ID: 1083363258

View in Genome Browser
Species Human (GRCh38)
Location 11:62125925-62125947
Sequence TGGCTGGGGCTACTTTAGAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 2, 3: 11, 4: 139}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083363258 Original CRISPR TGGCTGGGGCTACTTTAGAT TGG Intronic
902278915 1:15360222-15360244 TGTCTGGGGCTACTCCTGATAGG + Intronic
902445882 1:16463914-16463936 TGGCTGGGGCTTCCTTATAAGGG + Intergenic
903218605 1:21856381-21856403 AGGCAAGGGCTACTCTAGATAGG - Intronic
904369922 1:30041988-30042010 TGGCAGCGGCTGCTTCAGATGGG - Intergenic
904877300 1:33665792-33665814 TGGAAGAGGCTACTTTAGATAGG - Intronic
905578960 1:39068898-39068920 AGGAGGGGGCTACTTTGGATGGG + Intergenic
906543112 1:46603377-46603399 TGGATTGGGGTACTTTAGAAAGG - Intronic
910303077 1:85729394-85729416 TGGCTGAGCCTATTTTAAATGGG + Exonic
915568559 1:156731031-156731053 GGGCAAGGACTACTTTAGATAGG - Intronic
919055779 1:192568099-192568121 TCTCTGGGGCTAGTTTTGATTGG + Intergenic
923978276 1:239289670-239289692 TGGCTGGAGCAAATTTAGACTGG - Intergenic
1066265670 10:33773929-33773951 AGGATGGGGATCCTTTAGATGGG - Intergenic
1070704373 10:78627062-78627084 GGGCTGGGGCTTCTGTAGACAGG - Intergenic
1070831947 10:79423151-79423173 TGTCTGGGGCAGCTTTCGATTGG - Intronic
1074128774 10:110554155-110554177 GGGGTGGTGTTACTTTAGATAGG + Intergenic
1074140525 10:110668229-110668251 TGTCTGGGGCTACCTTGGGTGGG + Intronic
1074145154 10:110710886-110710908 TGGCTGGGACTGCTTTTGCTTGG + Intronic
1075381145 10:122019536-122019558 TGGCAGGGGCCGCTTTAGTTTGG + Intronic
1078129039 11:8596720-8596742 GGGGTGGGGCTATTTTAGGTAGG - Intergenic
1080974117 11:37315265-37315287 AGGCTCGGGCTAATTTAGTTTGG + Intergenic
1081496172 11:43612800-43612822 AGTATGTGGCTACTTTAGATAGG + Intronic
1081506344 11:43721227-43721249 GGGGTGGGGATATTTTAGATAGG + Intronic
1081770131 11:45645162-45645184 TGGCTGGGGCTCCTCTTGGTGGG + Intergenic
1081822541 11:46013556-46013578 TGACTGTGTCTACTTTAGATGGG - Intronic
1082129751 11:48473554-48473576 AGGGTGGGGTTACTTCAGATTGG + Intergenic
1082649147 11:55765903-55765925 TGGCAGTGGTTACTTTAGGTGGG + Intergenic
1083363258 11:62125925-62125947 TGGCTGGGGCTACTTTAGATTGG + Intronic
1089387924 11:118080011-118080033 TGGCTGGAGCTTCTTTTGGTGGG - Intronic
1089406333 11:118200679-118200701 TGGCTGGTGCTACTTGGTATAGG - Intronic
1092353517 12:7775634-7775656 TGTGTAGGGCTACTTCAGATAGG - Intergenic
1092824749 12:12388387-12388409 TGGCTGCTCCTAATTTAGATGGG + Intronic
1094486398 12:30928787-30928809 GGGAGGTGGCTACTTTAGATGGG - Intronic
1097492139 12:60283120-60283142 TGGCAGCGGCTATTCTAGATGGG + Intergenic
1098617771 12:72551842-72551864 TGGTTGGAGCAACTCTAGATCGG + Intronic
1101712044 12:107276631-107276653 TGGCTGATGCTAATCTAGATGGG + Intergenic
