ID: 1083352385

View in Genome Browser
Species Human (GRCh38)
Location 11:62040093-62040115
Sequence TTACCTCAGCCTCAGATTAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083352379_1083352385 16 Left 1083352379 11:62040054-62040076 CCCAGGCTGGTCTCAAACTCCTG 0: 19126
1: 38854
2: 56666
3: 50459
4: 31838
Right 1083352385 11:62040093-62040115 TTACCTCAGCCTCAGATTACAGG No data
1083352380_1083352385 15 Left 1083352380 11:62040055-62040077 CCAGGCTGGTCTCAAACTCCTGG 0: 18758
1: 81811
2: 152089
3: 186177
4: 177040
Right 1083352385 11:62040093-62040115 TTACCTCAGCCTCAGATTACAGG No data
1083352383_1083352385 -3 Left 1083352383 11:62040073-62040095 CCTGGGCTCAAGTGATCCTCTTA 0: 86
1: 2573
2: 22110
3: 62670
4: 151940
Right 1083352385 11:62040093-62040115 TTACCTCAGCCTCAGATTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083352385 Original CRISPR TTACCTCAGCCTCAGATTAC AGG Intergenic
No off target data available for this crispr