ID: 1083367643

View in Genome Browser
Species Human (GRCh38)
Location 11:62151170-62151192
Sequence GACATGAGTGAGCTCACGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083367638_1083367643 28 Left 1083367638 11:62151119-62151141 CCGTGAAAGGGGGGTGAAGACAA 0: 1
1: 0
2: 3
3: 42
4: 887
Right 1083367643 11:62151170-62151192 GACATGAGTGAGCTCACGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 76
1083367641_1083367643 2 Left 1083367641 11:62151145-62151167 CCAGCTGAGGAGTTCTGTTGAGA 0: 1
1: 0
2: 0
3: 19
4: 126
Right 1083367643 11:62151170-62151192 GACATGAGTGAGCTCACGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 76
1083367640_1083367643 3 Left 1083367640 11:62151144-62151166 CCCAGCTGAGGAGTTCTGTTGAG 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1083367643 11:62151170-62151192 GACATGAGTGAGCTCACGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083367643 Original CRISPR GACATGAGTGAGCTCACGGC TGG Intronic
900736772 1:4304102-4304124 GGCCTGAGTGAGCTCCAGGCAGG + Intergenic
901399809 1:9008014-9008036 AACATGAGTGAGCTGAGGTCCGG + Intronic
906155057 1:43609192-43609214 GACATGAGAGAACACAGGGCAGG - Intronic
906501042 1:46341986-46342008 TACATGAGTGAGCTGAGGGGAGG - Intronic
910790733 1:91047323-91047345 GACATGAATGAGCTCACTCAGGG + Intergenic
912811989 1:112801872-112801894 GGCAGGAGTGAGCACACAGCCGG - Intergenic
916038873 1:160945340-160945362 GACACCAGTGAGCGCAAGGCTGG + Intronic
917020832 1:170584649-170584671 GACATGAGTCACCTCACAGATGG + Intergenic
918801185 1:188974045-188974067 AACAGAAGGGAGCTCACGGCAGG - Intergenic
921560540 1:216653236-216653258 GGCATGTGTGAGCTCACACCTGG + Intronic
923428694 1:233897987-233898009 GTCATGAGTGATCTCATGTCGGG + Intergenic
1063074193 10:2698582-2698604 GACTTGAGTGAGCTCAGCACTGG + Intergenic
1063369871 10:5514156-5514178 GCAGTGAGTGAGCTCACGGTGGG + Intergenic
1067851937 10:49759977-49759999 GACATGGTTGAGCTGATGGCAGG - Intronic
1083367643 11:62151170-62151192 GACATGAGTGAGCTCACGGCTGG + Intronic
1084366943 11:68707941-68707963 GACCAGAGTGAGCTCTCCGCAGG + Exonic
1091352228 11:134906756-134906778 CACGTGAGTGTGCTCACGGCCGG + Intergenic
1091586003 12:1817334-1817356 GACATGAAAGAGCTCAAGACTGG - Intronic
1098154260 12:67580970-67580992 GACATGAGTGTGTGCATGGCAGG + Intergenic
1098195687 12:67999384-67999406 GAAATGACTGAGCTCATGGCTGG + Intergenic
1101728629 12:107408445-107408467 GACAAGAGTGGGCTCACCTCTGG + Intronic
1104013699 12:124949082-124949104 GACATGAGTGAGGCCTCGGTGGG - Intronic
1104465064 12:128983619-128983641 GCTGTGAGTGAGCTCACGCCCGG + Exonic
1104523310 12:129495582-129495604 GGCATGAGTGAGCTGACAGAAGG + Intronic
1104668731 12:130666539-130666561 CACAGGATTGAGCTCACAGCAGG - Intronic
1107315921 13:39131772-39131794 GGCATGAGTGACCCCACGGGTGG - Intergenic
1107894593 13:44948552-44948574 GACATGAATTTTCTCACGGCTGG + Intronic
1110783607 13:79496628-79496650 GACATGAGAGAGATTAGGGCAGG - Intronic
1121452116 14:94015569-94015591 TTCATGGGTGAGCTCACGGGTGG - Intergenic
1121932593 14:97986294-97986316 GAGATGAGTGAGCTCTAGTCAGG - Intergenic
1122663189 14:103311515-103311537 GACACGCGTGAGCTCACGGCCGG + Intergenic
1122972474 14:105158033-105158055 GACTTGAGCCAGCTCAGGGCAGG - Intronic
1125530647 15:40411290-40411312 GCCATGAGTGAGCCCAATGCAGG + Exonic
1126336139 15:47588185-47588207 GACATGACTGGGGTCATGGCTGG - Intronic
1127013756 15:54659701-54659723 GACATGAGTGAGTTCACTGCTGG - Intergenic
1127798418 15:62457434-62457456 GACATGATTGAGTTCATAGCAGG + Intronic