1104319602 12:127738382-127738404 TGGCTTGGGCTGCTTTACAGAGG - Intergenic
1107948450 13:45440875-45440897 TGGCTGGGGCTTATTGATATAGG + Intergenic
1110810523 13:79807356-79807378 TGGCAGCGGCCACTCTAGATAGG - Intergenic
1112769223 13:102777552-102777574 TAGTGGTGGCTACTTTAGATTGG - Intergenic
1115292214 14:31785057-31785079 TGGAAGGTGCTACTTTAGACAGG - Intronic
1116071387 14:40050086-40050108 AGGCTGCTGCTACTTTAAATTGG + Intergenic
1117535456 14:56698675-56698697 AGGGTGAGGCTACTTAAGATGGG - Intronic
1118005431 14:61561159-61561181 TGGCTATGGGAACTTTAGATGGG - Intronic
1119116509 14:72026896-72026918 TAGGGGGGGCTACTTTGGATGGG + Intronic
1119472905 14:74910344-74910366 AGGCTGGGCCCACTTTAGTTGGG - Intronic
1120218266 14:81704226-81704248 GGGATGGGCCTACTTTAGATTGG - Intergenic
1122517793 14:102320485-102320507 TGACGGGGGCTGCTTTAGAGTGG + Intronic
1122577354 14:102750761-102750783 TGGCTGGGGCCACTGCAGGTTGG + Intergenic
1127637763 15:60887990-60888012 TAGCTGGAGCTACTTTTTATTGG - Intronic
1128174857 15:65546128-65546150 TGGCTGGGGCTATAGTATATTGG - Intronic
1129005810 15:72372464-72372486 TGTCTGGAGCAACATTAGATGGG + Intronic
1131298078 15:91169760-91169782 GGTGTGGGGCTACTTTAGCTAGG + Intronic
1132171681 15:99664253-99664275 TAGTTGGAGCTACTTTAAATGGG - Intronic
1134069296 16:11250677-11250699 TGGATGGGGCTCTTTTAGAAAGG - Intronic
1139625995 16:68188531-68188553 TGGCAGTGGCCACTCTAGATGGG + Intronic
1140529978 16:75656994-75657016 TGGCAGAAGCTCCTTTAGATTGG + Exonic
1142470090 17:158355-158377 TGGCTGGGGCTGCTTGGGAGAGG - Intronic
1143528466 17:7485858-7485880 GAGGTGGGGCTACTTTAGATGGG + Intronic
1144073815 17:11699442-11699464 TGGATTGGTCTACTATAGATAGG - Intronic
1146112983 17:30108209-30108231 TGGCTATGGCTACCTTAGCTGGG - Exonic
1146443069 17:32913957-32913979 TGGGAGGTGCTACTTTAGATAGG + Intergenic
1146981291 17:37164142-37164164 TGGCTGGGGCTCCATTAGGCAGG - Intronic
1152710189 17:81867501-81867523 TGCCTAGGGCTACTGTAGCTGGG + Intergenic
1156494130 18:37514784-37514806 AGGTTGGGGCTCCTTTAAATGGG + Intronic
1159133496 18:64308765-64308787 TTGCAGGTGCTTCTTTAGATAGG + Intergenic
1159172208 18:64785605-64785627 TGGCTTGGGCTTCTTTAGATAGG - Intergenic
1160941820 19:1623693-1623715 TGGCTGAGGCCCCTTTAGAAAGG - Intronic
1160963638 19:1735957-1735979 TGACTGGGGCTCCTTTTGGTGGG - Intergenic
1164846547 19:31437715-31437737 TGAGAGGGGCTACTTGAGATTGG + Intergenic
1165049735 19:33133844-33133866 TGGCCCTGGCTACTTTAGACGGG - Intronic
927305866 2:21572123-21572145 AAGTGGGGGCTACTTTAGATTGG - Intergenic
939227701 2:139384726-139384748 TGGGTGGTGCTACATTAGAGGGG + Intergenic
942363976 2:175203109-175203131 TGGCTGGGCCCACATTAGAGGGG - Intergenic
943832777 2:192484309-192484331 TGGCTGGGGAGACTTCAGAATGG - Intergenic
