ID: 1083367547

View in Genome Browser
Species Human (GRCh38)
Location 11:62150574-62150596
Sequence AGGCAGAGCTAGAATGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 526
Summary {0: 1, 1: 0, 2: 0, 3: 43, 4: 482}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083367535_1083367547 24 Left 1083367535 11:62150527-62150549 CCAGCAGGGCTGAAGAGACTTGG 0: 1
1: 0
2: 2
3: 20
4: 173
Right 1083367547 11:62150574-62150596 AGGCAGAGCTAGAATGGGGAAGG 0: 1
1: 0
2: 0
3: 43
4: 482
1083367533_1083367547 29 Left 1083367533 11:62150522-62150544 CCCATCCAGCAGGGCTGAAGAGA 0: 1
1: 0
2: 1
3: 18
4: 177
Right 1083367547 11:62150574-62150596 AGGCAGAGCTAGAATGGGGAAGG 0: 1
1: 0
2: 0
3: 43
4: 482
1083367542_1083367547 -10 Left 1083367542 11:62150561-62150583 CCACCTGGGGCAGAGGCAGAGCT 0: 1
1: 1
2: 8
3: 49
4: 404
Right 1083367547 11:62150574-62150596 AGGCAGAGCTAGAATGGGGAAGG 0: 1
1: 0
2: 0
3: 43
4: 482
1083367540_1083367547 0 Left 1083367540 11:62150551-62150573 CCTAAGTAAGCCACCTGGGGCAG 0: 1
1: 0
2: 0
3: 11
4: 164
Right 1083367547 11:62150574-62150596 AGGCAGAGCTAGAATGGGGAAGG 0: 1
1: 0
2: 0
3: 43
4: 482
1083367534_1083367547 28 Left 1083367534 11:62150523-62150545 CCATCCAGCAGGGCTGAAGAGAC 0: 1
1: 0
2: 0
3: 40
4: 379
Right 1083367547 11:62150574-62150596 AGGCAGAGCTAGAATGGGGAAGG 0: 1
1: 0
2: 0
3: 43
4: 482

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083367547 Original CRISPR AGGCAGAGCTAGAATGGGGA AGG Intronic
900074683 1:803811-803833 AGGGAGGGCAAGAATTGGGATGG + Intergenic
900365911 1:2311931-2311953 ATGCAGAGGTAGGGTGGGGAGGG - Intergenic
901018778 1:6245693-6245715 AGGTGGAGCTAGAGTGGGGGTGG - Intergenic
901056125 1:6449313-6449335 AGGCAGGCCCAGATTGGGGAAGG - Intronic
901175933 1:7299082-7299104 AAGCAGACCTAGAGAGGGGAAGG - Intronic
901177773 1:7317148-7317170 AGGAAGGCCTAGGATGGGGAAGG + Intronic
901186816 1:7378952-7378974 AGTCAGAGACAGAGTGGGGATGG - Intronic
901460265 1:9387104-9387126 AAGCAGATCTGCAATGGGGAGGG + Intergenic
901461348 1:9393626-9393648 AGGCAGAGCCAGGATCCGGAGGG + Intergenic
901964212 1:12852786-12852808 AGTCAGAGCTAAAATGTGCAGGG + Intronic
902478231 1:16699182-16699204 AGGCAGGCCCAGACTGGGGAAGG + Intergenic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
903065819 1:20698802-20698824 AGGCAGGGCTGGAGTGGAGAGGG - Intronic
903117837 1:21192708-21192730 GGGCAGTGCCAGAGTGGGGAGGG - Intergenic
904360192 1:29966143-29966165 GGTCAGAGCCAGAATGGGAAAGG - Intergenic
904591888 1:31619474-31619496 AGGCAGAACTAGGATGGGTGTGG + Intronic
904804045 1:33118519-33118541 AGGCAGGGCTAGATCTGGGAAGG + Intronic
905170974 1:36109327-36109349 AGACAGAGCCAGAAGGAGGAGGG - Intronic
905380337 1:37557264-37557286 GGGCAGATTTAGGATGGGGAAGG + Intronic
906185427 1:43858817-43858839 AGCCAGAGCTAGAGGGGAGAAGG + Intronic
906236723 1:44215846-44215868 AGGCAGAGCTAGATTGGGCTAGG + Intronic
906751580 1:48267498-48267520 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
906781046 1:48573099-48573121 AGAAAGATCTAGAATAGGGAAGG - Intronic
907379621 1:54075454-54075476 ATGCATGGCTAGAATGGGCAAGG + Intronic
907514913 1:54987720-54987742 AGGCATAGCTAGAAAGTGGCAGG + Intronic
908189997 1:61692562-61692584 AGTCATGGCAAGAATGGGGAAGG + Intronic
908554500 1:65244008-65244030 AGGGAGACCTAAAATGGGGGAGG + Intergenic
909094504 1:71270832-71270854 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
909711999 1:78661932-78661954 AGGCAGAGATAAAATGGGCAAGG + Intronic
909742852 1:79054210-79054232 AGGAAGAGGAAGACTGGGGAGGG + Intergenic
909917405 1:81337113-81337135 ATGGAGAGCTGGAAAGGGGATGG - Intronic
910765690 1:90779968-90779990 AGGCAAAACTAGAATAGGGGTGG + Intergenic
911430028 1:97773781-97773803 ATGGGGAGCTAGAAGGGGGATGG - Intronic
911739497 1:101371541-101371563 AGGCAGAGATAGAATCAGGGAGG - Intergenic
913097675 1:115534848-115534870 AGGGGGAGCTGGAAAGGGGATGG - Intergenic
914937312 1:151992856-151992878 AGGCAGAGCTGGACTGAGGCTGG + Intronic
915791434 1:158676109-158676131 AGGTAGAGCAATAAAGGGGAGGG + Intronic
915995446 1:160557987-160558009 GGGCAGAGCTCCTATGGGGAGGG + Intronic
916490806 1:165300808-165300830 AGGCAGGGTGAGAAGGGGGAAGG - Intronic
916817563 1:168368472-168368494 AGGCAAAGAGATAATGGGGAAGG + Intergenic
917294511 1:173504922-173504944 TGGCAGTGCAAGAATGGGGAGGG - Intronic
917473050 1:175342425-175342447 AGACAGAGCAAGAATTGGGTGGG + Intronic
918113056 1:181475051-181475073 AGTCAGAGCTAGAATGTGTTAGG + Intronic
919048162 1:192480347-192480369 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
919240847 1:194914361-194914383 AAGGAGAGCTGGAAAGGGGAAGG - Intergenic
919660250 1:200237092-200237114 AGGCAGGGCTTGAATTGTGAAGG - Intergenic
919714242 1:200759101-200759123 AGGCAAAGCTGGAATGGGAGAGG - Intronic
920068469 1:203286055-203286077 AAGCAGACCTAGAAGTGGGATGG - Intergenic
