ID: 1083367643

View in Genome Browser
Species Human (GRCh38)
Location 11:62151170-62151192
Sequence GACATGAGTGAGCTCACGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 87
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 76}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083367641_1083367643 2 Left 1083367641 11:62151145-62151167 CCAGCTGAGGAGTTCTGTTGAGA 0: 1
1: 0
2: 0
3: 19
4: 126
Right 1083367643 11:62151170-62151192 GACATGAGTGAGCTCACGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 76
1083367640_1083367643 3 Left 1083367640 11:62151144-62151166 CCCAGCTGAGGAGTTCTGTTGAG 0: 1
1: 0
2: 1
3: 16
4: 186
Right 1083367643 11:62151170-62151192 GACATGAGTGAGCTCACGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 76
1083367638_1083367643 28 Left 1083367638 11:62151119-62151141 CCGTGAAAGGGGGGTGAAGACAA 0: 1
1: 0
2: 3
3: 42
4: 887
Right 1083367643 11:62151170-62151192 GACATGAGTGAGCTCACGGCTGG 0: 1
1: 0
2: 2
3: 8
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083367643 Original CRISPR GACATGAGTGAGCTCACGGC TGG Intronic