTCCATCCTCCCGGCGGTCGGG - Intergenic
904794801 1:33051212-33051234 ACTCCATCCTCCCGGCGGTCGGG - Intronic
905371322 1:37483999-37484021 AGGCCAACGTCCCAGGGGTAGGG - Exonic
906057624 1:42929159-42929181 ACTGCCTCCTCCCTGGGGTTTGG + Intronic
906436905 1:45803938-45803960 ACTCCATCCTCCCGGCGGTCGGG - Exonic
906486631 1:46240373-46240395 ACTCCATCCTCCCGGCGGTCGGG - Intergenic
906644533 1:47464307-47464329 ACATCTACCTGCCAGGGGTTAGG + Intergenic
908191482 1:61708161-61708183 ACCCCAGCCTCCCAGTGGCTAGG + Intronic
910907856 1:92200430-92200452 ACTCCACCATCCCTGGGGTCTGG - Intergenic
912655708 1:111484774-111484796 ACTGCAACCTCCCTTGGGTATGG - Intronic
914086471 1:144458788-144458810 ACTTCAACCTCCCAGAGTGTGGG - Intronic
916794155 1:168150193-168150215 CCTCCCACCTCCCAGGTGTCTGG - Intergenic
919775990 1:201194317-201194339 TCTCCTACCTCCCAGGGGAGAGG + Intronic
920023481 1:202974400-202974422 ACTCCATCCTTCCAGTAGTTTGG + Intergenic
920637255 1:207715809-207715831 ACTTCAGCCTCCCAGTAGTTGGG + Intronic
921414465 1:214870526-214870548 ACTCCATCCTCCCGGTGGTCGGG + Intergenic
923376070 1:233364140-233364162 CCTTCAACCTCTCTGGGGTTGGG + Intronic
924733183 1:246730807-246730829 ACCTCAGCCTCCCAGAGGTTTGG - Intronic
1064164551 10:12974952-12974974 ATTCCTACCTCGCAGGGGTTAGG - Intronic
1064192872 10:13222771-13222793 GCTTCAACCTCCCAGGGCTCAGG + Intronic
1067022101 10:42810050-42810072 ACTTCAGCCTCCCAAGCGTTAGG + Intronic
1069617397 10:69814829-69814851 ACTCCAGCCTCCAAGGGAATAGG + Intronic
1069918276 10:71800443-71800465 ACCCCAACCTACCTGGGGATGGG - Intronic
1070307881 10:75250723-75250745 ACAACAACCACCCAGGGTTTGGG - Intergenic
1072630443 10:97141913-97141935 CCTCCAGCCTCCCAGTAGTTGGG + Intronic
1072748180 10:97956919-97956941 ACCTCAGCCTCCCAGGTGTTTGG + Intronic
1072950145 10:99840229-99840251 ACTCCATCCTCCCGGCGGTCGGG + Intronic
1074947323 10:118293784-118293806 ACTCCAACATTCAAGTGGTTGGG - Intergenic
1075275539 10:121089531-121089553 ACTCGAGCCTCCATGGGGTTGGG + Intergenic
1075877556 10:125820704-125820726 ACTCAAACCTCCCAGGGACTTGG - Intronic
1078101043 11:8330451-8330473 CCTCCCACCTCCCACAGGTTGGG + Intergenic
1079140475 11:17805981-17806003 ACTTAAACTTCCCAGGGCTTTGG - Intronic
1079320448 11:19447512-19447534 ATTCCCACCTCACAGAGGTTTGG + Intronic
1080676058 11:34428444-34428466 GCTCCAACCTTCCAGAGGTCTGG + Intergenic
1081100626 11:38997266-38997288 ACTCCATCCTCCCAGTGCTCAGG + Intergenic
1082897033 11:58203065-58203087 ATTCCAACCTCTAAGGGGATTGG - Intergenic
1083299149 11:61731203-61731225 ACCCCTCCCTGCCAGGGGTTGGG + Intronic
1083334391 11:61914268-61914290 ACTCCAACCTCCCAGGGGTTGGG - Intronic
