ID: 1083352762

View in Genome Browser
Species Human (GRCh38)
Location 11:62042674-62042696
Sequence GAAGTAGAACTGACTGTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083352757_1083352762 13 Left 1083352757 11:62042638-62042660 CCAGTTAGTTTGGAATAAAGGGA No data
Right 1083352762 11:62042674-62042696 GAAGTAGAACTGACTGTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083352762 Original CRISPR GAAGTAGAACTGACTGTTGG AGG Intergenic
No off target data available for this crispr