ID: 1083367106

View in Genome Browser
Species Human (GRCh38)
Location 11:62148033-62148055
Sequence AGTCATGAGCCAGTGTGTTG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 265
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 238}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083367105_1083367106 3 Left 1083367105 11:62148007-62148029 CCAGAGAGGTTAAATGACATGTT 0: 1
1: 0
2: 22
3: 165
4: 741
Right 1083367106 11:62148033-62148055 AGTCATGAGCCAGTGTGTTGTGG 0: 1
1: 0
2: 2
3: 24
4: 238
1083367102_1083367106 28 Left 1083367102 11:62147982-62148004 CCACTTCACACAGGGGGAAACAG 0: 1
1: 0
2: 8
3: 104
4: 851
Right 1083367106 11:62148033-62148055 AGTCATGAGCCAGTGTGTTGTGG 0: 1
1: 0
2: 2
3: 24
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083367106 Original CRISPR AGTCATGAGCCAGTGTGTTG TGG Intronic
900220424 1:1505952-1505974 AGCCATGAGCCACTGTGTGTGGG - Intergenic
900790643 1:4677753-4677775 AATCATGTGCCTATGTGTTGAGG + Intronic
901517386 1:9757821-9757843 AGTGAGGGCCCAGTGTGTTGAGG - Intronic
903349403 1:22709320-22709342 GGTCAAGAGCCAGTGGGGTGGGG - Intergenic
904820021 1:33236005-33236027 ATTCAGGAGCCAGACTGTTGGGG + Intergenic
905111671 1:35599410-35599432 AGTCATGATGTAGTGTGTTCTGG - Intergenic
905303006 1:36998332-36998354 AGACATGAGACAGGGTGTTGGGG - Intronic
909599074 1:77442116-77442138 AGACATGAGGCACTGTGTAGTGG + Intronic
910933156 1:92462553-92462575 AGGCATGAGCCACTGTGCTCGGG + Intergenic
911327970 1:96491469-96491491 ATTCAAAAGACAGTGTGTTGAGG - Intergenic
911383611 1:97146952-97146974 TGCCATGAGCCAATGTATTGAGG + Intronic
911540299 1:99149729-99149751 AGTCATAAGCTATTGTGCTGAGG - Intergenic
914836460 1:151210863-151210885 AGTCATGAGCCATTGTGCCCGGG + Intronic
916823056 1:168418653-168418675 AGTCCTGCCCCATTGTGTTGTGG - Intergenic
917210857 1:172630703-172630725 AGTCAAGAGACAAGGTGTTGGGG + Intergenic
917455532 1:175182673-175182695 ATTCAGAAGCCAGTGTGTGGTGG - Intronic
917927311 1:179800127-179800149 AGACATGAAACAGTGTGCTGTGG + Intronic
918319388 1:183350251-183350273 AGCCATGAGCCAGGGTGTGCAGG + Intronic
919168702 1:193927530-193927552 AGCCATGGGCCAGAGTGGTGAGG - Intergenic
919213232 1:194515914-194515936 GGTCTTGACCCAGTTTGTTGTGG + Intergenic
919615695 1:199806000-199806022 AGCCATGAGCTGGTGTGTTGTGG - Intergenic
920841684 1:209560777-209560799 AAGCATAAGACAGTGTGTTGGGG - Intergenic
922926262 1:229349216-229349238 AGACATGAGCCACCGTGCTGGGG + Intergenic
1064248615 10:13689839-13689861 AGGCGTGAGCCACTGTGCTGGGG + Intronic
1064880404 10:20045447-20045469 AGGCATGAGCCACTGTGCTAGGG + Intronic
1065218725 10:23474710-23474732 AGGCATGAGCCACTGTGTGCCGG + Intergenic
1066160778 10:32725356-32725378 AGTCTTGGGCAAGAGTGTTGGGG - Intronic
1068938021 10:62655224-62655246 AGTAAAAAGCCAGTGTGCTGAGG + Intronic
