ID: 1083336103

View in Genome Browser
Species Human (GRCh38)
Location 11:61922738-61922760
Sequence TTCGCAGCCCAAAGCCCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083336103_1083336106 23 Left 1083336103 11:61922738-61922760 CCACTTGGGCTTTGGGCTGCGAA No data
Right 1083336106 11:61922784-61922806 AGATGCTGTCCTCCCTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083336103 Original CRISPR TTCGCAGCCCAAAGCCCAAG TGG (reversed) Intergenic
No off target data available for this crispr