ID: 1083366547

View in Genome Browser
Species Human (GRCh38)
Location 11:62144971-62144993
Sequence CGCCACCCCAGGAGAAGGAG CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 260
Summary {0: 1, 1: 0, 2: 0, 3: 23, 4: 236}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083366539_1083366547 -6 Left 1083366539 11:62144954-62144976 CCATCTCCCTCGCTCCCCGCCAC 0: 1
1: 0
2: 3
3: 76
4: 1155
Right 1083366547 11:62144971-62144993 CGCCACCCCAGGAGAAGGAGCGG 0: 1
1: 0
2: 0
3: 23
4: 236
1083366537_1083366547 7 Left 1083366537 11:62144941-62144963 CCTTGCTCATGTCCCATCTCCCT 0: 1
1: 1
2: 1
3: 62
4: 464
Right 1083366547 11:62144971-62144993 CGCCACCCCAGGAGAAGGAGCGG 0: 1
1: 0
2: 0
3: 23
4: 236
1083366538_1083366547 -5 Left 1083366538 11:62144953-62144975 CCCATCTCCCTCGCTCCCCGCCA 0: 1
1: 0
2: 1
3: 22
4: 497
Right 1083366547 11:62144971-62144993 CGCCACCCCAGGAGAAGGAGCGG 0: 1
1: 0
2: 0
3: 23
4: 236

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083366547 Original CRISPR CGCCACCCCAGGAGAAGGAG CGG Exonic