920220755 1:204398591-204398613 AGGCAGGCCTGGAATGGGCAGGG + Intergenic
920461105 1:206141140-206141162 ATGCGGAGTTAGAAGGGGGATGG - Intergenic
920544130 1:206801460-206801482 AGGCTGACCAGGAATGGGGAGGG - Intronic
921175076 1:212586253-212586275 ACCCAGAGCTTGACTGGGGAAGG + Intronic
921945832 1:220885389-220885411 ACTCAGAGTTGGAATGGGGAAGG + Intergenic
922176658 1:223202641-223202663 GGGCAGAGCAGGGATGGGGAGGG + Intergenic
922270528 1:224028716-224028738 AGGGAGGGCAAGAATTGGGATGG + Intergenic
922503252 1:226111680-226111702 AGTGAAAGGTAGAATGGGGAAGG - Intergenic
923086002 1:230703981-230704003 AGGCACAGCAGGGATGGGGAGGG + Intronic
923946397 1:238892927-238892949 AGGCAGAGCTAAAAGATGGAAGG + Intergenic
924204583 1:241698673-241698695 AAGAAGAGGAAGAATGGGGAGGG - Intronic
924820088 1:247480895-247480917 CTGCAGAGTTAGAATGGGAATGG + Intergenic
924908854 1:248487312-248487334 AGGAAGAACTAGAATTTGGAGGG - Intergenic
924915253 1:248560750-248560772 AGGAAGAACTAGAATTTGGAGGG + Intergenic
1064587458 10:16852516-16852538 AGGCAAAGATAGAGTGAGGAAGG - Intronic
1065609045 10:27452675-27452697 AGGCAGGGTGAGAGTGGGGATGG - Intergenic
1066507470 10:36060336-36060358 AGGAAGAGACAGAGTGGGGAGGG + Intergenic
1066649067 10:37638710-37638732 AGGCAGAGCCAGGCTGGAGAAGG + Intergenic
1067155273 10:43776279-43776301 ACACAGAGCTGGATTGGGGAAGG - Intergenic
1067474579 10:46557106-46557128 AGGCGGAGCTAGGATGGAGAAGG - Intergenic
1070425374 10:76281935-76281957 AGGCAGGGCTACAATGGGGCTGG - Intronic
1071018750 10:81028129-81028151 ATGCAGAGGAAGAGTGGGGAGGG - Intergenic
1071276827 10:84063323-84063345 AGGCAGAGGCAAGATGGGGATGG - Intergenic
1071691102 10:87820223-87820245 TGGCAGGGCTAAAAGGGGGAGGG + Intronic
1071988367 10:91075278-91075300 TGGCAGAACTAGAAGGTGGAAGG + Intergenic
1073103765 10:101020725-101020747 AGGGAGAGTGAGAATGGGGCGGG + Intronic
1073480848 10:103785286-103785308 AGGAACAGCTAGCATGGGGGTGG + Intronic
1073510473 10:104039572-104039594 GGCCAGAGCCAGAATGGGGCGGG + Intronic
1074887239 10:117703827-117703849 AGGAAGAGCTGGGATGAGGATGG - Intergenic
1074925735 10:118068534-118068556 AGGCAGAGAAAGGATGGTGATGG - Intergenic
1075918749 10:126191963-126191985 AGGAAGAGAGAGAATGGGGAGGG + Intronic
1076074417 10:127522063-127522085 GGGGAGAGCGAGAATGAGGATGG - Intergenic
1076704460 10:132293669-132293691 AGGCAGGGCCAGAGTGGGGGTGG + Intronic
1076856324 10:133117073-133117095 AGGCACAGGCAGAAGGGGGAAGG + Intronic
1077465025 11:2729846-2729868 AGGCAGGGCTGGTTTGGGGAAGG + Intronic
1077634730 11:3834688-3834710 AGGCAGGCCCAGAATGGGGGAGG + Intronic
1077672440 11:4168168-4168190 AGGCAGAGTTAGACAGGGGCTGG - Intergenic
1077675443 11:4190379-4190401 AGGAAGAGCTAGAGGTGGGAAGG + Intergenic
1078039665 11:7848234-7848256 AGGGAGAGATTGAATGTGGATGG - Intergenic
1079538080 11:21539519-21539541 ATGCGGAGCTGGAAAGGGGATGG + Intronic
1080036822 11:27719693-27719715 AGGAAGAGATAGAATGAGGGAGG + Intronic
1080588849 11:33704040-33704062 ATGCAGAGCTGGAGTGGGGGAGG - Intronic
1081039279 11:38191188-38191210 TGGCAGAGCTATATTTGGGAAGG + Intergenic
1081205984 11:40276247-40276269 ATGCTGAGTTAGAATAGGGAAGG + Intronic
1081584551 11:44375492-44375514 GGGCAGAGCTAGGATGGAGGAGG - Intergenic
1081653559 11:44841668-44841690 ACGCAGAGCTAGGAAGAGGAGGG + Intronic
1081831752 11:46120831-46120853 AGGCAGAGGGGGAAGGGGGAGGG + Intronic
1083152308 11:60799560-60799582 GGGCAGAGCTAGCAAGAGGAAGG - Intronic
1083231313 11:61322211-61322233 ATGCTTATCTAGAATGGGGAGGG - Intronic
1083367547 11:62150574-62150596 AGGCAGAGCTAGAATGGGGAAGG + Intronic
1083626389 11:64074083-64074105 AGGCAAGGCCAGAATGGGGAGGG - Intronic
1085449498 11:76623409-76623431 AGGCACTCCCAGAATGGGGAGGG - Intergenic
1086270174 11:85053730-85053752 AGGCAGAGCTTGAACCGAGATGG + Intronic
1087009577 11:93500579-93500601 ACGCAGAACTGGAAAGGGGAAGG + Intronic
1088777594 11:113100548-113100570 ATGGAGAGCTGGAAAGGGGATGG + Intronic
1089014995 11:115158266-115158288 AAGCAGTGCAAGAGTGGGGATGG + Intergenic
1089688580 11:120172206-120172228 TGGGAGAGCTAGAAGGTGGATGG + Intronic
1089755438 11:120682749-120682771 AGGCAGTGTGAGCATGGGGAAGG - Intronic
1090387979 11:126367463-126367485 GGGCAGAGCTTGAATGGAGAGGG + Intronic
1090390617 11:126384909-126384931 GGACAGAGCTTGAATGGAGAGGG + Intronic
1090666490 11:128918193-128918215 AGGCAGAGTTACAACCGGGAGGG + Exonic
1090876914 11:130798384-130798406 AGGCAGAGTGGGAGTGGGGAAGG + Intergenic
1090926063 11:131251416-131251438 ATGCAGAGCTAGGATGGCGGAGG + Intergenic
1091907490 12:4200694-4200716 TGTGAGAGGTAGAATGGGGATGG - Intergenic
1092442514 12:8519379-8519401 AGGGAGGGGTAGAATGAGGAAGG - Intronic
1092508129 12:9124978-9125000 AGGCAGAGCAAGAGAGAGGATGG + Intergenic
1093369695 12:18352721-18352743 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1094739813 12:33275630-33275652 AGGTGGAGATAGAATGTGGAAGG - Intergenic
