ID: 1083366742

View in Genome Browser
Species Human (GRCh38)
Location 11:62145832-62145854
Sequence CTGGGTCAACCCCACAAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 132
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 122}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083366742_1083366751 28 Left 1083366742 11:62145832-62145854 CCCACCTTGTGGGGTTGACCCAG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1083366751 11:62145883-62145905 AGGTTTCCCAGAAGTCTCCAGGG 0: 1
1: 0
2: 0
3: 21
4: 214
1083366742_1083366750 27 Left 1083366742 11:62145832-62145854 CCCACCTTGTGGGGTTGACCCAG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1083366750 11:62145882-62145904 GAGGTTTCCCAGAAGTCTCCAGG 0: 1
1: 0
2: 3
3: 11
4: 182
1083366742_1083366749 8 Left 1083366742 11:62145832-62145854 CCCACCTTGTGGGGTTGACCCAG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1083366749 11:62145863-62145885 GTTGCTTCATGCTAAGAAGGAGG 0: 1
1: 0
2: 2
3: 8
4: 120
1083366742_1083366748 5 Left 1083366742 11:62145832-62145854 CCCACCTTGTGGGGTTGACCCAG 0: 1
1: 0
2: 0
3: 9
4: 122
Right 1083366748 11:62145860-62145882 CTTGTTGCTTCATGCTAAGAAGG 0: 1
1: 0
2: 0
3: 24
4: 217

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083366742 Original CRISPR CTGGGTCAACCCCACAAGGT GGG (reversed) Intronic
901457090 1:9369311-9369333 CTGGGTCAAGGCCATAAGCTGGG - Exonic
905207928 1:36353479-36353501 CTGGTTCACCCCAACAAGGGTGG + Intronic
915169219 1:153966248-153966270 CTGAGAAAGCCCCACAAGGTGGG + Intronic
919018113 1:192067473-192067495 CTGGATGCTCCCCACAAGGTGGG - Intergenic
921159069 1:212460413-212460435 CTGGGTCAAGCCCAAAAGGGAGG - Intergenic
923687845 1:236166034-236166056 CTTGGTAAACCCCACTAAGTGGG + Intronic
1067065650 10:43102637-43102659 GTGGGGCGGCCCCACAAGGTCGG - Intronic
1067877638 10:50019504-50019526 CTTGGCCCACCCCACCAGGTTGG + Intergenic
1074568236 10:114600924-114600946 CTTTGTAAACCCCAAAAGGTAGG + Intronic
1074783380 10:116818334-116818356 CTGGGACACCACCACAGGGTAGG - Intergenic
1075994732 10:126868162-126868184 CTGGGTCATCCCAACTTGGTGGG - Intergenic
1076289925 10:129337525-129337547 ATGGGTCAACCCCACAGGTCAGG + Intergenic
1077193264 11:1264996-1265018 CTGGGTCCCTCCCACAACGTGGG + Intergenic
1081330265 11:41792637-41792659 CTGGATCAATCCCACATTGTCGG - Intergenic
1081461841 11:43279333-43279355 CTGGGTCAATCCCTCAAGTGGGG + Intergenic
1081867840 11:46369390-46369412 CAGAGTCATCCTCACAAGGTGGG - Intronic
1083366742 11:62145832-62145854 CTGGGTCAACCCCACAAGGTGGG - Intronic
1085014616 11:73165123-73165145 CTGGTTCAACCCAAAAAGCTTGG + Intergenic
1085113279 11:73907642-73907664 CCTGGTCAACCCCACTGGGTAGG + Intronic
