ID: 1083343707

View in Genome Browser
Species Human (GRCh38)
Location 11:61975119-61975141
Sequence TTTTTCATGCAGAAGAGTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083343707_1083343709 -2 Left 1083343707 11:61975119-61975141 CCCTCACTCTTCTGCATGAAAAA No data
Right 1083343709 11:61975140-61975162 AAGTACCCAGCCTTCAACACCGG No data
1083343707_1083343710 -1 Left 1083343707 11:61975119-61975141 CCCTCACTCTTCTGCATGAAAAA No data
Right 1083343710 11:61975141-61975163 AGTACCCAGCCTTCAACACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083343707 Original CRISPR TTTTTCATGCAGAAGAGTGA GGG (reversed) Intergenic
No off target data available for this crispr