ID: 1083356896

View in Genome Browser
Species Human (GRCh38)
Location 11:62073230-62073252
Sequence TTGTAGACACGCTCGGGGCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083356896_1083356900 -6 Left 1083356896 11:62073230-62073252 CCTAGCCCCGAGCGTGTCTACAA No data
Right 1083356900 11:62073247-62073269 CTACAAAATTACTGACATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083356896 Original CRISPR TTGTAGACACGCTCGGGGCT AGG (reversed) Intergenic
No off target data available for this crispr