947110277 2:226710814-226710836 TGGCTGGGACCACTTGAAATGGG + Intergenic
1171264994 20:23763922-23763944 TGGCTGTGGCTAATGCAGATGGG - Intergenic
1171274636 20:23845614-23845636 TGGCTGTGGCTAATGCAGATGGG - Intergenic
1172116221 20:32574973-32574995 TGGCTGGGGCTAGGTGAGGTGGG - Intronic
1172151269 20:32792301-32792323 TGGCTGGGGCTTCTATATCTTGG + Intronic
1172440904 20:34965879-34965901 AGGGTGGGGCTACTGTAGATGGG + Intergenic
1173848455 20:46202682-46202704 TGGCTGGTTCAACTTTGGATGGG - Intronic
1175064942 20:56276755-56276777 TGGCAGTGGCCACTCTAGATGGG - Intergenic
1177052976 21:16262241-16262263 TGGTTGGGGTTACTTCAGGTTGG - Intergenic
1178813566 21:35906526-35906548 TGGCTTGTGCTACTTCAGCTGGG + Intronic
1183764945 22:39864414-39864436 AGGGTGGGGCTATTTTAGAAAGG - Intronic
1183888517 22:40905612-40905634 TGGAAGGTGCTAATTTAGATGGG + Intronic
949492245 3:4600400-4600422 TTGCTGGGGATACTGTGGATGGG + Intronic
951809075 3:26679593-26679615 TGGATGGTGCTATTTTAAATAGG - Intronic
953163648 3:40445114-40445136 TGGCAGTGGCCACTCTAGATGGG - Intergenic
953183787 3:40619992-40620014 ATGCTGGGGCTTCTTTAAATGGG + Intergenic
958195139 3:90234954-90234976 TGGCAGCGGCCACTGTAGATGGG - Intergenic
958977185 3:100682038-100682060 TGGCAGCGGCCACTTCAGATGGG - Intronic
960834069 3:121885752-121885774 TGGCAGGTGCTATTTTAAATAGG - Intronic
967996709 3:195172439-195172461 TGGCTGCGGGTACTGTTGATGGG - Intronic
969343808 4:6558837-6558859 TGGGTGGGGCATCTTTAGATGGG - Intronic
969588228 4:8106882-8106904 TGCATGGGGCTACTGTAGACAGG - Intronic
970517645 4:16849279-16849301 CGTTTGGGGCTACTTTAGTTGGG - Intronic
972221866 4:36965215-36965237 TGGCAGAGGCTACTTGGGATTGG - Intergenic
975801843 4:78068276-78068298 TGAAGGTGGCTACTTTAGATAGG + Intronic
980524275 4:133969329-133969351 TGGCTGAGTCTATTTTAAATGGG - Intergenic
980938111 4:139245639-139245661 TCTCTTGGGATACTTTAGATAGG + Intergenic
983474435 4:168196490-168196512 GGGCAGGGGCTACAATAGATGGG - Intergenic
984111805 4:175626379-175626401 TGGCTGGGGCAAATTTAGAAAGG + Intergenic
984875369 4:184363148-184363170 TGGCTGGGGCTAGGATGGATGGG + Intergenic
987095660 5:14546901-14546923 GGGGTGGGGTTATTTTAGATAGG + Intergenic
987192467 5:15492375-15492397 TGGCAGTGGCTACGTTAGCTGGG - Intergenic
988225166 5:28404315-28404337 TGGCAGCGGCCACTTTAAATGGG - Intergenic
989866009 5:46508604-46508626 TGCTTGGGTCTACTTTACATGGG - Intergenic
990688346 5:58333928-58333950 TGTTTGAGGCTACTTTACATAGG + Intergenic
994718665 5:103354464-103354486 TGACAGGAGCTACTTGAGATAGG + Intergenic
998232576 5:140370572-140370594 TGCCAGGGGCTACTTTAGATGGG + Intronic
999218999 5:149959838-149959860 TGGCTGTGGCTAGTTTACACAGG + Intergenic
1000450289 5:161377632-161377654 TGGCAGGGGTTACTTTAAACTGG + Intronic
1001210298 5:169805080-169805102 TGGCTGAGGCAACATTATATAGG - Intronic