1070428156 10:76309298-76309320 AGTCAGGAGCCAGTGTCCAGTGG + Intronic
1070853705 10:79588222-79588244 AGTCATGAGCCACTGTGCCTGGG + Intergenic
1071130558 10:82388110-82388132 AGTGATGAGTAATTGTGTTGTGG - Intronic
1072290397 10:93959770-93959792 AGTCATTATCCAGTGTGATAAGG + Intergenic
1074607627 10:114989419-114989441 AGGCATCATCCAGTCTGTTGAGG + Intergenic
1074730875 10:116373781-116373803 AGGCATGAGCCACTGTGGTCTGG + Intronic
1075004144 10:118818468-118818490 AGTCCTGCGCCAGGGTGTTCTGG - Intergenic
1075051757 10:119187448-119187470 AGGTATGAGCCACTGTGTTCGGG + Intergenic
1075600206 10:123761960-123761982 TGTCATGAGGCGGTGTGTGGAGG + Exonic
1079310878 11:19364633-19364655 AGTGATGACCCACTGTGTTCAGG - Intronic
1079808154 11:24960471-24960493 AGTCTTGGGAGAGTGTGTTGAGG + Intronic
1083367106 11:62148033-62148055 AGTCATGAGCCAGTGTGTTGTGG + Intronic
1083465608 11:62843688-62843710 AGTCATCAGCCAGGGAGTTGTGG + Intergenic
1083714265 11:64566924-64566946 ACTCGTGAGCCAGTGGGGTGGGG + Intronic
1088809912 11:113385263-113385285 AGTCAGCAGCCAGTGTGTGGAGG - Intergenic
1089319776 11:117617643-117617665 TGTCTTGTGGCAGTGTGTTGTGG - Intronic
1090075436 11:123577703-123577725 AGTCATTATCCAGTGAGGTGAGG + Intronic
1090878227 11:130810425-130810447 AGTCATGAGCGAGTGTGTGGAGG + Intergenic
1091680609 12:2524163-2524185 AGACACTAGCCACTGTGTTGAGG - Intronic
1092183235 12:6460543-6460565 AGGCATGAGCCACTGTGTCCAGG + Intronic
1094469250 12:30788214-30788236 AGTCACGAGACAAGGTGTTGGGG + Intergenic
1094658443 12:32442834-32442856 AGGCATGAGCCACTGTGTCCAGG + Intronic
1095547694 12:43390587-43390609 ACTCATGTTCCAGTGTTTTGTGG - Intronic
1099031840 12:77535944-77535966 CCCCATGAGACAGTGTGTTGAGG + Intergenic
1101752571 12:107594691-107594713 ATTCTTGGGACAGTGTGTTGAGG + Intronic
1101949575 12:109164182-109164204 AGCCTTGTGCCATTGTGTTGTGG - Intronic
1102685155 12:114718854-114718876 ATTCATGAGCCTGTATGTTTGGG + Intergenic
1105500888 13:20970764-20970786 AGTCAGTAGCCTGGGTGTTGGGG + Intergenic
1107621045 13:42231065-42231087 AGTCATGAGGCAGGGTGCTGTGG + Intronic
1107871042 13:44746707-44746729 AGACATGAGCCACCGTGCTGGGG + Intergenic
1111493044 13:89010152-89010174 AGTAGTGAGCCAGTGGGTTAAGG - Intergenic
1111848010 13:93535918-93535940 AGTGATGAGCCTGTATGTTTGGG + Intronic
1113245018 13:108385892-108385914 AGTCATGAGACACAGTGGTGAGG + Intergenic
1119205176 14:72788655-72788677 AGTCAGGAGCCAGGGAGGTGGGG - Intronic
1121024011 14:90600896-90600918 ATTCATGAGGCTGTGTCTTGGGG + Intronic
1121393241 14:93594546-93594568 AGGCATGAGCCACTGTGCTGGGG + Intronic
1121850135 14:97214111-97214133 AGTCTTGAGCCCGTGAGTTCTGG - Intergenic
1122615836 14:103017168-103017190 AATCATGAACCAGGGTGTAGCGG + Intronic
1122898961 14:104774246-104774268 TGGCATGAGGCAGTGTGGTGTGG - Intronic
