ID: 1083347670

View in Genome Browser
Species Human (GRCh38)
Location 11:62004877-62004899
Sequence AGCAAAATCCATGCATGGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083347670_1083347672 0 Left 1083347670 11:62004877-62004899 CCTGGCCATGCATGGATTTTGCT No data
Right 1083347672 11:62004900-62004922 CTTAAAAAATGTCTCTCAGCTGG No data
1083347670_1083347673 1 Left 1083347670 11:62004877-62004899 CCTGGCCATGCATGGATTTTGCT No data
Right 1083347673 11:62004901-62004923 TTAAAAAATGTCTCTCAGCTGGG No data
1083347670_1083347674 9 Left 1083347670 11:62004877-62004899 CCTGGCCATGCATGGATTTTGCT No data
Right 1083347674 11:62004909-62004931 TGTCTCTCAGCTGGGCGCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083347670 Original CRISPR AGCAAAATCCATGCATGGCC AGG (reversed) Intergenic
No off target data available for this crispr