1087400040 11:97652852-97652874 CTTGGACACCCCCACCAGGTTGG + Intergenic
1089512221 11:119006770-119006792 CTGGGTCCCTCCCACAACGTGGG - Intronic
1091805529 12:3353361-3353383 CTAGGTCCACCCCAGCAGGTGGG - Intergenic
1092214023 12:6667855-6667877 CTGGGGCAGCCCCCCAGGGTGGG - Exonic
1093329034 12:17812933-17812955 CTGGGGCAACCCTGAAAGGTAGG - Intergenic
1097610039 12:61808128-61808150 CTGGGTCCCTCCCACAACGTGGG - Intronic
1100584503 12:95967265-95967287 CTGGGTCCCTCCCACAATGTGGG + Intronic
1103944079 12:124516701-124516723 CTGGCTCGACCCCTCAAGGATGG - Intronic
1106224222 13:27773089-27773111 CTGGGTCAGCCCCAAAGGCTTGG + Intergenic
1111943280 13:94636364-94636386 CTGGGTCCCTCCCACAACGTGGG + Intergenic
1114528669 14:23381765-23381787 CTCAGTCAACCACACAAGGGTGG - Intergenic
1116996655 14:51331840-51331862 GTGATTCAACCCCACAAGGAAGG - Intergenic
1117278035 14:54209224-54209246 GTGGGCCACCCCCACAAAGTCGG + Intergenic
1120126086 14:80745076-80745098 CTGGGTCCCTCCCACAACGTTGG - Intronic
1120129538 14:80788741-80788763 CTCGGTCAACCCTACAATTTAGG + Intronic
1121009509 14:90511883-90511905 CTGCCGCAACCCCATAAGGTGGG + Intergenic
1121090145 14:91175606-91175628 CAAGGTCAACCCCCCAAGGCTGG + Intronic
1121219593 14:92275580-92275602 CTGTGAGAACCCCACAGGGTGGG + Intergenic
1121570558 14:94943623-94943645 TCGCGTCAATCCCACAAGGTTGG + Intergenic
1124831430 15:33153479-33153501 CTGGATCTGCCCCACAAAGTAGG - Exonic
1127652284 15:61021064-61021086 CTTGGTCCTCCCCTCAAGGTGGG + Intronic
1131719582 15:95153220-95153242 CTGGGTCCCTCCCACAACGTGGG - Intergenic
1134099305 16:11440431-11440453 CTGGGGCACAGCCACAAGGTGGG + Intronic
1141896380 16:86961229-86961251 CTGGGACAGCCCCACAGTGTTGG - Intergenic
1142150465 16:88510334-88510356 CTGAGCCAACCCCACAGAGTGGG - Intronic
1142164788 16:88580464-88580486 CTGGGTCCTTCCCACAAGGGTGG - Intronic
1142178025 16:88653891-88653913 CTGAGTCCACCCCACAGGGCAGG + Intronic
1142473719 17:177922-177944 CTGGGTGAACCACACAGGGCAGG + Intronic
1149234282 17:54571912-54571934 CTGGGTCCCTCCCACAACGTGGG + Intergenic
1151347519 17:73511252-73511274 CTGAGTCAGCCCCACATGGAAGG - Intronic
1152266081 17:79295718-79295740 CTGTGTCCATCCCACAAGGATGG + Intronic
1152582440 17:81172261-81172283 CCGGGACAACCCCACACAGTGGG + Intergenic
1153348235 18:4051546-4051568 CTGGGTCCCTCCCACAATGTGGG + Intronic
1153517372 18:5916766-5916788 CTGGGTCATCCCCAGAAGTGGGG + Intergenic
1153837508 18:8977179-8977201 TTGGTTCAACCCAAAAAGGTGGG + Intergenic
1155839854 18:30631222-30631244 CTGGATCAATCCTACAATGTTGG + Intergenic
1157586151 18:48802533-48802555 CTCTGTCAACCTCAGAAGGTAGG + Intronic