1125551566 15:40548892-40548914 ATTCATGTTCCAGTGTGATGTGG - Intronic
1126447884 15:48770198-48770220 AAGGATGAGCCACTGTGTTGTGG - Intronic
1130038740 15:80385804-80385826 AGTTATGAGCTTGTGTGATGCGG + Intronic
1130379853 15:83362187-83362209 AGTCATGAGGCAGTGGATTCTGG + Intergenic
1131337996 15:91568825-91568847 AGTCAAGAGACAAGGTGTTGGGG + Intergenic
1132321761 15:100930532-100930554 AGTCAGGAGCAAGTGTGGGGTGG - Intronic
1134104553 16:11476477-11476499 AGTGAGGAGTGAGTGTGTTGTGG - Intronic
1134172589 16:11979918-11979940 AGGCATGAGCCACTGTGCTCCGG + Intronic
1136047507 16:27626132-27626154 AGGCATGAGCCACTGTGCTCTGG + Intronic
1136091711 16:27925467-27925489 AGTCTTGACCCAGAATGTTGTGG + Intronic
1139955469 16:70691074-70691096 AGTCTTGAGCCAAGGGGTTGAGG - Intronic
1140184073 16:72751040-72751062 ATTCATGGGCCATTGTGCTGGGG + Intergenic
1140235554 16:73155542-73155564 AGGCATGAGCCACTGTGTCCAGG - Intergenic
1141252911 16:82375048-82375070 AAAAATGAGCCAGTGTGTGGTGG - Intergenic
1144510500 17:15871099-15871121 TGTCATGAGCCAGTGTGCTTTGG + Intergenic
1144857051 17:18275038-18275060 AGGCATGAGCCACCGTGTTCAGG - Intronic
1144886238 17:18464470-18464492 AGGCGTGAGCCACTGTGCTGGGG - Intergenic
1145049883 17:19651127-19651149 AGTTATAAACCAGTGTGTTAAGG + Intronic
1145122022 17:20268832-20268854 TCTCACGAGCCAGTGTGCTGTGG + Intronic
1145145970 17:20479899-20479921 AGGCGTGAGCCACTGTGCTGGGG + Intergenic
1145174660 17:20688823-20688845 TGTCATGAGCCAGTGTGCTCTGG + Intergenic
1146195623 17:30810279-30810301 AGGCATGAGCCAATGTGCTCAGG - Intronic
1146489298 17:33268877-33268899 AGGAAAGAGCAAGTGTGTTGGGG - Intronic
1146763011 17:35495047-35495069 AAAAATGAGCCAGTGTGGTGGGG - Intronic
1148031517 17:44624602-44624624 AGACAGGAGCCAGAGTGCTGGGG + Intergenic
1150883158 17:69054241-69054263 AGGCATGAGCCACTGTGTCCAGG - Intronic
1153335503 18:3920062-3920084 AGGCATGAGCCACTGTGTCCGGG - Intronic
1155426403 18:25711918-25711940 AGACATAAACCAGTGTCTTGGGG - Intergenic
1157005789 18:43582403-43582425 AGACATGAACCACTGTGTTCTGG - Intergenic
1157036243 18:43978488-43978510 AGTCTGGAGTCAGTGTGTGGCGG + Intergenic
1157701871 18:49766190-49766212 AGGCATGAGCCACTGTGCTTGGG + Intergenic
1159972941 18:74676368-74676390 AGGCATGAGCCACTGTGTCCCGG + Intronic
1162947482 19:14052585-14052607 AGGCGTGAGCCACTGTGCTGGGG - Exonic
1163798705 19:19352368-19352390 AGTTATGTGTCTGTGTGTTGCGG - Intronic
1164271823 19:23679710-23679732 AGGCATGAGCAAGTAGGTTGTGG - Intronic
1164671777 19:30076535-30076557 AGGCCTGGGCCAGTGGGTTGGGG - Intergenic
1166019120 19:40009082-40009104 AGTAAGGAGCTAGAGTGTTGGGG + Intronic
1167384468 19:49155874-49155896 GGTCATGGGCACGTGTGTTGGGG - Intergenic
925403885 2:3592820-3592842 AGGCATGAGCCACTGTGCTTGGG + Intergenic