1085336531 11:75701001-75701023 ACTCCAACATCACAGGGCTTTGG - Intergenic
1085521461 11:77141496-77141518 ACTCCAACTCCCTAGGAGTTGGG - Intronic
1086562463 11:88183852-88183874 ACTTCAGCCTCCCAGTAGTTGGG - Intergenic
1089365705 11:117919717-117919739 ATACCAACCTCCCAGGGGTGTGG - Intronic
1091727043 12:2853645-2853667 ACTCCAACTCCCCAGTGCTTTGG + Intronic
1091762464 12:3096098-3096120 ACTCCATCCTCCCGGCGGTCGGG + Intronic
1093498080 12:19780028-19780050 ACCCTAACCTCCCACAGGTTGGG - Intergenic
1094133681 12:27101574-27101596 ACTCCATCCTCCTATGGCTTAGG + Intergenic
1094183820 12:27619618-27619640 ACTCCATCCTCCTATGGCTTAGG + Intronic
1095439324 12:42227071-42227093 ACTCCATCCTCCCGGCGGTCGGG - Intronic
1096022504 12:48333867-48333889 ACTCCATCCTCCCGGCGGTCGGG + Intergenic
1096694319 12:53339028-53339050 AGCCCAGCCTCCCAGGGGGTGGG + Intronic
1100004214 12:89874420-89874442 ACTCCAAGTTTCCTGGGGTTTGG - Intergenic
1101832839 12:108272702-108272724 ACGCCCACCTCCCAGGTTTTGGG + Intergenic
1102495475 12:113316287-113316309 ACTCCCAGGTTCCAGGGGTTAGG + Intronic
1102497659 12:113330509-113330531 ACTCCCACCTCACGGGGTTTGGG + Intronic
1103219311 12:119230504-119230526 TCTCCAACTTCCCAGGGCCTGGG + Intergenic
1103327222 12:120129713-120129735 CCTCCAACATCCCAGGGCCTCGG + Intronic
1104599966 12:130146129-130146151 ACCCCAACCTCCCAAAGGCTGGG - Intergenic
1111403516 13:87771186-87771208 ACCTCAGCCTCCCAGGTGTTGGG + Intergenic
1116871618 14:50073857-50073879 ACTCCATCCTCCCGGCGGTCGGG - Intergenic
1118794521 14:69129193-69129215 ATTCCAATCTCCCATGGATTGGG - Intronic
1119196143 14:72718001-72718023 GATCCTACCTCCAAGGGGTTTGG + Intronic
1119405202 14:74394573-74394595 CCATCAACCTCCCAGGGCTTTGG - Intergenic
1119902096 14:78269838-78269860 ACTCCGACTTCCCAGAGTTTAGG - Intronic
1121580580 14:95026667-95026689 ACTGCAAGCTCCTAGGGGTAGGG + Intergenic
1122114878 14:99522678-99522700 CCTCCCACCTCCCACGGGTTCGG + Intronic
1122393723 14:101407983-101408005 TCTCCAACCTGCCATGGGCTGGG - Intergenic
1122935865 14:104955850-104955872 ACCCCAACCTGCCAGGACTTAGG + Intronic
1122964043 14:105112799-105112821 ACTCCATCCTCCCGGCGGTCGGG + Intergenic
1126108858 15:45164023-45164045 CCACCAATCTCCCAGGGGATGGG - Intronic
1126767472 15:52023368-52023390 ACTACAACCTGCCAGTGGTGTGG + Intronic
1128041812 15:64581482-64581504 ACTCCTACCTCCCAGGGAAAAGG + Intronic
1128074745 15:64819077-64819099 AGCCCAAGCTCCCAGGGGCTAGG + Intronic
1128187374 15:65654272-65654294 ACTCCACCCCTCCAGGGGTGAGG - Exonic
1130563158 15:84974488-84974510 ATGCCAACCTGGCAGGGGTTTGG + Intergenic
1130899978 15:88199813-88199835 ACTCAAAGATCCCAGGGGCTTGG + Intronic