1095986953 12:48005117-48005139 ACGCAGAGCTGGATGGGGGAGGG - Intergenic
1096015067 12:48263821-48263843 AGGAAGAGAGAGAAAGGGGAAGG + Intergenic
1096817104 12:54208649-54208671 CAGCAGAGCTGGAATGTGGAGGG - Intergenic
1097188471 12:57208375-57208397 GGGCAGAGGCAGCATGGGGAGGG - Intronic
1097222388 12:57458909-57458931 AAGCAGAGCTAGGATGTGGGAGG + Intronic
1097998676 12:65917657-65917679 AGGAAGAGACAGAAGGGGGAAGG + Intronic
1099926464 12:89024590-89024612 AGGGACTACTAGAATGGGGAGGG - Intergenic
1100471365 12:94896319-94896341 AAGCAGAACCAGAATAGGGAAGG + Intergenic
1101638812 12:106570354-106570376 AAGCAGAGCTTGAATGTGGGAGG + Intronic
1101888543 12:108690988-108691010 ATGCAGAGCTGCAATGGGAAGGG - Intronic
1102768900 12:115456322-115456344 AGGCAGAGCTACTAAGTGGAAGG - Intergenic
1103025682 12:117571973-117571995 AGGCAGGGATAGGATGGGGGTGG - Intronic
1103090990 12:118097981-118098003 AGGCTGATCTAGAATGGGCCAGG - Intronic
1103723948 12:122988784-122988806 AGGCAGAGCCACCGTGGGGAAGG + Exonic
1103823052 12:123713238-123713260 AGACAGAGCCAGAAATGGGAAGG + Intronic
1103915062 12:124371925-124371947 AGGCAGAGCCAGACTGGGTGCGG + Intronic
1104232519 12:126898794-126898816 AGGAGGAGAAAGAATGGGGAAGG + Intergenic
1104265862 12:127231966-127231988 AAGGAGAGCTGGAAAGGGGATGG - Intergenic
1104603676 12:130171353-130171375 GGGCAGGGGTGGAATGGGGAGGG - Intergenic
1107003345 13:35577314-35577336 AGGTAGACCAAGAGTGGGGAAGG + Intronic
1107749111 13:43545465-43545487 AGGCAGTGTTAGGATGGGGAGGG + Intronic
1108071592 13:46634501-46634523 AGGCACAGCCTGAATGAGGAAGG - Intronic
1108158984 13:47618500-47618522 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
1108556836 13:51601720-51601742 AGGAAGAGGCAGAGTGGGGAAGG + Intronic
1109241154 13:59890210-59890232 GGGCAGAGCACTAATGGGGAAGG - Intronic
1109496540 13:63178955-63178977 AGGCAAAGAGAGAATGAGGAAGG - Intergenic
1109922243 13:69080975-69080997 GGCCAGAGCTAGAATGAGGCAGG + Intergenic
1111878124 13:93921496-93921518 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1113214911 13:108028862-108028884 ATGCAGAGGTAGAAGTGGGAGGG + Intergenic
1114269930 14:21094349-21094371 GGGCACAGCTAGCCTGGGGAAGG + Intronic
1114479256 14:23021718-23021740 AGGCAGAGCTGGACTGTGAATGG - Intronic
1115320625 14:32076699-32076721 AGGCGGAGGAAGAAGGGGGAGGG + Intronic
1115899563 14:38129629-38129651 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
1116809085 14:49522238-49522260 AGGAAGAGACAGAATGGGGAAGG - Intergenic
1116849917 14:49898212-49898234 AGGCAGAACAAGAATGGAGCGGG + Intergenic
1117168733 14:53068078-53068100 TGGCAGAATTAGAATGTGGATGG - Intronic
1118017525 14:61675234-61675256 AGGCAGCTCTGGAATGGAGATGG + Intergenic
1119139687 14:72255089-72255111 AGGCAGAGGGAGATGGGGGATGG + Intronic
1119899761 14:78249593-78249615 AGGCAGAGCTAGAGTAAGGGAGG + Intronic
1120059198 14:79961753-79961775 AGGGACTACTAGAATGGGGAGGG - Intergenic
1120095415 14:80382397-80382419 AGAGAGAGCTAGAAAGGGCACGG + Intronic
1120491152 14:85180126-85180148 AAGGGGAGCTAGAAAGGGGATGG - Intergenic
1120523277 14:85549063-85549085 ATGAAGAGCTGGAAAGGGGATGG - Intronic
1120996070 14:90419613-90419635 AGGAAGAGGTAGAATGAGGCTGG + Intergenic
1121080417 14:91103410-91103432 CGGCAGAGCTGGGATGGAGACGG - Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1123006557 14:105326587-105326609 AGGCAGCCCGAGAATGTGGAAGG - Intronic
1125832654 15:42727775-42727797 GGGCAGAGGGAGAATGGGAAAGG + Intronic
1125874807 15:43134197-43134219 AGGAAGAGGCAGCATGGGGAGGG - Intronic
1126861940 15:52893440-52893462 AGGAAGGGCTGGAATCGGGATGG + Intergenic
1126868493 15:52962229-52962251 AGCAAGACCGAGAATGGGGAGGG - Intergenic
1126967569 15:54072651-54072673 AGGCAGAGATAAGATGGGAAAGG + Intronic
1127027633 15:54824997-54825019 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1127278516 15:57468892-57468914 AGGCAAAGAGAGAATGAGGAAGG - Intronic
1127867777 15:63045744-63045766 AGGGAGCGCTGGAATGGGGTGGG + Intronic
1128310564 15:66629565-66629587 ATACACAGCTAGAATGAGGAGGG + Intronic
1128511637 15:68317196-68317218 AGGCACAGGTAGTTTGGGGAGGG - Intronic
1128676761 15:69615449-69615471 AGACAGAGCCTGAATTGGGAGGG + Intergenic
1128816813 15:70615997-70616019 AGGAACAGCAAGCATGGGGAAGG + Intergenic
1129117312 15:73371779-73371801 AGGCAGTGCTGGAAAGGAGAGGG - Intergenic
1129233373 15:74209055-74209077 GGGCAGAGCCAGACTGGAGAAGG - Intronic
1129665628 15:77577987-77578009 AGGCAGAGATAGAGGGAGGAGGG + Intergenic
1130106608 15:80933200-80933222 AGGCAGGGCTAGAAGGTGAAGGG - Intronic
1130210900 15:81920429-81920451 AGGGAGTGCAAAAATGGGGAGGG - Intergenic
1130982902 15:88825088-88825110 AGGCACAGCTAGAATGTGGCGGG + Intronic
1131408104 15:92183275-92183297 AGACAGAAGTAGTATGGGGAGGG - Intergenic
1131553102 15:93374750-93374772 AGGCAGAGGCAGGATGGGGTTGG + Intergenic
1131646234 15:94348359-94348381 AGGGAGAGAGAGAAGGGGGATGG - Intronic