926075845 2:9942118-9942140 AGGCAAGAGACAGTGTGTTCTGG + Intergenic
926560793 2:14415265-14415287 AGGTATGAGTCAGTGTTTTGGGG + Intergenic
926737398 2:16083787-16083809 AGTCCCCAGCCAGTGAGTTGGGG - Intergenic
926776794 2:16431091-16431113 AGTCAAGAGCCAGACAGTTGTGG - Intergenic
928238256 2:29564120-29564142 AGTCAAGAGACAAGGTGTTGGGG - Intronic
929586954 2:43122253-43122275 AGGCATGGGCCAGTGTGTAGGGG - Intergenic
930866430 2:56126580-56126602 TGTCCTGAGCCAGGTTGTTGGGG + Intergenic
931450349 2:62362893-62362915 AGTCATGTACCAGTGTGCAGAGG - Intergenic
931883342 2:66589624-66589646 AGTCATTAAGCAGTGTCTTGAGG + Intergenic
932214299 2:69956694-69956716 CGTCATGAGTAAGTGTCTTGTGG - Intergenic
933065936 2:77795697-77795719 ATTCATGAGTCAGTGTGGAGTGG + Intergenic
933513949 2:83277545-83277567 AGGCATGAGCCACTGTGCTGGGG - Intergenic
935029236 2:99306172-99306194 AATCATGAGGCAGGGTGTGGTGG - Intronic
935102377 2:100009073-100009095 AGTCATCAGGCAGTGTGCTGGGG + Intronic
935696788 2:105777231-105777253 AGCCACGAGCCGGGGTGTTGCGG + Intronic
936427987 2:112435770-112435792 GGTCAGGACCCAGTGTGTAGCGG - Intergenic
938523289 2:132096244-132096266 AGGCATGAGCCATTGTGCTCAGG + Intergenic
938941520 2:136173552-136173574 AGACATGGGCCAGTGCGCTGAGG + Intergenic
941156522 2:161985677-161985699 AGCCATCTGGCAGTGTGTTGTGG + Intergenic
941575466 2:167224522-167224544 AGTCATGAGCCACTGTGCCCAGG + Intronic
942865581 2:180670438-180670460 AGTCATGCGGCACTGTCTTGTGG - Intergenic
945087110 2:206142971-206142993 AGGCATGAGCCAGTGTGCCTGGG - Intronic
945212812 2:207401281-207401303 AATCATGAGACAGTTTGATGAGG + Intergenic
946178418 2:217935940-217935962 TCTCATGAGGCAGTGTGATGTGG - Intronic
946365982 2:219249373-219249395 ATTAATGAGGCAGTGTGGTGTGG + Exonic
947238733 2:227971364-227971386 AGTCATCTCCCAGTGTGTTTAGG + Intergenic
949039358 2:241840275-241840297 AGTCATGAGCCAGCGTCTGGCGG + Intergenic
1170138998 20:13106533-13106555 AATCAGGAGGCTGTGTGTTGGGG + Intronic
1172594033 20:36137352-36137374 AGGCATGAGCCACTGCGCTGGGG + Intronic
1172957035 20:38768299-38768321 AGACATGAGCTGTTGTGTTGAGG + Intronic
1173653165 20:44680436-44680458 AGGCATGAGCCAGTGCGTCCAGG + Intergenic
1173704458 20:45099798-45099820 AGTCAGGAGTCAGTGGGTAGTGG - Intronic
1173871869 20:46347411-46347433 AGTGATGAGGCAGTGGGCTGGGG - Intronic
1174326043 20:49779743-49779765 AGGCGTGAGCCATTGTGCTGGGG - Intergenic
1174740772 20:53012070-53012092 AGTCATGGGCCATCGTGTAGTGG - Intronic
1175706893 20:61185820-61185842 AGGCATAAGCCACTGTGCTGAGG + Intergenic
1175855826 20:62120513-62120535 AGACAAGAGACAGTGTGATGCGG + Intergenic
1176374268 21:6079442-6079464 GGTCAGGACCCAGTGTGTAGCGG + Intergenic
1178886233 21:36486926-36486948 AGTCATTAGCCAGTGTGATGAGG + Intronic
1179749208 21:43458803-43458825 GGTCAGGACCCAGTGTGTAGCGG - Intergenic
