ID: 1083355862

View in Genome Browser
Species Human (GRCh38)
Location 11:62065611-62065633
Sequence AAGGGCTGGATGTTGTCGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083355862_1083355867 -6 Left 1083355862 11:62065611-62065633 CCAAACGACAACATCCAGCCCTT No data
Right 1083355867 11:62065628-62065650 GCCCTTAGTGAGCTGGTGGTGGG No data
1083355862_1083355864 -10 Left 1083355862 11:62065611-62065633 CCAAACGACAACATCCAGCCCTT No data
Right 1083355864 11:62065624-62065646 TCCAGCCCTTAGTGAGCTGGTGG No data
1083355862_1083355866 -7 Left 1083355862 11:62065611-62065633 CCAAACGACAACATCCAGCCCTT No data
Right 1083355866 11:62065627-62065649 AGCCCTTAGTGAGCTGGTGGTGG No data
1083355862_1083355871 26 Left 1083355862 11:62065611-62065633 CCAAACGACAACATCCAGCCCTT No data
Right 1083355871 11:62065660-62065682 AGCACATGGAAGATACATGCTGG No data
1083355862_1083355870 12 Left 1083355862 11:62065611-62065633 CCAAACGACAACATCCAGCCCTT No data
Right 1083355870 11:62065646-62065668 GTGGGAATGTGAGAAGCACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083355862 Original CRISPR AAGGGCTGGATGTTGTCGTT TGG (reversed) Intergenic