1131679377 15:94705626-94705648 AGGGAGAGAGAGAAGGGGGAGGG - Intergenic
1131806072 15:96124365-96124387 AGGCGGAGCTAAATGGGGGATGG - Intergenic
1131893262 15:96997504-96997526 AGGCAGAGACAGAAAAGGGAAGG - Intergenic
1132101394 15:99025856-99025878 GGGTGGAGCTGGAATGGGGAAGG + Intergenic
1132590131 16:723002-723024 AGGCAGAGCTGGAACGGGAGCGG - Exonic
1133207990 16:4245516-4245538 GTTCAGAGCTAGAAAGGGGAAGG + Intergenic
1133328663 16:4957996-4958018 AGGCAGAGCTAGATTAGGGCGGG + Intronic
1135352196 16:21738515-21738537 ATGGGGAGCTAGAAAGGGGATGG + Intronic
1135450686 16:22554637-22554659 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1135487794 16:22881080-22881102 TGGCAGAGCTAGAATTTGAATGG - Intronic
1135762869 16:25151571-25151593 ATGCAGTTCTAGAATGGGGCTGG - Exonic
1136586001 16:31185162-31185184 AGGCAGAGGTGGCATGGGGTAGG + Exonic
1137514566 16:49131761-49131783 AGGCAGAGATAGTCTGGGAAGGG + Intergenic
1137629942 16:49936074-49936096 AGTCAGGGCTATCATGGGGAGGG + Intergenic
1138328421 16:56193300-56193322 AGGTAGAGGTGGAAGGGGGAGGG + Intronic
1138603555 16:58072499-58072521 AGGGAGGGCTGGAATGTGGAGGG + Intergenic
1139511197 16:67429646-67429668 AGGCAGGACTTGAATGAGGAGGG - Intergenic
1140339112 16:74139790-74139812 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1140734035 16:77881992-77882014 ATGCACAGCCAGGATGGGGATGG + Intronic
1140766883 16:78168228-78168250 AGGAAGAGGAAGAATGGGCAGGG - Intronic
1141300383 16:82810239-82810261 AAGCAGAGATAGAATGGGTGAGG + Intronic
1141724041 16:85774542-85774564 GGGGTGAGCAAGAATGGGGAAGG + Intronic
1141954858 16:87363993-87364015 ATGCAGAGCAAGGACGGGGAGGG + Intronic
1142246654 16:88973269-88973291 AGGCAGAGGAAGATTTGGGAGGG + Intronic
1142255937 16:89013996-89014018 AGGCAGAGAAAGAGTGAGGAAGG + Intergenic
1142418605 16:89956852-89956874 AGGCTGAGCTGCAAGGGGGAGGG + Intronic
1142666103 17:1464758-1464780 AGGCAGTGCTGGAGTGGGGAAGG - Exonic
1142789325 17:2251383-2251405 AGGCTGAGGTAGAACCGGGATGG + Intronic
1143103809 17:4518650-4518672 AGGAAGTGCCAGGATGGGGATGG + Intronic
1145274412 17:21421309-21421331 AGGTAGAGCTGGGATGGGGGTGG + Intergenic
1145312270 17:21707213-21707235 AGGTAGAGCTGGGATGGGGGTGG + Intergenic
1145996428 17:29107326-29107348 AGGCAGGCCTAGAAAGGAGAGGG + Intronic
1147229398 17:39006201-39006223 AGGCAGAGCTTGAACTGGGGTGG - Intergenic
1147428393 17:40357023-40357045 AGGCAGAGGGAGAAAGGGGCTGG - Intronic
1147443462 17:40461267-40461289 AGGCAGACCCTGGATGGGGAGGG + Intergenic
1148079130 17:44957836-44957858 CAGCTGAGCTAGACTGGGGAGGG + Intergenic
1148129374 17:45253957-45253979 GGGAAGAGCTGGCATGGGGAAGG - Intergenic
1148217170 17:45839639-45839661 AGGTAGAGCTGGGATGGGGCTGG - Intergenic
1148725389 17:49786072-49786094 AGGTATATTTAGAATGGGGAAGG - Intronic
1148741784 17:49897267-49897289 AGAGAGAGAAAGAATGGGGAAGG + Intergenic
1149454463 17:56776790-56776812 GGGCAGTGCTGGAATGGAGAAGG - Intergenic
1150222031 17:63501136-63501158 AGGCAGAGGTGACATGGGGAGGG - Intronic
1151012971 17:70522371-70522393 AGGCAGAGAGTGAATTGGGAGGG + Intergenic
1151245741 17:72793166-72793188 GGGAAAAGCTAGAATGAGGATGG + Intronic
1151385871 17:73754962-73754984 AGGCAGAGGGAGATTTGGGAGGG + Intergenic
1151438676 17:74114450-74114472 AGGCAGATCTGAACTGGGGAGGG + Intergenic
1151554946 17:74842078-74842100 AGGTAGAGCAAGGATCGGGATGG + Exonic
1153487121 18:5610559-5610581 AGTCTGGACTAGAATGGGGATGG + Intronic
1153852229 18:9106188-9106210 AGGAAGAGCCAGAAAGGGGGAGG - Intronic
1154059987 18:11050740-11050762 AGGCAGAATTAGAAAGGGGTAGG - Intronic
1155983337 18:32203827-32203849 AGCCAGAGAAAGAGTGGGGAGGG + Intronic
1156014498 18:32532911-32532933 AGTAAGAGCTAGAACGGGTATGG - Intergenic
1156400644 18:36736508-36736530 AAGGAGAGCTGGAAAGGGGATGG + Intronic
1156551596 18:38024739-38024761 AGGCAGAGCTAGGGTGAGGCAGG + Intergenic
1157114250 18:44848244-44848266 AGGCTTAGCTAGTTTGGGGAAGG + Intronic
1158516602 18:58135801-58135823 AGTCACAGCTAGACTGGGTATGG + Intronic
1158907644 18:62029425-62029447 AGGTAAAGATAGAAAGGGGATGG + Intergenic
1159619257 18:70618772-70618794 AAGCAGAGATGGATTGGGGAAGG + Intergenic
1159647751 18:70939814-70939836 AGGCAAAGCTAAAATAGTGAAGG + Intergenic
1160821888 19:1062778-1062800 AGGCAGGGCCAGAAAGGGCATGG - Intronic
1162178182 19:8847249-8847271 ATGGGGAGCTAGAAGGGGGATGG + Intergenic
1162344279 19:10110619-10110641 AGGCAGAGCTGGGAAGGGCAGGG + Intronic
1162502173 19:11060208-11060230 AGGCAGAGCTGGCATGTGGCAGG + Intronic
1163632566 19:18424862-18424884 AGGGAGGGGGAGAATGGGGAAGG + Intronic
1164573587 19:29391976-29391998 TGGCAGAGCCACAATGTGGAAGG + Intergenic
1166107845 19:40606174-40606196 GGGCAGAGCGAGAATGGAGTGGG - Intronic
1167268091 19:48493358-48493380 GGGCCGAGCTAGAGTGGGGCGGG - Intronic
1167268148 19:48493524-48493546 AGGCCGAGCTAGGGTGGGGCGGG - Intronic