1180662802 22:17483279-17483301 AGGCATGAGCCACTGTGTGGCGG - Intronic
1180947100 22:19701875-19701897 AGGCATGAGCCACTGTGTCCAGG - Intergenic
1181050731 22:20237193-20237215 AGTCCTGAGCCAGTGGGTGGAGG - Intergenic
1183339621 22:37272945-37272967 AGGCGTGAGCCACTGTGCTGGGG - Intergenic
1184010865 22:41747271-41747293 AGTCATGAGGCAGTCTTATGTGG - Intronic
949355770 3:3179397-3179419 AGCCGTGAGCCAGGGTGTCGGGG - Intronic
949520840 3:4852669-4852691 AATCATGAGCCACTGCGCTGAGG - Intronic
951059907 3:18193351-18193373 AGTCATGAATGTGTGTGTTGAGG + Intronic
951634387 3:24756968-24756990 TGTCATGATCCTGTGTTTTGAGG - Intergenic
951732411 3:25824713-25824735 AGTCATGAGCCACTGTGCCCAGG + Intergenic
952414358 3:33076943-33076965 AGGCATGAGCCATTGTGTCCGGG - Intronic
952792554 3:37211859-37211881 AGCCATGATTCAGTGTGATGGGG + Intergenic
955305721 3:57829059-57829081 AGACATGAGCCACTGTGTCTGGG + Intronic
955690420 3:61585381-61585403 AGTCATAAGACTGCGTGTTGAGG - Intronic
957333202 3:78792819-78792841 AGGCATGAGCCACTGTGTCTAGG - Intronic
957377096 3:79372163-79372185 AGTCCACAGCCAGGGTGTTGGGG + Intronic
960237199 3:115297466-115297488 AGGCATGAGCCACTGTGGTCAGG + Intergenic
961507588 3:127380820-127380842 TGTCATCAGCCAGTGTTTTTCGG - Intergenic
963872536 3:150433794-150433816 AGGCATGAGCCACTGTGCTCAGG - Intronic
963914790 3:150849012-150849034 AGACATCAGCCACTGTGCTGGGG + Intergenic
964009562 3:151874454-151874476 AGGCATGAGCCACTGTGCTGGGG + Intronic
965094212 3:164202792-164202814 ACTCATGAGTCAGTATGCTGTGG - Intergenic
966274140 3:178144098-178144120 AGAAATGAGCCAGTGTGCTGGGG + Intergenic
966889905 3:184399403-184399425 AGTCATGAGCCACCGTGCTGGGG + Intronic
969440333 4:7213154-7213176 ACTCATGAGCCAGATTATTGTGG - Intronic
970043965 4:11828977-11828999 AGGCATCATCCAGTTTGTTGAGG - Intergenic
970919524 4:21376702-21376724 AGTCATGAACAAATGAGTTGTGG - Intronic
971525654 4:27614386-27614408 AGTCATGTGCAAGCATGTTGTGG + Intergenic
972091999 4:35298209-35298231 AGTCATGAGCCACTGTGTCCGGG + Intergenic
972629240 4:40829111-40829133 AAGCTTGTGCCAGTGTGTTGGGG + Intronic
973070298 4:45850073-45850095 AGTCATGAGCCACTGTGCCCAGG + Intergenic
973125335 4:46576422-46576444 ATTGCTGTGCCAGTGTGTTGTGG - Intergenic
973834116 4:54792159-54792181 AGTCATAAGGCAGTGTGGTGTGG - Intergenic
974009287 4:56592662-56592684 AGTCCTGTGCCAGGGCGTTGGGG + Intronic
974929165 4:68341985-68342007 AGTCATTAGCAAGAGGGTTGGGG - Intronic
976755191 4:88490563-88490585 AGGCATGAGCCACTGTGTCTGGG - Intronic
976831508 4:89320022-89320044 ACTCATGATTCAGTGAGTTGGGG - Intergenic
976873864 4:89830672-89830694 AAGCAAGAGCCACTGTGTTGGGG - Intronic
977876720 4:102158291-102158313 GGTCAGCAGCCAGGGTGTTGGGG + Intergenic
977966491 4:103155589-103155611 AGGCATAAGCCATTGTGTTGAGG + Intronic
