ID: 1083344682

View in Genome Browser
Species Human (GRCh38)
Location 11:61981019-61981041
Sequence CTAACTTTACCCCTGGAAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083344682_1083344692 18 Left 1083344682 11:61981019-61981041 CCTTCTTCCAGGGGTAAAGTTAG No data
Right 1083344692 11:61981060-61981082 ATCTCACAAGCATTGTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083344682 Original CRISPR CTAACTTTACCCCTGGAAGA AGG (reversed) Intergenic
No off target data available for this crispr