ID: 1083344692

View in Genome Browser
Species Human (GRCh38)
Location 11:61981060-61981082
Sequence ATCTCACAAGCATTGTGAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083344686_1083344692 -8 Left 1083344686 11:61981045-61981067 CCCCTGCCCTGCCGCATCTCACA No data
Right 1083344692 11:61981060-61981082 ATCTCACAAGCATTGTGAAAAGG No data
1083344688_1083344692 -10 Left 1083344688 11:61981047-61981069 CCTGCCCTGCCGCATCTCACAAG No data
Right 1083344692 11:61981060-61981082 ATCTCACAAGCATTGTGAAAAGG No data
1083344682_1083344692 18 Left 1083344682 11:61981019-61981041 CCTTCTTCCAGGGGTAAAGTTAG No data
Right 1083344692 11:61981060-61981082 ATCTCACAAGCATTGTGAAAAGG No data
1083344687_1083344692 -9 Left 1083344687 11:61981046-61981068 CCCTGCCCTGCCGCATCTCACAA No data
Right 1083344692 11:61981060-61981082 ATCTCACAAGCATTGTGAAAAGG No data
1083344684_1083344692 11 Left 1083344684 11:61981026-61981048 CCAGGGGTAAAGTTAGGACCCCC No data
Right 1083344692 11:61981060-61981082 ATCTCACAAGCATTGTGAAAAGG No data
1083344685_1083344692 -7 Left 1083344685 11:61981044-61981066 CCCCCTGCCCTGCCGCATCTCAC No data
Right 1083344692 11:61981060-61981082 ATCTCACAAGCATTGTGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083344692 Original CRISPR ATCTCACAAGCATTGTGAAA AGG Intergenic
No off target data available for this crispr