ID: 1083347673

View in Genome Browser
Species Human (GRCh38)
Location 11:62004901-62004923
Sequence TTAAAAAATGTCTCTCAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083347666_1083347673 20 Left 1083347666 11:62004858-62004880 CCTTAGAAAGATTCCGAGGCCTG No data
Right 1083347673 11:62004901-62004923 TTAAAAAATGTCTCTCAGCTGGG No data
1083347671_1083347673 -4 Left 1083347671 11:62004882-62004904 CCATGCATGGATTTTGCTCTTAA No data
Right 1083347673 11:62004901-62004923 TTAAAAAATGTCTCTCAGCTGGG No data
1083347669_1083347673 7 Left 1083347669 11:62004871-62004893 CCGAGGCCTGGCCATGCATGGAT No data
Right 1083347673 11:62004901-62004923 TTAAAAAATGTCTCTCAGCTGGG No data
1083347670_1083347673 1 Left 1083347670 11:62004877-62004899 CCTGGCCATGCATGGATTTTGCT No data
Right 1083347673 11:62004901-62004923 TTAAAAAATGTCTCTCAGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083347673 Original CRISPR TTAAAAAATGTCTCTCAGCT GGG Intergenic
No off target data available for this crispr