978711932 4:111793252-111793274 AGTCAAGAGCCAGAGAGTTTTGG - Intergenic
979910715 4:126362636-126362658 AGTCATGAGCAAGGGGGTTTGGG - Intergenic
981314161 4:143325189-143325211 AGGAATGAGCCACTGTATTGTGG + Intergenic
982241045 4:153299813-153299835 AGGTATGAGCCAGAGTGGTGGGG - Intronic
989088119 5:37697669-37697691 AGTCATGAGCCTGTTTATAGTGG - Exonic
992628758 5:78660153-78660175 TTTCATGAGCCTGTGTTTTGAGG - Intronic
992971361 5:82062106-82062128 AGGCATGAGCCACTGTGTCCAGG + Intronic
993578630 5:89632646-89632668 AGTCTTGGGAGAGTGTGTTGAGG + Intergenic
996165637 5:120219273-120219295 AGTCATGAGACAGTATGTGTTGG + Intergenic
997103136 5:130990571-130990593 TGTCATGAGTCAGTGGGATGAGG - Intergenic
997426131 5:133803932-133803954 AGCTATGAGCCAATGAGTTGAGG + Intergenic
998846137 5:146311724-146311746 ATTCATGGGCCCGTGTGTTCTGG + Intronic
1001987491 5:176087099-176087121 ATTCATTTCCCAGTGTGTTGTGG + Intronic
1002229379 5:177751043-177751065 ATTCATTTCCCAGTGTGTTGTGG - Intronic
1002265966 5:178032730-178032752 ATTCATTTCCCAGTGTGTTGTGG + Intronic
1002349737 5:178575763-178575785 GTGCATGAGCCATTGTGTTGGGG + Intronic
1002494989 5:179605687-179605709 AGACGGGAGCCAGTGTGATGAGG + Intronic
1006238937 6:32660826-32660848 AGCCATGATCCAGTGTGGGGAGG - Intronic
1006351486 6:33524471-33524493 AGGCATGAGCTACTGTGCTGGGG - Intergenic
1007696382 6:43736712-43736734 AGTCATGGGCAAGAGTGTTTTGG + Intergenic
1007883916 6:45203967-45203989 AGGCGTGAGCCACTGTGTTTGGG - Intronic
1008899696 6:56596962-56596984 AGGCATGAGCCACTGTGTCCAGG - Intronic
1011455913 6:87548933-87548955 AGGCATGAGCCATTGTGCTGGGG - Intronic
1011751275 6:90457588-90457610 AGTCATGAGCCAACGTGGTTAGG - Intergenic
1013301434 6:108808520-108808542 AGACATGAGCCTGTGTTTGGGGG - Intergenic
1016534893 6:145098880-145098902 AGTCAAGAGACAAGGTGTTGAGG - Intergenic
1016646865 6:146420053-146420075 AGACATCAGCAAATGTGTTGAGG - Intronic
1017191660 6:151660800-151660822 AGAAATGAGGCAGTGTATTGGGG - Intronic
1018781192 6:167067207-167067229 AGGCATGAGCTACTGTGCTGTGG + Intergenic
1023713871 7:43022997-43023019 AGGCATGAGCCACTGTGCCGGGG + Intergenic
1024528461 7:50370727-50370749 GGGCATGAGCCAGAGTGTTCCGG + Intronic
1024984084 7:55180859-55180881 AGTCATTACCCAGGGTGTTCCGG + Intronic
1026156332 7:67829106-67829128 AGGCATGAGCCATTGTGTCAAGG - Intergenic
1026591471 7:71699653-71699675 AGGCATGAGCCACTGTGTCCAGG - Intronic
1029160922 7:98551376-98551398 AGTCATGAGCCACTGTGCCCAGG + Intergenic
1029416443 7:100446187-100446209 AGTCATGACCCAGGCTGGTGGGG - Intergenic
1031303679 7:120097194-120097216 AGACATGAGCCAGTGTGTCCGGG + Intergenic
1032316889 7:130846257-130846279 AGTCCTTAGTCACTGTGTTGGGG + Intergenic
1034136280 7:148773291-148773313 AGACATTAGCCAGAGTTTTGGGG - Intronic