1163467057 19:17474405-17474427 CTGGGTGAACCCAAGAAGGAAGG - Intronic
1164843491 19:31412383-31412405 CTGGATGATCCCCCCAAGGTTGG - Intergenic
1165981369 19:39727088-39727110 CTGGGAAAACCCTACAAAGTAGG - Intergenic
1167559158 19:50215100-50215122 CTGGTGCACCCCCACAGGGTGGG - Intronic
1168192073 19:54746039-54746061 GTGGGTGAACCTCATAAGGTCGG - Intronic
925611647 2:5706609-5706631 CTGGGGCAGCCACACAGGGTAGG + Intergenic
927640316 2:24841634-24841656 CTGGGTAAAGCCCACGATGTCGG + Exonic
933996599 2:87674600-87674622 CTGGGTGAACCCCAGGAGGAGGG - Intergenic
934610442 2:95731593-95731615 CTGGGTCCATCCCACAACATGGG + Intergenic
936297253 2:111276310-111276332 CTGGGTGAACCCCAGGAGGAGGG + Intergenic
937149043 2:119673329-119673351 CTGGGACAAAACCACAACGTTGG - Intergenic
937980236 2:127610382-127610404 GTGGGCCAACCCTACAAGGTAGG + Intronic
938841067 2:135164467-135164489 CTGGCTAAACCCAACAAGGTTGG - Intronic
939587152 2:144019698-144019720 CTGGTTTAACCCCTCAAGTTAGG - Intronic
943623883 2:190178576-190178598 CTGGGTCTCCCCCACCAGCTTGG + Intronic
943731512 2:191307720-191307742 CTTAGTCAACCCCACACGTTTGG + Intronic
945362706 2:208910875-208910897 CTGACTGAACCCCACAATGTTGG - Intergenic
945447825 2:209959266-209959288 CTGGGTAAACCCCCAAAAGTGGG + Intronic
945779525 2:214152532-214152554 AGGGACCAACCCCACAAGGTCGG + Intronic
947155151 2:227154911-227154933 TAGGGTCAACCCCAAAAGGTGGG - Intronic
948654622 2:239468979-239469001 CTGGGCCAACCCTACCAGGTGGG + Intergenic
1175733848 20:61371935-61371957 CTGGGTCATCTCCACAAGACTGG - Intronic
1176117815 20:63440658-63440680 CAGGGTAAACTCCCCAAGGTGGG - Intronic
1178701674 21:34839063-34839085 CTAAGACAACACCACAAGGTTGG + Intronic
1178852849 21:36227648-36227670 GTAGGTTAACCCCACAATGTTGG - Intronic
1179354793 21:40649263-40649285 CAGGGACAACCCAACAGGGTGGG - Intronic
1179404501 21:41114084-41114106 TTGGGTCACCCCCACAGGTTTGG - Intergenic
1180152852 21:45960762-45960784 CTGAGTCACTCCCACAACGTGGG + Intergenic
1181360014 22:22327229-22327251 CAGGGTCAGCTGCACAAGGTAGG + Intergenic
1181581610 22:23831887-23831909 ATGGGTCAGCCCCAGAGGGTGGG + Intronic
1182282102 22:29223907-29223929 CTGGCTCAATCCTACAAGGAAGG - Intronic
1184270249 22:43376912-43376934 CTGTGTTGACCTCACAAGGTGGG + Intergenic
1184965132 22:47965973-47965995 CTTTGTCAACCCCAGCAGGTTGG - Intergenic
1185236329 22:49715672-49715694 CAGGGTCAGCCCCACAGGGGAGG + Intergenic
950708395 3:14797938-14797960 GTGAGTCACCCCCTCAAGGTGGG + Intergenic
951038027 3:17955002-17955024 CTGGCTCAACCCAACTGGGTAGG + Intronic
958005844 3:87810802-87810824 CTGTGTCAAAGCCACAAGTTGGG - Intergenic
961605972 3:128095693-128095715 CTGGGTAAGCCCCACAATGGGGG - Intronic