1132738033 16:1397148-1397170 CCTCCAACCCCCCAGGCGTAGGG - Intronic
1133207729 16:4243512-4243534 ACCTCAACCTCCGAGGGGCTGGG + Intergenic
1135430593 16:22379269-22379291 GCTTCAACCTCCCAGGGCTCAGG + Intronic
1138969216 16:62124321-62124343 ACTGTAACCTGACAGGGGTTGGG + Intergenic
1141486384 16:84343097-84343119 ATTCCCACCTCTCAGGGGTGTGG - Intergenic
1141940140 16:87270351-87270373 TCTCCAACCTTCCAGGAGTGAGG + Intronic
1144163003 17:12580274-12580296 ACCCCACCTGCCCAGGGGTTGGG - Intergenic
1144504871 17:15821387-15821409 TCTGAAACCTCCCAGGGGATGGG - Intergenic
1144645899 17:16973213-16973235 TCTGAAACCTCCCAGGGGATGGG + Intergenic
1145169044 17:20639270-20639292 TCTGAAACCTCCCAGGGGATGGG - Intergenic
1145203607 17:20968709-20968731 TCTGAAACCTCCCAGGGGATGGG - Intergenic
1145205646 17:20983912-20983934 ACTCCATCCTCCCGGCGGTCGGG - Intergenic
1146505993 17:33405883-33405905 ACTCCAATCACCCAGGGGCCAGG + Intronic
1146523331 17:33544043-33544065 ACTGCAGGCTCCCAGGGGTTGGG - Intronic
1147963163 17:44179914-44179936 ACTCCATCCTCCCGGCGGTCGGG - Intergenic
1149038649 17:52160339-52160361 ACTCCAACTGCCCAGGAGTCTGG + Intergenic
1149908706 17:60550746-60550768 ACTCCATCCTCCCGGCGGTCGGG - Intergenic
1149978930 17:61293873-61293895 ACTTCAGCCTCCCAGGTGTCTGG + Intronic
1152035387 17:77869154-77869176 TCTCCAAACTCCCAGTGGTTTGG - Intergenic
1152188928 17:78876391-78876413 ACTCCAGCCTAGCAGGGGTGGGG - Intronic
1153962469 18:10151396-10151418 ACCCCAAACTACCAGGTGTTTGG + Intergenic
1155256211 18:24000193-24000215 ACTCCAAAGTGCTAGGGGTTAGG - Intronic
1155405303 18:25481224-25481246 ACTCCATCCTCCCAGTTGTTCGG + Intergenic
1155832329 18:30533165-30533187 TCTCCTACTTCCCAGGGCTTTGG + Intergenic
1156231262 18:35155928-35155950 CCTCCCACCTGCCAGGGGTGGGG - Intergenic
1156451644 18:37269850-37269872 ACTCTGACCTCCCAGGCGATAGG + Intronic
1156530027 18:37806149-37806171 ACACCAAGCTCCCAGGGGCAGGG - Intergenic
1158618891 18:59013143-59013165 TCTCCCGCCTCCCTGGGGTTAGG + Intergenic
1160846979 19:1170374-1170396 CGGCCAACCTCCCGGGGGTTGGG + Intronic
1161407533 19:4098914-4098936 AATCCAACTGCCCAGGGGCTTGG + Intronic
1161512748 19:4680623-4680645 ACTGCACCCTCCCAGGGTTTAGG - Intronic
1161530514 19:4786437-4786459 ACTGCAACTTCCCAGGGAGTTGG + Intergenic
1161906938 19:7163672-7163694 ACTTCTAGCTCCCAGGTGTTTGG - Intronic
1162484420 19:10950272-10950294 GCCTCAACCTCCCAGGGGTCAGG - Intergenic
1162557026 19:11393468-11393490 GCTTCAACCTCCCAGGGCTCTGG + Intronic
1162608424 19:11730331-11730353 ACTCCAACCTCCCAGAGTATTGG - Intronic
1162946165 19:14045041-14045063 ACTGCAACCTCCCCGGGTTCAGG - Intronic
