ID: 1083351315

View in Genome Browser
Species Human (GRCh38)
Location 11:62031027-62031049
Sequence TGCTCCCCAGCCGGGCACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083351315_1083351321 -4 Left 1083351315 11:62031027-62031049 CCACCGTGCCCGGCTGGGGAGCA No data
Right 1083351321 11:62031046-62031068 AGCAGACTTTTTAAGGTTGTGGG No data
1083351315_1083351327 29 Left 1083351315 11:62031027-62031049 CCACCGTGCCCGGCTGGGGAGCA No data
Right 1083351327 11:62031079-62031101 GCCGGGACTGCTGATTGGTGAGG No data
1083351315_1083351326 24 Left 1083351315 11:62031027-62031049 CCACCGTGCCCGGCTGGGGAGCA No data
Right 1083351326 11:62031074-62031096 AGTGAGCCGGGACTGCTGATTGG No data
1083351315_1083351329 30 Left 1083351315 11:62031027-62031049 CCACCGTGCCCGGCTGGGGAGCA No data
Right 1083351329 11:62031080-62031102 CCGGGACTGCTGATTGGTGAGGG No data
1083351315_1083351322 -3 Left 1083351315 11:62031027-62031049 CCACCGTGCCCGGCTGGGGAGCA No data
Right 1083351322 11:62031047-62031069 GCAGACTTTTTAAGGTTGTGGGG No data
1083351315_1083351323 11 Left 1083351315 11:62031027-62031049 CCACCGTGCCCGGCTGGGGAGCA No data
Right 1083351323 11:62031061-62031083 GTTGTGGGGAGCCAGTGAGCCGG No data
1083351315_1083351324 12 Left 1083351315 11:62031027-62031049 CCACCGTGCCCGGCTGGGGAGCA No data
Right 1083351324 11:62031062-62031084 TTGTGGGGAGCCAGTGAGCCGGG No data
1083351315_1083351320 -5 Left 1083351315 11:62031027-62031049 CCACCGTGCCCGGCTGGGGAGCA No data
Right 1083351320 11:62031045-62031067 GAGCAGACTTTTTAAGGTTGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083351315 Original CRISPR TGCTCCCCAGCCGGGCACGG TGG (reversed) Intergenic