1167268160 19:48493557-48493579 AGGCGGAGCTGGAGTGGGGCGGG - Intronic
1167311144 19:48738779-48738801 AGGCAGAGCTAGAGCAGGGCCGG - Intronic
1167608262 19:50493215-50493237 AGGTAGAAGGAGAATGGGGAGGG + Intergenic
1167634182 19:50644396-50644418 ATGAAGAGTTAGAGTGGGGATGG + Intronic
1167742429 19:51332039-51332061 GGGCAGAGAAAGAATTGGGAGGG + Exonic
1168461901 19:56566841-56566863 AGGGAGAGATAAAATGGGGTGGG + Intergenic
1202712252 1_KI270714v1_random:25010-25032 AGGCAGGCCCAGATTGGGGAAGG + Intergenic
925276792 2:2655793-2655815 AGGCAGAGCTAGAAAGACAAGGG - Intergenic
925615394 2:5740487-5740509 AGCCAGAGGCAGAATGGGTAAGG - Intergenic
925669386 2:6294556-6294578 AGGCTGAGCCAGGCTGGGGATGG - Intergenic
926040334 2:9667608-9667630 AGGCAGAAAAGGAATGGGGACGG + Intergenic
926307743 2:11651367-11651389 AGGTAAAGATACAATGGGGAAGG - Intergenic
926464846 2:13175552-13175574 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
927721520 2:25386105-25386127 AAACAGTGCTAGAATGGAGAGGG + Intronic
928441440 2:31295542-31295564 ATGCAGAGCTGAAAAGGGGATGG - Intergenic
929171114 2:38934434-38934456 AGGGAGGGATAGAAGGGGGAGGG - Intronic
930113404 2:47698151-47698173 AGGCTGAGCTAGTCTTGGGAAGG + Intronic
930192827 2:48478024-48478046 AGACAGAGATACAAGGGGGAAGG + Intronic
930695212 2:54404583-54404605 AGGCAGAGCAAGGTTGGGCATGG + Intergenic
930699023 2:54440530-54440552 ACTCAGAGCTAAGATGGGGATGG - Intergenic
931945040 2:67297030-67297052 AAGCAGAGGTAGAGTGGGGCTGG + Intergenic
934747258 2:96767540-96767562 AGGCACAGCTAGAAGCTGGAAGG - Intronic
934913338 2:98278544-98278566 ATGGAGAGCTAGAAAGGGGATGG + Intronic
935583066 2:104775708-104775730 AGGCGGAGGTAAAATGGAGAGGG + Intergenic
936226046 2:110653354-110653376 AGGCAAAGCTAGAATGAAAATGG + Intronic
936964687 2:118116226-118116248 AGGCAGGGGAAGAATGGGCATGG + Intergenic
937025274 2:118692512-118692534 AGGCAGAGCCAGGATAGGAATGG - Intergenic
937840401 2:126519068-126519090 ATGAAGAGCTGGAAAGGGGATGG - Intergenic
938574258 2:132589217-132589239 AGGCAGAGGGGCAATGGGGAGGG - Intronic
939878474 2:147603823-147603845 AAGCAGAGCAAGAATTGGAATGG - Intergenic
940660014 2:156534120-156534142 ATGGGGAGCTAGAAAGGGGATGG + Intronic
941880578 2:170476487-170476509 ATGGAGAGCTGGAATGGGGATGG + Intronic
942347179 2:175015699-175015721 AGGCCGAGCTTCAATGTGGAGGG - Intergenic
942444678 2:176070241-176070263 AGGCAGAGGTGGAATAGGGTTGG - Intergenic
943746036 2:191463631-191463653 ATGCAGAGCTGGAAAGCGGATGG + Intergenic
944667732 2:201971152-201971174 AGACAGAGGGAGAAAGGGGATGG + Intergenic
946237392 2:218332548-218332570 AGGCAGGGCTGAGATGGGGAAGG - Intronic
946305685 2:218855804-218855826 AGGGGGAGCTTGAATGGGGCAGG - Intergenic
948091884 2:235302046-235302068 AGGAAGAGAGAGAAGGGGGAAGG - Intergenic
948815838 2:240510053-240510075 AGGGAGGGCAAGAATGGGGAAGG - Intronic
1168862424 20:1055332-1055354 TGGCAGAGCAAGGCTGGGGAAGG - Intergenic
1171023932 20:21611550-21611572 AGGCAGAGTTGGAATGGGAAAGG + Intergenic
1171435587 20:25120589-25120611 GGGCAGGGGTGGAATGGGGAAGG + Intergenic
1172015626 20:31870797-31870819 AGGCAGAGCCGGAAGGGGGACGG - Intronic
1172396202 20:34607511-34607533 ATGGAGAGCTGGAAAGGGGATGG - Intronic
1172652664 20:36515070-36515092 AGGCAGAACTGGAATGTGGGAGG + Intronic
1172871684 20:38139656-38139678 TGGCAGAGGTAGAAAGGGGAAGG + Intronic
1173850472 20:46214691-46214713 AGGCAGAGCGGGAATTGGGAAGG - Intronic
1174030473 20:47620562-47620584 AGGCAGAGCAAGGATGAGGAAGG - Intronic
1174092957 20:48063888-48063910 AGGCAGGGAGAAAATGGGGAGGG + Intergenic
1174286819 20:49480008-49480030 AGCCAGAGCTGAAATGGGGAGGG - Intronic
1175055170 20:56191305-56191327 AGGCAGAGCCAGCAGGAGGACGG + Intergenic
1178087048 21:29122515-29122537 ATGGAGAGCTGGAAAGGGGATGG + Intronic
1178088143 21:29133645-29133667 AAAGAAAGCTAGAATGGGGAGGG - Intronic
1178147064 21:29752219-29752241 GGTCAGAGCTAGAATGGGCTGGG + Intronic
1179329398 21:40384234-40384256 AGGCAGAGGTGAAATCGGGATGG + Intronic
1179540349 21:42079585-42079607 GGGCAGATCTAGAAGGAGGAAGG + Intronic
1180333581 22:11555542-11555564 AGGAAAAGATAAAATGGGGACGG + Intergenic
1181851158 22:25750860-25750882 AGTCAGAGCCAGGAAGGGGAAGG + Intronic
1182106441 22:27693255-27693277 AGGAAGTGCTTGAAGGGGGATGG - Intergenic
1182317895 22:29460000-29460022 CGGCAGGGCTACAATGGTGAAGG - Intergenic
1183283283 22:36945610-36945632 AGGCAAAGAGAGAATGAGGAAGG + Intergenic
1184341468 22:43888340-43888362 AGGAAGAGCCAGGATGTGGATGG + Intronic
1184804786 22:46787428-46787450 AGGCAGAGCTACTCTGGTGAAGG - Intronic
949563247 3:5221830-5221852 ACACAGAGCCAGAGTGGGGAGGG - Intergenic
950014877 3:9748515-9748537 AGACAGAGCTGGGATGGAGACGG + Intergenic
951289681 3:20860489-20860511 AGGCACAGCTTTACTGGGGAAGG + Intergenic
952205612 3:31179151-31179173 GGGGAGAAATAGAATGGGGAAGG - Intergenic
952339086 3:32430342-32430364 AGGCATAAGCAGAATGGGGATGG - Intronic