1163183077 19:15617694-15617716 ACTCCAGGTTCCCAGGGCTTTGG - Intronic
1163233641 19:16019291-16019313 CCTCCGCCCTCCCAGGGGTATGG - Intergenic
1164191886 19:22925419-22925441 ACTCCATCCTCCCGGCGGTCGGG - Intergenic
1165738588 19:38192822-38192844 ACCCCAGCCTCCCCAGGGTTGGG + Intronic
1165989679 19:39802978-39803000 ACTGCAGCCTCCCAGAGTTTAGG + Intergenic
1166261416 19:41644142-41644164 ACTCCATCCTCCCGGCGGTCGGG - Intronic
1167072420 19:47228502-47228524 CCTCCAGCCTACCCGGGGTTAGG + Intronic
1167576310 19:50319615-50319637 ACTAGAAACTCCCAGGGGATGGG - Intronic
1167816385 19:51885139-51885161 ATTCTAACCTTTCAGGGGTTGGG + Intronic
1167847493 19:52176555-52176577 ACTTCAGCCTCCCAGTAGTTGGG + Intergenic
1167982950 19:53291179-53291201 GCTCCAACCGCCCAGGCGATCGG + Exonic
925762367 2:7197961-7197983 ACTCCAGCCTCCCAAGGGTCTGG + Intergenic
926433084 2:12809756-12809778 ACTCCACCCTCCAATGGGATGGG - Intergenic
929633178 2:43487610-43487632 ATTCTAACCTCCAAGGAGTTAGG + Intronic
930589735 2:53312887-53312909 ACTCCAGGCTCCCAGGCCTTCGG - Intergenic
932395106 2:71439297-71439319 CCTCAAACCTCCCTGGGCTTAGG + Intergenic
933777506 2:85779888-85779910 ACCCCATCCTCCCAGGGCCTGGG - Intronic
933852012 2:86375641-86375663 CCTCAAACCTCCCAAGGGCTGGG + Intergenic
934706859 2:96487514-96487536 ACTTCAGCCTCCCAAAGGTTGGG - Intergenic
936399602 2:112155501-112155523 CCTCCAACCTCTCTGGGGTGAGG - Intronic
937042672 2:118834195-118834217 TCTCCGACCGCCCAGGGCTTGGG - Intergenic
937337885 2:121072878-121072900 ACTCCAGGCTGGCAGGGGTTAGG - Intergenic
938964066 2:136372141-136372163 CCTCCAAACTCCCATGTGTTTGG - Intergenic
940048410 2:149434986-149435008 AATCCAAGATACCAGGGGTTAGG - Intronic
940962609 2:159801770-159801792 ACTTCAGCCTCCCAAGTGTTGGG - Intronic
943069739 2:183126148-183126170 ACCTCAGCCTCCCAGGGGCTGGG + Intronic
944258459 2:197649697-197649719 AGTCCACCCTCCCAGAGCTTTGG + Intronic
947110197 2:226710206-226710228 ACTCCAATCTCCCAGACTTTGGG - Intergenic
948929103 2:241119331-241119353 AGGCCAACGTCCCAGGGGTAGGG - Intronic
1170455897 20:16532437-16532459 ACTCCAACCCACCAGGAGTTGGG + Intronic
1171205700 20:23279063-23279085 ACTCCAAGCTCTCAGGCCTTGGG - Intergenic
1172069262 20:32244539-32244561 CCTCCCACCTCCAAGGGGTTAGG + Intergenic
1172106235 20:32518767-32518789 TCTCCACCCTGCCAGGGTTTAGG - Intronic
1172201696 20:33131558-33131580 AGTGAAACTTCCCAGGGGTTAGG - Intergenic
1172604796 20:36207142-36207164 AGCCCAACCTCCCATGGGTCAGG + Intronic
1176553777 21:8243766-8243788 ACCTCAACCTCCCCAGGGTTAGG - Intergenic
1176572699 21:8426790-8426812 ACCTCAACCTCCCCAGGGTTAGG - Intergenic