1034497342 7:151430820-151430842 AGTCGGGAGCCAGTTGGTTGGGG + Intronic
1037189023 8:16099757-16099779 AGTCATGGGCCATTGTTCTGGGG + Intergenic
1037907108 8:22721956-22721978 AGACATGAGGCAGTGAGGTGTGG - Intronic
1038531584 8:28322107-28322129 AGGCATGAGCCACTGTGCCGGGG - Intronic
1039129565 8:34247794-34247816 AGGCATGAGCCACTGTGCCGGGG + Intergenic
1042167566 8:65960366-65960388 AGTTTTGAGCCACTGTGTTTAGG + Intergenic
1043450605 8:80362300-80362322 AGGCATGAGCCACTGTGCTGGGG - Intergenic
1043930187 8:86081994-86082016 AGGCATGAGCCACTGTGTCCGGG - Intronic
1043950906 8:86308078-86308100 AGTCATGAGCCTGAGAGGTGAGG + Intronic
1046951382 8:120023058-120023080 AGTCAGGAGCCAGCATGGTGAGG + Intronic
1048218504 8:132518997-132519019 AGGCATGAGCCACTGTGTCTGGG - Intergenic
1048252708 8:132879892-132879914 TGCCATGAGCCAGGATGTTGAGG + Intronic
1048885191 8:138903905-138903927 GGCCATGTGCCAGTGTGTGGGGG + Intronic
1050266520 9:3896384-3896406 AGGCATGAGCCACTGTGCTCGGG - Intronic
1050330476 9:4540552-4540574 AGTCCTGAGGCAGTGTCTAGTGG - Intronic
1056272848 9:84963736-84963758 AGTCATGAGACAGTGTCAAGTGG - Intronic
1057828252 9:98387646-98387668 AGGCATGAGCCACTGTGTCCGGG - Intronic
1060298595 9:122360486-122360508 AGTGATGAGCTAGGGTGGTGGGG + Intergenic
1060495143 9:124112961-124112983 AGTAGTGAGCCAGTGTCTTGAGG + Intergenic
1060966654 9:127715573-127715595 AGCCATGAGCCGATGTGTTTTGG - Exonic
1061041743 9:128144680-128144702 AGGCAGGAGGCTGTGTGTTGTGG + Intergenic
1061363550 9:130158495-130158517 AGCCATCAGGCAGTGTGTTCTGG - Intergenic
1062668646 9:137693607-137693629 CGTCCTGAGCCACTGTGTGGGGG - Intronic
1062668664 9:137693675-137693697 CGTCCTGAGCCACTGTGTGGGGG - Intronic
1062668673 9:137693709-137693731 CGTCCTGAGCCACTGTGTGGGGG - Intronic
1062668700 9:137693811-137693833 CGTCCTGAGCCACTGTGTGGGGG - Intronic
1062668709 9:137693845-137693867 CGTCCTGAGCCACTGTGTGGGGG - Intronic
1062668718 9:137693879-137693901 CGTCCTGAGCCACTGTGTGGGGG - Intronic
1062668727 9:137693913-137693935 CGTCCTGAGCCACTGTGTGGGGG - Intronic
1062668762 9:137694049-137694071 CGTCCTGAGCCACTGTGTGGGGG - Intronic
1062668771 9:137694083-137694105 CGTCCTGAGCCACTGTGTGGGGG - Intronic
1185486741 X:487364-487386 AGGCATGAGCCACTGTGTGCTGG + Intergenic
1185705072 X:2260737-2260759 AGGCATGAGCCAGTGTGCCCAGG + Intronic
1188373242 X:29394730-29394752 AGTCCTGAGCGTGTGTGTTCAGG - Intronic
1197154144 X:123251863-123251885 AGTCATTAGCCATTGGCTTGAGG - Intronic
1199764843 X:150933975-150933997 AGGCATCAGCCAGTCTGTGGAGG + Intergenic
1199833442 X:151565513-151565535 AGTCAGGAGCCAGTGGGAAGTGG + Intronic
1199996594 X:153030163-153030185 AGTGAGGAGCCAGCATGTTGTGG + Intergenic
1200321606 X:155195906-155195928 AGAAATGACCCAATGTGTTGCGG - Intergenic
1201013813 Y:9577095-9577117 AGACATGAGCCACTGTGTACAGG + Intergenic