952350817 3:32535380-32535402 GGCCAGTGCTAGAATGTGGATGG - Intronic
953252815 3:41262072-41262094 AGGCAGAGCAACAATGGGGTGGG - Intronic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
954309392 3:49753125-49753147 AGGCAGAGAGAAAATGGGGGTGG - Intronic
954361200 3:50123789-50123811 TGGCAGAGCTGGAGAGGGGAAGG + Intergenic
955602700 3:60664433-60664455 AGGAAGAGGAAGAAGGGGGAGGG - Intronic
956351091 3:68337281-68337303 AGGAAGAGAGAGAATGGGGCAGG + Intronic
956472280 3:69579812-69579834 AGGAAGAGAGACAATGGGGAGGG + Intergenic
956868460 3:73392258-73392280 TGGCAGAGCTAGACCGGGCAGGG + Intronic
957758413 3:84522776-84522798 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
958524684 3:95240810-95240832 ATGGAGAGCTAGAAAGAGGATGG + Intergenic
959933223 3:112004368-112004390 AGGCAGAGCAAGAAAGGTGGGGG + Intronic
960358178 3:116678771-116678793 ATGGAGAGCTGGAATGGGGATGG - Intronic
960509069 3:118526277-118526299 AGGCAGAGCTAGCAGGAGGATGG + Intergenic
960743071 3:120856191-120856213 AGCCAAAACTAGGATGGGGATGG - Intergenic
960811519 3:121631683-121631705 GGGCAGAGACAGCATGGGGAAGG - Exonic
963204015 3:142614376-142614398 AGGCAGTGAAAGAATGAGGATGG + Intronic
963977198 3:151494376-151494398 AGGCATATCTTGAATGGGAATGG + Intergenic
964327528 3:155563420-155563442 GGGGAGAGCTAGAAGGTGGATGG - Intronic
964555795 3:157936613-157936635 AGGGACAGCTGGAATGTGGAGGG - Intergenic
965347735 3:167572963-167572985 AGGAAGAATTAGAAAGGGGAGGG - Intronic
966199025 3:177342375-177342397 AGGCAGAGCTATAAGACGGAAGG + Intergenic
966780305 3:183578655-183578677 AGGCAGAGCAAGTTTGAGGAAGG + Intergenic
966924748 3:184636942-184636964 AAGGAGAGCTAGAATTGGGAGGG - Intronic
967051579 3:185789623-185789645 AGGAAGAGCTGGAATGAGGTGGG - Intronic
967149100 3:186631800-186631822 AGAGAGAGCTAGAAAGTGGAAGG - Intergenic
967881152 3:194302658-194302680 AAGCAGAGCAAGGATGGAGAAGG + Intergenic
968224412 3:196964643-196964665 TGGCAGTGCTAGACTGGGCACGG - Intronic
968248366 3:197179158-197179180 AGGCAGAGCTGCAATCCGGATGG + Intronic
969232818 4:5843346-5843368 ATGCAGGGCTACAAAGGGGAAGG - Intronic
969362864 4:6676156-6676178 AGGCAGACCTAGAGTAGGAAAGG + Intergenic
969522100 4:7684377-7684399 AGGGAGAGCTTGAAAGGGAAGGG - Intronic
969545083 4:7820739-7820761 AGGCAGAGTGAGGATGTGGAGGG + Intronic
969564179 4:7967947-7967969 AGGCAGAGCTAGAAGGCAGGTGG - Intronic
969630454 4:8332875-8332897 ACGCAGGGCAAGAATGTGGAGGG - Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970423954 4:15929573-15929595 AGGCAGGGCAAGGGTGGGGAGGG - Intergenic
970814165 4:20134244-20134266 AGGCAGAGCTGGAGGGGAGAAGG + Intergenic
970854136 4:20634318-20634340 AGGCTGAGGAAGAATTGGGAGGG + Intergenic
974368639 4:60985699-60985721 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
974578360 4:63760170-63760192 AGGCTGTGCTAGAATCAGGATGG - Intergenic
975707785 4:77128121-77128143 AAGGGGAGCTGGAATGGGGATGG + Intergenic
976802344 4:89006785-89006807 AAGGAGAGCTAGACAGGGGATGG + Intronic
976883602 4:89960483-89960505 AGGGTGAGCTGGAAAGGGGATGG + Intergenic
976892026 4:90060734-90060756 AGGATGAGCTATAAGGGGGAAGG - Intergenic
980097313 4:128504692-128504714 ATGGAGAGCTGGAAAGGGGATGG + Intergenic
981120047 4:141039367-141039389 AGGTAGAGAAAGAAAGGGGAGGG + Intronic
981373502 4:143987349-143987371 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
981786052 4:148480881-148480903 TTGGAGAGCTAGAATGTGGAGGG - Intergenic
982192634 4:152873865-152873887 AGGCAGAGACAGAGTGGGAAAGG - Intronic
983192757 4:164772221-164772243 AGGAAGAGGGAGAAGGGGGAGGG + Intergenic
983695274 4:170520608-170520630 AGGTAGAGCTAGGATGGGAGTGG + Intergenic
983810195 4:172051473-172051495 AGGGGGAGCTGGAATGGGGATGG + Intronic
984179073 4:176458732-176458754 AGGCAGAAATAGAGAGGGGAAGG + Intergenic
985746936 5:1653078-1653100 AGGCAGAGCTAGCTTGGTGGTGG + Intergenic
985908905 5:2863903-2863925 AGGCAGAACTGGGATGGGGCAGG + Intergenic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988592975 5:32565151-32565173 AGGCAGAACTAGCATGGGTGGGG + Intronic
989044784 5:37264241-37264263 AGGCAGGGATAAAGTGGGGATGG - Intergenic
990677561 5:58204794-58204816 AGGCAGAGGTATAAAGGAGAAGG + Intergenic
990989025 5:61667043-61667065 ACCTAGAGCTAAAATGGGGAAGG + Intronic
991376602 5:65974580-65974602 AGGAAGAGTTAAGATGGGGATGG - Intronic
992108227 5:73468145-73468167 AAACAGAGCAAGAATGGGGGGGG + Intergenic
992758187 5:79928969-79928991 AGCCAGAGATAGCATGGGGCAGG - Intergenic
994026237 5:95087743-95087765 AGGCAGAGCCACAAAAGGGAAGG - Intronic
994368859 5:98946947-98946969 AGGCAGAGCTTGCAGGGGGCTGG - Intergenic
995533644 5:113114787-113114809 AAGGGGAGCTAGAAGGGGGATGG - Intronic
995898253 5:117039959-117039981 AGGTAGAGTTAGGATGGGGATGG + Intergenic
996243326 5:121228827-121228849 AGGAAGAGATGGAATGGGGAAGG + Intergenic