1002311562 5:178318312-178318334 TGACTGGGACTCCTTTTGATTGG + Intronic
1005577188 6:27200884-27200906 TTGCTAGGGCTACCATAGATGGG + Intergenic
1007581405 6:42962395-42962417 TGCCTGGGGCTCCTTTAAGTGGG + Intronic
1008773092 6:55003243-55003265 CAGATGGGGCTACTTTAAATTGG - Intergenic
1009847040 6:69146682-69146704 TGGCAGTGGCCACTCTAGATAGG + Intronic
1012417708 6:99027592-99027614 TGACTGGTGCTCTTTTAGATGGG + Intergenic
1013395629 6:109736217-109736239 CTTCTGGGACTACTTTAGATTGG - Intronic
1015281891 6:131443012-131443034 TGGCTGGGGCTACAGTTTATAGG + Intergenic
1017052441 6:150406198-150406220 TGGTTGGGGGTACTGGAGATTGG - Intergenic
1017453704 6:154578406-154578428 TGTCTGGGTCTACTTCAGGTCGG + Intergenic
1017508530 6:155091182-155091204 TGGCTGGGCGTCCTTTAGATTGG - Intronic
1018814979 6:167323856-167323878 TGGGTGGGGTTACTTTATCTGGG - Intergenic
1020977057 7:15019540-15019562 TGGAGGGGGTTACTTTAGATAGG + Intergenic
1022778521 7:33553959-33553981 TGGTGGAGGCTACTTTCGATAGG + Intronic
1023539048 7:41245365-41245387 GGGTGGGGGCTACTGTAGATAGG - Intergenic
1023662841 7:42488392-42488414 TGCCTGGGACTACTTTGGAATGG - Intergenic
1024786368 7:52911736-52911758 TGGCAGCGGCTGCTCTAGATGGG + Intergenic
1026776109 7:73231957-73231979 TGGCTGGGGCTGACTCAGATGGG - Intergenic
1027016966 7:74785328-74785350 TGGCTGGGGCTGACTCAGATGGG - Intronic
1027071061 7:75160608-75160630 TGGCTGGGGCTGACTCAGATGGG + Intergenic
1032601336 7:133299385-133299407 TGGCTGTTGCTACTTTAGGAGGG + Intronic
1034542350 7:151766573-151766595 TGGCTCAGGCCACTTTAGAAAGG + Intronic
1038890704 8:31719596-31719618 TCGCTGCGGTTACTTTAGAAAGG + Intronic
1044811635 8:96069403-96069425 TGGCTGGGGCTCACTTAGAGTGG - Intergenic
1045245034 8:100435360-100435382 TGGCTGGGGCAGCCTGAGATGGG + Intergenic
1047104820 8:121720480-121720502 TGGCAGTGGCCACTCTAGATGGG + Intergenic
1048282029 8:133112719-133112741 GGGCTGGGGCTATTTTATATAGG - Intronic
1050410304 9:5357084-5357106 GAGGTGGTGCTACTTTAGATCGG - Intergenic
1051391525 9:16569860-16569882 TGGCTGAGGCAACTGGAGATTGG - Intronic
1052308764 9:27041052-27041074 AGACTGGGGCTACTGTAGAAAGG - Intronic
1052863056 9:33448493-33448515 TGGCTGGGGGTAAGTCAGATGGG - Intergenic
1055306245 9:74932147-74932169 TGCCTGTGGCTATTTTAAATGGG - Intergenic
1056768876 9:89462645-89462667 TGGCTGGGACAGCTTTAAATAGG - Intronic
1060321827 9:122568958-122568980 AGACTGGGGGTATTTTAGATGGG + Intergenic
1187509813 X:19907601-19907623 TGGCAAGGGATACTGTAGATTGG + Intergenic
1192250165 X:69406304-69406326 AGGTAGGGTCTACTTTAGATAGG + Intergenic
1192265479 X:69534390-69534412 TGGCAGTGGCCACTGTAGATGGG + Intergenic
1193093291 X:77518395-77518417 TGACTGTGGCTACTGTAAATGGG - Intronic
1202139679 Y:21708645-21708667 TGGCTGGTCCTTCATTAGATGGG + Intergenic