1176580608 21:8471351-8471373 ACCTCAACCTCCCCAGGGTTAGG - Intergenic
1176722955 21:10406576-10406598 ACTTCAACCTCCCAAGTGTCTGG - Intergenic
1177036056 21:16044129-16044151 CCACCAACCTTCCAAGGGTTTGG - Intergenic
1178493927 21:33071222-33071244 ACTTTAACGTCCCAGGGGTGGGG - Exonic
1178814120 21:35911920-35911942 ACTCCAAGCTCTCAGGGGATGGG + Intronic
1179977524 21:44877368-44877390 ACTGCAACCTCCCAGAGTGTTGG + Intergenic
1180202501 21:46233352-46233374 CCCCCAAACTCCCAGAGGTTGGG - Intergenic
1182017520 22:27053029-27053051 AATCCACCCTCCCAGGTGCTCGG + Intergenic
1182025379 22:27114291-27114313 ACTACAAACTCCCAGAGGGTAGG + Intergenic
1182641330 22:31770150-31770172 GCCCCAACCTCCCAGGGCTCAGG - Intronic
1183845083 22:40536336-40536358 ACTCCATCCTCCCGGCGGTCGGG - Intronic
1203258781 22_KI270733v1_random:160798-160820 ACCTCAACCTCCCCAGGGTTAGG - Intergenic
950162544 3:10771292-10771314 ACTCCAGCCTCCCAGAGGTAGGG + Intergenic
950253891 3:11488409-11488431 ACTCCATCCTCCCGGCGGTCGGG + Intronic
950544174 3:13629097-13629119 ACACACACCTCCCAGGGGTGGGG - Intronic
951671232 3:25184426-25184448 ACTATAAGCTCCCAGAGGTTAGG - Intronic
953851442 3:46468281-46468303 TCTCCAACGTGCCAGGAGTTGGG + Intronic
955717554 3:61846663-61846685 ACTTCAACCTCCCAAGTGCTGGG - Intronic
957803682 3:85119160-85119182 ACCTCAGCCTCCCAAGGGTTGGG - Intronic
957943900 3:87038097-87038119 ACTCAAACCTCTCAGGGACTTGG + Intergenic
959419615 3:106112737-106112759 ACTCCATCCTCCCGGCGGTCGGG + Intergenic
962997349 3:140643771-140643793 ACACCAGCCTGTCAGGGGTTGGG - Intergenic
965909431 3:173753383-173753405 ACTCCAAACTTCCAGTGGCTCGG + Intronic
966515002 3:180809779-180809801 ACCTCAGCCTCCCAGGTGTTGGG - Intronic
966646728 3:182253768-182253790 ACCTCAACCTCCCAAGTGTTGGG + Intergenic
967873063 3:194248300-194248322 ATGCCGAGCTCCCAGGGGTTAGG + Intergenic
967979760 3:195058776-195058798 GCTCCTGCCTCCCAGGGGTGCGG + Intergenic
968281336 3:197479113-197479135 ACTCCAGGCTCCCAGCTGTTTGG - Intergenic
969706007 4:8791934-8791956 TCTCAAAGTTCCCAGGGGTTGGG + Intergenic
971381252 4:26100174-26100196 TCTCCTACCTCTCAGGGCTTTGG + Intergenic
972714949 4:41636158-41636180 ACTTCAGCCTCCCAAGTGTTGGG + Intronic
976097932 4:81528558-81528580 CCTCCAACCTGGAAGGGGTTAGG + Intronic
977537152 4:98267398-98267420 AATCCCATCACCCAGGGGTTTGG + Intronic
978465347 4:109002934-109002956 ACTGCAACCTGTCAGGGGTCAGG - Intronic
978719692 4:111893875-111893897 ACTCTCACCTCCCTGGAGTTAGG + Intergenic
981592729 4:146382402-146382424 ACTACAGACTCCCAGGGGCTGGG + Intronic
981751052 4:148092530-148092552 ATTCCAAGCTCCCAGTGCTTGGG + Intronic