996277825 5:121689043-121689065 ATGAAGAGCAAAAATGGGGAAGG + Intergenic
998848687 5:146334627-146334649 AGGCAGTAGTAGCATGGGGAAGG - Intronic
999736499 5:154517280-154517302 AGGCTGAGCCACAGTGGGGAGGG - Intergenic
1000234449 5:159344555-159344577 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1000429654 5:161136157-161136179 ACACAGAGATATAATGGGGAGGG - Intergenic
1000839020 5:166193129-166193151 ATGCAGATTAAGAATGGGGAAGG + Intergenic
1001548648 5:172586573-172586595 AGGAAGAGCGAGGCTGGGGAAGG + Intergenic
1001822425 5:174720742-174720764 TTGCAGAGTGAGAATGGGGAAGG - Intergenic
1001969578 5:175943828-175943850 AAGGAGAGCTAGAAAGGGGATGG + Intronic
1002247857 5:177899925-177899947 AAGGAGAGCTAGAAAGGGGATGG - Intergenic
1002791519 6:440966-440988 AGGCAGCTGTAGAATGGGAAGGG - Intergenic
1003683621 6:8279675-8279697 AGGAAGAGATAGAAAGGAGAGGG - Intergenic
1005086062 6:22008088-22008110 TGGGAGAGCTAAATTGGGGAAGG - Intergenic
1005522007 6:26609973-26609995 GGGCAGAGAGAGGATGGGGATGG + Intergenic
1006105738 6:31715289-31715311 AGGCAGAGCCGGGCTGGGGAGGG + Intronic
1006682727 6:35808797-35808819 AGGCAGTGCCAGGAGGGGGAGGG + Intronic
1006796729 6:36736930-36736952 AGGCTTAGCAGGAATGGGGAAGG + Intergenic
1006918656 6:37613360-37613382 AGGCAGAGCAAGGAAGGTGAAGG + Intergenic
1006959039 6:37908177-37908199 AGACAGATCTAAAATGTGGAAGG - Intronic
1006988844 6:38195560-38195582 AGTCAGAGCCAGTATGGGGTTGG - Intronic
1007282455 6:40722571-40722593 AGGCAGTCCCAGAGTGGGGAGGG + Intergenic
1007341219 6:41192578-41192600 AGGCAGAGCCAGAAAGGGGCTGG - Intronic
1008627535 6:53332579-53332601 AGGCGGAGAGAGAATGGAGAGGG + Intronic
1009614232 6:65984600-65984622 AGGAAGCCCTAAAATGGGGATGG - Intergenic
1009782879 6:68293066-68293088 AGGAAGAGGAAGAATGGGGAGGG + Intergenic
1010804079 6:80214165-80214187 TTGTAGAGCTGGAATGGGGAAGG + Intronic
1010897825 6:81387267-81387289 AGGCAGAACTAGAAATGTGAGGG + Intergenic
1011458150 6:87574571-87574593 AGGGAGAGAGAGAATAGGGAGGG + Intronic
1011663369 6:89613070-89613092 AGACAGAGCTAGGATGGAAATGG + Intronic
1012769039 6:103405280-103405302 AAGGAGAGCTGGAAAGGGGATGG + Intergenic
1013557457 6:111270914-111270936 AGGTACAGCTAGTATGGGGATGG + Exonic
1013826063 6:114213095-114213117 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1014117503 6:117682191-117682213 AGACAGAGTAAGACTGGGGATGG - Intronic
1014841034 6:126220357-126220379 AGCCAGAGCTTGAATTTGGAAGG + Intergenic
1015288549 6:131511435-131511457 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1015389505 6:132665244-132665266 AGGAAGAGCAAGAAAGGGAAGGG - Intergenic
1016874039 6:148847296-148847318 AGTCAAAGCTTGACTGGGGAAGG + Intronic
1018278016 6:162153680-162153702 AGGGGGAGCTGGAAAGGGGATGG + Intronic
1018320222 6:162600752-162600774 AGGAAGAGTGAGAAGGGGGAGGG - Intronic
1018767455 6:166945231-166945253 AGGCATAGTTAGCATGAGGATGG - Intronic
1018803094 6:167238380-167238402 AGGCAGAACTGGAAAGGGGGTGG - Intergenic
1019754767 7:2760928-2760950 AGGGGGAGCTGGAGTGGGGAAGG - Intronic
1019816564 7:3205305-3205327 AGGCAGTGATGGAAGGGGGATGG + Intergenic
1019975050 7:4574455-4574477 AGGAAGAGAGAGAAGGGGGAGGG - Intergenic
1020007962 7:4792309-4792331 GGGCGGAGCCAGAGTGGGGAGGG - Intronic
1021202400 7:17741489-17741511 AGGGACAGCAAGAATGGTGATGG - Intergenic
1021560501 7:21964749-21964771 ATGGAGAGCTGGAAGGGGGATGG - Intergenic
1022636599 7:32142178-32142200 AGGCAGAAGGAGAAGGGGGAAGG + Intronic
1023794525 7:43780739-43780761 TGGCAGGGTGAGAATGGGGATGG - Intronic
1023945271 7:44797552-44797574 AGGCAGAGGGACAATCGGGAGGG - Intronic
1024927426 7:54632258-54632280 AGGAAGACCTAAAGTGGGGAGGG - Intergenic
1025114979 7:56249919-56249941 AGCTAGACCTAGAATGGGGTAGG - Intergenic
1025927661 7:65972525-65972547 AGGCAGAGCAATGATGGGGGAGG - Intronic
1026011814 7:66642249-66642271 AGGCAGAGGTAAAATAAGGAAGG - Exonic
1026248407 7:68644917-68644939 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1026907408 7:74070548-74070570 AGGAAGGGCCAGAATGGGAATGG - Intergenic
1027569555 7:79847237-79847259 ATGCAGAGCTGGAAGAGGGATGG - Intergenic
1029315250 7:99706336-99706358 TGGCACACCTAGGATGGGGAAGG - Intronic
1029471613 7:100758352-100758374 AGGCAGGGACAGCATGGGGAGGG - Intronic
1031135544 7:117879998-117880020 GGGAAGAGCTAGGATGGGAATGG - Intergenic
1031258071 7:119482076-119482098 AAGCAGAGCTGGAGAGGGGATGG - Intergenic
1032437476 7:131911963-131911985 AGGAAGAGATGGAATGGGGAAGG + Intergenic
1033881302 7:145887155-145887177 ATGGTGAGCTAGAAAGGGGATGG + Intergenic
1034099055 7:148436105-148436127 AGGAAGAGCCAGCATGGGGAGGG + Intergenic
1035023383 7:155811523-155811545 GGGCAGAGGTAGGATGGGGAAGG + Intronic
1035831776 8:2702650-2702672 AGGCCGAGCCAGCATGGGTAGGG - Intergenic
1036098848 8:5755525-5755547 AGGCAGAGTTAGAAGGAGGCAGG + Intergenic
1036587391 8:10136820-10136842 AGACACACCAAGAATGGGGAAGG - Intronic