1128356466 15:66930960-66930982 GGCTTGAGTGAGCTCACACCTGG - Intergenic
1134599395 16:15521568-15521590 GCCATAAGTGAGCTCCCAGCAGG + Intronic
1142711842 17:1727735-1727757 GACATGAGTGAGAGCACGAAGGG - Exonic
1144787970 17:17842321-17842343 GATAGGAGTCAGGTCACGGCAGG - Intergenic
1146053481 17:29569338-29569360 CACACGAGTGAGCCCAGGGCAGG + Exonic
1148442159 17:47717000-47717022 GACATGTGTGTTCTCACGCCTGG - Intergenic
1148991290 17:51669063-51669085 GCCATGCGGGAGCCCACGGCGGG - Intronic
1152096216 17:78273184-78273206 GACAGGTGTGAGCTCTCGGCAGG - Intergenic
1155491810 18:26407352-26407374 GACACGAGTGAGCTCACAGAGGG - Intergenic
1156527196 18:37778278-37778300 GCCCTGAGGGAGCTCACTGCAGG - Intergenic
1160101484 18:75923548-75923570 GACATGAGAGAGGTCAAGGAGGG + Intergenic
1160750644 19:732726-732748 GACCTCACTGAGCTCACGTCAGG + Intronic
1161068275 19:2248653-2248675 GACATCAGTGCACTCAGGGCTGG - Exonic
1167086782 19:47315406-47315428 GGACTGAGTGAGCTCATGGCAGG + Intronic
1168393217 19:56027644-56027666 CAGATGAGAGAGCCCACGGCGGG - Exonic
927783914 2:25959313-25959335 GCCATGAGGGAGCTCACAGGGGG - Intronic
928328497 2:30338820-30338842 GACAGGAGTGAGGTCATGGAAGG + Intergenic
934793645 2:97083102-97083124 GCCATGAGTGCGCTCACCACAGG - Intergenic
936060901 2:109295191-109295213 GTGATGAGCGAGCTCATGGCAGG + Intronic
938981445 2:136530949-136530971 GAGATGAATGACCTCAGGGCAGG + Intergenic
946061815 2:216949116-216949138 TACAGGGGTGAGCTCACGGCTGG + Intergenic
946362850 2:219229444-219229466 GCCCTAAGTGAGCTCGCGGCGGG - Intronic
947461899 2:230310709-230310731 GACATGGGTGAGCAGAGGGCAGG - Intronic
947470983 2:230400921-230400943 GACATGGGTGAGCAGAGGGCAGG - Intronic
1170733702 20:18995292-18995314 TACAAGAGTGTGCTCACGGAGGG + Intergenic
1172661923 20:36574050-36574072 GACCTGAGTGAGCGCGCGGGGGG + Intronic
1179992756 21:44957188-44957210 GTGATGAGTCAGCTCAGGGCAGG + Intronic
1182116833 22:27761584-27761606 GACAGGAGGCAGCACACGGCAGG + Intronic
1184026030 22:41857223-41857245 GACTTGAGTGAACTTAAGGCAGG + Intronic
956384047 3:68698085-68698107 CACAAGAGTGAACTCAAGGCAGG + Intergenic
960637338 3:119796477-119796499 GGCTTGAGTGAGCTCAGGGCTGG - Intronic
961043842 3:123695286-123695308 GACATGGGTGAGCTCAGAGTTGG - Intronic
969999473 4:11350097-11350119 GACATAATTCAGCTCACAGCAGG + Intergenic
970406990 4:15773459-15773481 AAGATGAGAGAGCTCATGGCTGG - Intergenic
984950538 4:185004559-185004581 GGGATGAGTGTGGTCACGGCGGG - Intergenic
987206729 5:15635169-15635191 GGCATGACTGAGGTCACTGCTGG + Intronic
990404823 5:55478675-55478697 GACATGAGTGGGGTAAGGGCAGG + Intronic
990931829 5:61100418-61100440 AACAAGAGTGAGCTCAGGGATGG - Intronic
995759972 5:115552446-115552468 GTCATGACTGAGTTCAGGGCTGG - Intergenic
1001539924 5:172530624-172530646 GACAACAGTGAGCCCTCGGCGGG + Intergenic
1002948666 6:1786896-1786918 GAAGTGAGTGAGCTGACTGCAGG + Intronic
1006773837 6:36576692-36576714 GAGATGAGGGAGTTCACGGCAGG - Intergenic
1007775282 6:44221587-44221609 GACCTGAGGGAGCTCAGGGAGGG + Intronic
1008537454 6:52517737-52517759 CACATGAGTCATCTCACTGCTGG + Intronic
1019191193 6:170251909-170251931 GACACGCGTGAGCTCATGGAGGG - Intergenic
1019325391 7:435944-435966 GACATGAGTGAGCAAGCGTCTGG + Intergenic
1019504825 7:1385591-1385613 GGCCTGAGTGGGCTCACAGCGGG - Intergenic
1021619922 7:22541361-22541383 CACATGCGTGAGCTCACTGAGGG - Intronic
1034179516 7:149126525-149126547 GAGATGAGGGAGCTGACGGGAGG + Intronic
1059381582 9:113931269-113931291 GACACGAGTGTGCTCAGGGCAGG - Intronic
1197952275 X:131910365-131910387 GACATGAGTGAGCTAAAGAAAGG - Intergenic