982616127 4:157637857-157637879 ACTCCATCCTCCCGGCGGTCGGG + Intergenic
983320918 4:166195538-166195560 GCTCCGACCTCCCAGGGTTCAGG + Intergenic
985415715 4:189733966-189733988 ACTCCAACCTTCCAGGAGGATGG + Intergenic
985511318 5:315750-315772 ACTCCAGGCTCCCTGGGGATGGG + Intronic
987062393 5:14254820-14254842 TCTCCAACCTCCAAGTGGTCTGG - Intronic
992373692 5:76170972-76170994 ACTCCATCCTCCCGGCGGTCGGG - Intronic
992374552 5:76175350-76175372 ACTCAAATGGCCCAGGGGTTAGG + Intronic
993288702 5:86036697-86036719 ACTCCAGCCTGTCAGGGGATTGG + Intergenic
993467367 5:88265587-88265609 AGTCCACAGTCCCAGGGGTTGGG + Intronic
996088703 5:119329697-119329719 ACGCCCACCTCCCAGGGTTTTGG + Intronic
998826608 5:146107790-146107812 ACTCCAGCCTCCCAAGGGGCTGG + Intergenic
999272689 5:150306606-150306628 ACCCCAAACTCCCAGGCTTTTGG - Intronic
1000349202 5:160339982-160340004 ACTCCATCCACCCAGGTGCTCGG - Intronic
1000985219 5:167858742-167858764 ACTCCATCCTCCCGGCGGTCGGG - Intronic
1001940903 5:175738794-175738816 ACTCCACCCTCCCAGAGATGTGG - Intergenic
1002341440 5:178518906-178518928 ACTCCATCCTCCCGGCGGTCGGG + Intronic
1003141788 6:3477877-3477899 CCTCCAACCTCCCAGTGAGTGGG - Intergenic
1003871046 6:10403767-10403789 ACTCAAACCTCGCAGGGGTGAGG + Intronic
1004460894 6:15834829-15834851 ACTACAGCCTCCCTGGGGTTAGG - Intergenic
1006492103 6:34396892-34396914 ACTCCATCCTCCCGGCGGTCGGG - Intronic
1007674455 6:43581656-43581678 ACTCCATCCTCCCGGCGGTCGGG + Intronic
1008916608 6:56794663-56794685 CCTCCAGCCTCCTGGGGGTTGGG - Intronic
1011202305 6:84850525-84850547 ATTCCAACCTCCATGGGGTAGGG + Intergenic
1011590039 6:88963290-88963312 ACTCCAACGTGCCCGGGGGTGGG - Intronic
1012826092 6:104149070-104149092 ACTCCACCCTCCAAGGAGGTGGG - Intergenic
1013481392 6:110555931-110555953 ACATCAACCTCCCAGTGTTTGGG - Intergenic
1014730107 6:125022537-125022559 ACTGCAACCAGCCAGGGGTGTGG + Intronic
1015476511 6:133664202-133664224 ACTCCATCCTCCCGGCGGTCGGG - Intergenic
1017342003 6:153334853-153334875 ACTCCAACCTCCCAGAGTTAAGG - Intergenic
1017746131 6:157448126-157448148 ACCCCAGCCTCCCAAAGGTTGGG + Intronic
1019641628 7:2106537-2106559 GCTCCACTCTCCCAGGGGTGGGG + Intronic
1019783550 7:2959071-2959093 CCTCCAGCCTGCCATGGGTTTGG + Intronic
1020117287 7:5482784-5482806 ACCTCAGCCTCCCAGGTGTTGGG - Intronic
1020338384 7:7082790-7082812 ATTCTAACCTCACAGGGCTTGGG + Intergenic
1021872120 7:25017867-25017889 ACTCCATCCTCCCGGCGGTCGGG - Intergenic
1023024029 7:36035192-36035214 ACTCCTAGCTCCCAGAGGGTGGG - Intergenic
1026380903 7:69798432-69798454 ACTCCAGCATCCCAGGGGAAAGG - Intronic
1032007881 7:128318390-128318412 ACTTCAACCTCCCCGGGCTCAGG - Intronic