1037175889 8:15945438-15945460 ATGGGGAGCTAGAAGGGGGATGG - Intergenic
1038322124 8:26536882-26536904 AGGCAGTGAGAGAATGGTGAGGG + Intronic
1039290443 8:36088867-36088889 ATGGGGAGCTAGAAAGGGGATGG + Intergenic
1041166552 8:55098136-55098158 GGGGAGAGTAAGAATGGGGAAGG + Intergenic
1041496557 8:58492000-58492022 AGGCAGAGCTAGAGAGAGAAGGG + Intronic
1042072074 8:64947283-64947305 AAGCAGTGCTACACTGGGGATGG - Intergenic
1043828959 8:84964737-84964759 AGGCAGAGGTAGGATTGGGCAGG + Intergenic
1044611366 8:94095494-94095516 AGGCAGAGCCAGCATGAGAATGG + Intergenic
1045712782 8:105004922-105004944 AGGTAGAGATAGGATGGGGCTGG + Intronic
1046127586 8:109929341-109929363 AGGCAGAGCAAGTATGGCTATGG - Intergenic
1046216386 8:111152815-111152837 AGGCAGAACTTGAATGTGCATGG - Intergenic
1046582522 8:116110870-116110892 ATGGGGAGCTAGAAAGGGGATGG - Intergenic
1046689178 8:117263496-117263518 AGGCAAAGAGAGAATGAGGAAGG - Intergenic
1048399336 8:134049317-134049339 AAGCTGAGCTAGAATTGGCATGG + Intergenic
1048833554 8:138497744-138497766 AGGGAGAGGAAGATTGGGGAGGG + Intergenic
1048859641 8:138714557-138714579 AGGAAGAGCAAGAGTGGGAAAGG - Intronic
1049134686 8:140885598-140885620 AGGCAGAGTTAGTAAGGGCAGGG + Intronic
1049639456 8:143708158-143708180 AGGAAGGGCTAAATTGGGGAAGG - Intronic
1049850866 8:144829415-144829437 AGGCAGCGCCAGAAGGGGGCTGG + Intronic
1049912733 9:285194-285216 AGGGACAGCAAGAGTGGGGAGGG + Intronic
1050502438 9:6313270-6313292 AGGCAAAGAGAGAATGAGGAAGG + Intergenic
1050710112 9:8451807-8451829 TGGCAGAGCCACAATGGGAAGGG - Intronic
1050829109 9:9989531-9989553 AAGGGGAGCTAGAAGGGGGATGG - Intronic
1052734810 9:32330632-32330654 AGGCCGAGATAGTATGGGGAAGG + Intergenic
1053148697 9:35729442-35729464 AGGCAGAGGAAGACTGGAGAGGG + Intronic
1053361023 9:37486592-37486614 AGGGAGTGTCAGAATGGGGATGG - Intronic
1053419409 9:37967834-37967856 TGTCAGACCTAGAATAGGGAAGG + Intronic
1053819181 9:41948884-41948906 AGGTTGAGCTAGAGTGGTGAGGG - Intronic
1055071856 9:72174804-72174826 AGACAGAGACAGAGTGGGGATGG + Intronic
1055281171 9:74676201-74676223 AGGAGGGGCTAGACTGGGGAAGG - Intronic
1055300047 9:74873275-74873297 AGGCTGAGAGAGCATGGGGAAGG - Intronic
1056085729 9:83147814-83147836 AGGGGGAGCTGGAAAGGGGATGG + Intergenic
1056675692 9:88675181-88675203 AGGCCAAGCTGGAATGGGCATGG - Intergenic
1056687248 9:88776855-88776877 AGGCAGGTCTAAAATGGGGGAGG - Intergenic
1058027565 9:100158916-100158938 AGGGAGAGAGAGAACGGGGAAGG - Intronic
1059374637 9:113872705-113872727 GGGCAGAGCTTCAAGGGGGAGGG - Intergenic
1059952226 9:119477705-119477727 ATGCGGAGCCAGAAGGGGGATGG + Intergenic
1060398281 9:123331761-123331783 CGGCAGAGCTAGAAGGGAGCAGG - Intergenic
1060503960 9:124183992-124184014 AGGCAGGGCAAGACTGGGGCTGG + Intergenic
1061014814 9:127975476-127975498 AGGCTGGGCCAGAACGGGGAGGG - Intronic
1061334624 9:129923969-129923991 AGGCAGAGGCAGGAGGGGGAGGG + Exonic
1061389913 9:130311745-130311767 AGGCAGAGAGAGGGTGGGGAGGG + Intronic
1061617634 9:131790768-131790790 AGACAGAGCTAGAGATGGGAGGG + Intergenic
1061706582 9:132457778-132457800 AGGCAGAGAGAGAAAGGGAAGGG + Intronic
1062185757 9:135217646-135217668 AGACAGAGGTAGAAGGAGGAGGG - Intergenic
1062562907 9:137149724-137149746 AGGAAAAGCAAGAGTGGGGAAGG + Intronic
1185589967 X:1269664-1269686 ACGCAGAGCTGAAAGGGGGAGGG + Intronic
1185874592 X:3692098-3692120 AGGGAGAGCGAGAGTGGGGAGGG + Intronic
1186544149 X:10431636-10431658 AGGCAGAGAGAGAAAGAGGAGGG - Intergenic
1186552682 X:10522873-10522895 AGGAAGAGCTATAATGGGAATGG + Intronic
1187765954 X:22642317-22642339 AGGTAGAGGAACAATGGGGATGG - Intergenic
1188010322 X:25048422-25048444 GGGCAGAGCTGGAATGCGCATGG - Intergenic
1188079722 X:25822241-25822263 AGGCAAAGAGAGAATGAGGAAGG + Intergenic
1189229796 X:39443354-39443376 AGGCAGGGGGACAATGGGGAGGG + Intergenic
1189588611 X:42487985-42488007 AGGCAGAGAGACAAAGGGGAAGG + Intergenic
1190417948 X:50199738-50199760 AGGGAGAGCGGGAGTGGGGAGGG - Intronic
1190502650 X:51095192-51095214 AGGCAGAGAGAGAATGGGGGTGG - Intergenic
1191052963 X:56213969-56213991 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1192178766 X:68902508-68902530 AGACAGTGCTAGAAAGGAGACGG + Intergenic
1193709374 X:84860770-84860792 ATGGAGAGCTGGAAAGGGGATGG - Intergenic
1194610389 X:96035952-96035974 AGGAAGAAATAGAATGGTGAAGG - Intergenic
1196331610 X:114476797-114476819 AGGGAAAAATAGAATGGGGATGG + Intergenic
1196897904 X:120355620-120355642 AGGCACATCTGGAATGGGGCTGG + Intergenic
1196917804 X:120556791-120556813 TTGCAGAGCTAGTATGGTGATGG - Intronic
1197013390 X:121594204-121594226 ATGCAGAGCTGGAAGGGAGATGG + Intergenic
1197414772 X:126161890-126161912 AGGCATAGATAGTATGGGGGAGG - Intergenic
1197462094 X:126755318-126755340 AAGGGGAGCTAGAAAGGGGATGG + Intergenic
1198697653 X:139359736-139359758 ATGAAGAGCTGGAAGGGGGACGG + Intergenic