962339643 3:134571053-134571075 CTGGGTCCCTCCCACAACGTGGG + Intronic
972918159 4:43905330-43905352 CTGGATCAACCCTACATTGTCGG - Intergenic
977389365 4:96388396-96388418 CTGGCTCAATCCCACACTGTGGG + Intergenic
979588657 4:122451006-122451028 CTGGGTCTACTCCACAAGGAGGG + Intergenic
981873043 4:149508845-149508867 CTGGGTCTTTCCCACAATGTGGG - Intergenic
984081575 4:175254463-175254485 CTGGATCAATCCCACATTGTTGG - Intergenic
984209218 4:176825150-176825172 CTGGCTCAACCCCAGGTGGTTGG - Intergenic
996549265 5:124712669-124712691 CTGGGCCAACTCCACAGGGTGGG - Intronic
998771254 5:145548645-145548667 CTGGGTAGACACCACAAGGATGG - Intronic
999510510 5:152245963-152245985 CTGGCTCATCCCCAGAAGCTAGG - Intergenic
1004340882 6:14806438-14806460 CTGGGTCTACCCCACCAAGCAGG - Intergenic
1004718752 6:18245827-18245849 CTGGGTCCCTCCCACAACGTGGG - Intronic
1006456064 6:34132725-34132747 CTCGGTCAGCGCCACAAGGCTGG + Intronic
1013233754 6:108178323-108178345 CTGGGTAAACCACCCAAGGCAGG + Intronic
1016752368 6:147645145-147645167 CTGGGGCAACCCCACACGACAGG + Intronic
1017752108 6:157497517-157497539 CAGTGTGAACCCCACAAGGAAGG + Intronic
1020048569 7:5063597-5063619 CAGAGTCAACCCCACAATGGGGG + Intronic
1021094101 7:16515495-16515517 CTTGGTCAACCACACAAGCTAGG - Intronic
1023804809 7:43865045-43865067 CTGGGTCCCTCCCACAACGTGGG - Intergenic
1023970319 7:44986274-44986296 CTGGGTGGACCCCAGTAGGTGGG - Intergenic
1026167833 7:67926258-67926280 TGAGGTCCACCCCACAAGGTGGG - Intergenic
1032780639 7:135162688-135162710 CTGGGTCCCTCCCACAATGTGGG + Intronic
1034418091 7:150975607-150975629 CTCTGACAACCCCATAAGGTAGG + Intronic
1040359213 8:46649268-46649290 CAGGGTCCTGCCCACAAGGTGGG + Intergenic
1043566013 8:81548620-81548642 CTGTGTTACTCCCACAAGGTCGG + Intergenic
1044008526 8:86964839-86964861 CTGAATCAATCCCACAACGTTGG + Intronic
1045745063 8:105408758-105408780 CTGTGTCAAACCCACAAGGAGGG + Intronic
1052019491 9:23509054-23509076 CTGGGTCCTTCCCACAACGTGGG - Intergenic
1053367789 9:37535930-37535952 CTGGCTCAAGCCCTCAAGGAGGG - Intronic
1054935079 9:70678129-70678151 ATGGGACCACTCCACAAGGTCGG - Intronic
1055649493 9:78393341-78393363 CTGGTTCAGCCCGAAAAGGTGGG + Intergenic
1056855883 9:90129282-90129304 AAGGGTCAACCCCACATGGCTGG - Intergenic
1058308643 9:103473377-103473399 TTGATTCAGCCCCACAAGGTGGG - Intergenic
1060190280 9:121588376-121588398 CTGGGTCATTCCCACCAGCTGGG + Intronic
1186201480 X:7159315-7159337 CTGTGTCAATACCACAGGGTTGG - Intergenic
1195246369 X:102999080-102999102 CTGGGTCAAGCCTACAAAGAGGG - Intergenic
1199088705 X:143665132-143665154 CTTCTTCACCCCCACAAGGTTGG - Intergenic
1201264604 Y:12193807-12193829 CTGGGTCTATCCCTCCAGGTGGG + Intergenic