1035174328 7:157039698-157039720 TCTCCCAGCTCCCAGGGGCTCGG + Intergenic
1035508133 8:150693-150715 ACTCCATCCTCCCGGCGGTCGGG + Intergenic
1036536897 8:9658404-9658426 ACTCCATCCTCCCGGCGGTCGGG + Intronic
1037849683 8:22316868-22316890 ACCTCAACCTCCCTGGGTTTTGG + Intronic
1038325937 8:26572747-26572769 ACTTCAGCCTCCCAGGTGTTGGG + Intronic
1039491226 8:37948903-37948925 ACTTCCACCTCCCAGAGCTTGGG + Intergenic
1040416302 8:47198793-47198815 CCTCCAAACTCCCAAGGGCTGGG - Intergenic
1043740685 8:83807881-83807903 ACTCCATCCTCCCAGTGTGTAGG + Intergenic
1044660443 8:94590127-94590149 ACTCCATCCTCCCGGCGGTCGGG - Intergenic
1044860034 8:96514376-96514398 GTCCCAACCTGCCAGGGGTTTGG + Intronic
1047687095 8:127315792-127315814 ACTCCATCCTCCCGGCGGTCGGG - Intergenic
1048791864 8:138111654-138111676 ACTCTGATCTCCCAGGGCTTTGG - Intergenic
1049078483 8:140420471-140420493 ACTACAACCTACCTGGGGTGGGG + Intronic
1052908488 9:33858653-33858675 ACCCCAGCCTCCCAGGGTTCTGG + Intronic
1053457045 9:38241463-38241485 ACTCCATCCTCCCGGCGGTCGGG - Intergenic
1057790121 9:98119143-98119165 GCTCCGACCTCCCAGGGGTCCGG + Exonic
1058745320 9:107984917-107984939 AGTCCAACCTCCCTGGCATTAGG - Intergenic
1059210837 9:112513623-112513645 ACTCCATCCTCCCGGCGGTCGGG - Intronic
1060064756 9:120494976-120494998 ACTCCATCCTCCCGGCGGTCGGG - Intronic
1060652336 9:125339237-125339259 ACCCCAGCCTCCCAAGTGTTGGG + Intronic
1060876691 9:127089065-127089087 ACTCCAACCTCAACGGGGTCTGG - Exonic
1061127276 9:128684796-128684818 ACTCCTAACTCCCAAGTGTTGGG - Intronic
1061984113 9:134119146-134119168 ACTCCATCCTCCCGGCGGTCGGG + Intergenic
1062321195 9:135991189-135991211 ACTGGCACCTCCCAGGGCTTGGG + Intergenic
1203474971 Un_GL000220v1:142809-142831 ACCTCAACCTCCCCAGGGTTAGG - Intergenic
1203367197 Un_KI270442v1:269337-269359 AATCTAACCTATCAGGGGTTAGG + Intergenic
1186221284 X:7351816-7351838 GCTCCAACTTCCCAGGGTTGTGG - Exonic
1186841769 X:13491752-13491774 ACTCCAAGCTTCCAGTTGTTCGG + Intergenic
1187711250 X:22056683-22056705 ACTGCAACCTCCCAGTAGCTGGG - Intronic
1191618335 X:63190419-63190441 ACTCCATCCTCCCGGCGGTCGGG + Intergenic
1192621057 X:72680757-72680779 ACTCCATCCTCCCGGCGGTCGGG - Intronic
1194344389 X:92745207-92745229 ACTGCAACCTACCAGGGGGTGGG - Intergenic
1195036344 X:100973477-100973499 ACTCCATCCTCCCGGCGGTCGGG + Intronic
1195735433 X:108008077-108008099 GCCTCAACCTCCCAGGGCTTGGG + Intergenic
1200652734 Y:5861848-5861870 ACTGCAACCTACCAGGGGGTGGG - Intergenic
1202387174 Y:24337109-24337131 AGTCCATCCTCACAGGGGTCAGG + Intergenic
1202483612 Y:25333019-25333041 AGTCCATCCTCACAGGGGTCAGG - Intergenic