ID: 1083369379

View in Genome Browser
Species Human (GRCh38)
Location 11:62166246-62166268
Sequence CTGTGTCAGGGCCAAGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083369372_1083369379 -9 Left 1083369372 11:62166232-62166254 CCTTTTGCCACTCCCTGTGTCAG No data
Right 1083369379 11:62166246-62166268 CTGTGTCAGGGCCAAGGAGATGG No data
1083369370_1083369379 13 Left 1083369370 11:62166210-62166232 CCCTGATGTGGACTCTACAGCTC No data
Right 1083369379 11:62166246-62166268 CTGTGTCAGGGCCAAGGAGATGG No data
1083369371_1083369379 12 Left 1083369371 11:62166211-62166233 CCTGATGTGGACTCTACAGCTCC No data
Right 1083369379 11:62166246-62166268 CTGTGTCAGGGCCAAGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083369379 Original CRISPR CTGTGTCAGGGCCAAGGAGA TGG Intergenic
No off target data available for this crispr