ID: 1083355867

View in Genome Browser
Species Human (GRCh38)
Location 11:62065628-62065650
Sequence GCCCTTAGTGAGCTGGTGGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083355862_1083355867 -6 Left 1083355862 11:62065611-62065633 CCAAACGACAACATCCAGCCCTT No data
Right 1083355867 11:62065628-62065650 GCCCTTAGTGAGCTGGTGGTGGG No data
1083355861_1083355867 2 Left 1083355861 11:62065603-62065625 CCAAGACACCAAACGACAACATC No data
Right 1083355867 11:62065628-62065650 GCCCTTAGTGAGCTGGTGGTGGG No data
1083355860_1083355867 24 Left 1083355860 11:62065581-62065603 CCACAAACTGTTGTGGGTGATGC No data
Right 1083355867 11:62065628-62065650 GCCCTTAGTGAGCTGGTGGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083355867 Original CRISPR GCCCTTAGTGAGCTGGTGGT GGG Intergenic