ID: 1083355861

View in Genome Browser
Species Human (GRCh38)
Location 11:62065603-62065625
Sequence GATGTTGTCGTTTGGTGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083355861_1083355866 1 Left 1083355861 11:62065603-62065625 CCAAGACACCAAACGACAACATC No data
Right 1083355866 11:62065627-62065649 AGCCCTTAGTGAGCTGGTGGTGG No data
1083355861_1083355863 -5 Left 1083355861 11:62065603-62065625 CCAAGACACCAAACGACAACATC No data
Right 1083355863 11:62065621-62065643 ACATCCAGCCCTTAGTGAGCTGG No data
1083355861_1083355870 20 Left 1083355861 11:62065603-62065625 CCAAGACACCAAACGACAACATC No data
Right 1083355870 11:62065646-62065668 GTGGGAATGTGAGAAGCACATGG No data
1083355861_1083355864 -2 Left 1083355861 11:62065603-62065625 CCAAGACACCAAACGACAACATC No data
Right 1083355864 11:62065624-62065646 TCCAGCCCTTAGTGAGCTGGTGG No data
1083355861_1083355867 2 Left 1083355861 11:62065603-62065625 CCAAGACACCAAACGACAACATC No data
Right 1083355867 11:62065628-62065650 GCCCTTAGTGAGCTGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083355861 Original CRISPR GATGTTGTCGTTTGGTGTCT TGG (reversed) Intergenic