ID: 1083372119

View in Genome Browser
Species Human (GRCh38)
Location 11:62190403-62190425
Sequence TCACCTATTAAGGTTAAGGT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 81}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083372110_1083372119 19 Left 1083372110 11:62190361-62190383 CCAGCACCAGCCCTTGGGACACA 0: 1
1: 0
2: 3
3: 31
4: 280
Right 1083372119 11:62190403-62190425 TCACCTATTAAGGTTAAGGTTGG 0: 1
1: 0
2: 0
3: 6
4: 81
1083372115_1083372119 -4 Left 1083372115 11:62190384-62190406 CCCTTCTCTGAGCACGAGGTCAC 0: 1
1: 0
2: 2
3: 6
4: 121
Right 1083372119 11:62190403-62190425 TCACCTATTAAGGTTAAGGTTGG 0: 1
1: 0
2: 0
3: 6
4: 81
1083372113_1083372119 8 Left 1083372113 11:62190372-62190394 CCTTGGGACACACCCTTCTCTGA 0: 1
1: 0
2: 2
3: 12
4: 257
Right 1083372119 11:62190403-62190425 TCACCTATTAAGGTTAAGGTTGG 0: 1
1: 0
2: 0
3: 6
4: 81
1083372112_1083372119 9 Left 1083372112 11:62190371-62190393 CCCTTGGGACACACCCTTCTCTG 0: 1
1: 0
2: 4
3: 24
4: 216
Right 1083372119 11:62190403-62190425 TCACCTATTAAGGTTAAGGTTGG 0: 1
1: 0
2: 0
3: 6
4: 81
1083372116_1083372119 -5 Left 1083372116 11:62190385-62190407 CCTTCTCTGAGCACGAGGTCACC 0: 1
1: 0
2: 0
3: 13
4: 129
Right 1083372119 11:62190403-62190425 TCACCTATTAAGGTTAAGGTTGG 0: 1
1: 0
2: 0
3: 6
4: 81
1083372111_1083372119 13 Left 1083372111 11:62190367-62190389 CCAGCCCTTGGGACACACCCTTC 0: 1
1: 0
2: 3
3: 44
4: 462
Right 1083372119 11:62190403-62190425 TCACCTATTAAGGTTAAGGTTGG 0: 1
1: 0
2: 0
3: 6
4: 81

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083372119 Original CRISPR TCACCTATTAAGGTTAAGGT TGG Intronic
900816205 1:4848276-4848298 TCTCCTATTAATCTTAAGTTTGG + Intergenic
901430727 1:9212876-9212898 GCAACTGTTAAGGTTAAGGATGG - Intergenic
922351190 1:224735763-224735785 CCAGCTACTCAGGTTAAGGTGGG - Intronic
923401117 1:233615668-233615690 TCACCTGTAAAGGTTGAGGGTGG - Intronic
1065272489 10:24049169-24049191 TCACCTCTTAAAGTTAATCTGGG + Intronic
1073795943 10:106988573-106988595 TCACCTTTTAAGGCTAATGTGGG + Intronic
1074096387 10:110317136-110317158 TTATCTAGTAAGGGTAAGGTGGG + Intergenic
1083372119 11:62190403-62190425 TCACCTATTAAGGTTAAGGTTGG + Intronic
1085744147 11:79100454-79100476 TCACCATTAAAGGTTGAGGTGGG - Intronic
1085952839 11:81353703-81353725 TTACTTATAAATGTTAAGGTTGG + Intergenic
1090303796 11:125672762-125672784 TCACAGATAAAGGCTAAGGTTGG - Intronic
1090314168 11:125770220-125770242 TCATCTCTTTAGGTTAAGGGTGG + Intergenic
1092579622 12:9824503-9824525 TCACCTGTTCAGGATAATGTTGG - Intergenic
1093087384 12:14881817-14881839 TCTCCTATTTTGGGTAAGGTGGG + Intronic
1094162542 12:27406486-27406508 TCACTTATGAAGCTTAAGTTTGG - Intronic
1101734724 12:107454423-107454445 TGACCTATTAAGGGTTAGGGGGG + Intronic
1109630201 13:65034974-65034996 TCACTTTTAAAGGTTAATGTTGG + Intergenic
1111910053 13:94301153-94301175 CCACCTATTAAAGTTAAATTAGG - Intronic
1112816051 13:103274833-103274855 TCACCTGTTCTGGTTAGGGTGGG + Intergenic
1116682289 14:47987743-47987765 TCACCTATTAAGATTTAGTTTGG - Intergenic
1119360808 14:74047799-74047821 CCACCTATTTAGCTTATGGTGGG - Intronic
1120353549 14:83396435-83396457 TTACATATAAAGGTTAAAGTAGG - Intergenic
1124793530 15:32753015-32753037 TCTCCTATTAAGGTAAAGACTGG - Intergenic
1131489082 15:92846548-92846570 TTAACTATTAAGGTTATGGGTGG + Intergenic
1136645377 16:31609188-31609210 TGATCAGTTAAGGTTAAGGTGGG - Intergenic
1139615236 16:68084877-68084899 TCAGCCATTAAAGTTGAGGTGGG + Intronic
1144750298 17:17643951-17643973 TCACCAAATAAGGTTACAGTTGG - Intergenic
1145944753 17:28765041-28765063 TCACTTATTAAGATAAAGGATGG + Intronic
1146606187 17:34259797-34259819 TCACCTTTTAAGATGAAGGCAGG - Intergenic
1149014583 17:51893025-51893047 TCACTTATTAAGCATAAAGTAGG - Intronic
1152174403 17:78778004-78778026 TCAAATATTAAGGTTTAGGCTGG + Intronic
1158917649 18:62151521-62151543 TCACCTCCCAAGGTTAAGGAGGG + Intronic
1161189773 19:2947096-2947118 TCACCTATTAAGATGAAGAGAGG - Intergenic
926016504 2:9457605-9457627 GCACCTATTAAGTTTAAAGAAGG + Intronic
929809024 2:45172612-45172634 TCACCTATTACGATTATGGATGG - Intergenic
930051191 2:47217445-47217467 TCGCCTATTAAGGTTAATAGGGG + Intergenic
930080714 2:47446149-47446171 ACACCTACTAAGGCTAAGGCAGG - Intronic
940481465 2:154237271-154237293 TTACATAATAAGATTAAGGTAGG - Intronic
941510978 2:166409020-166409042 TGTGCTATTAAGGTTATGGTAGG - Intronic
944353377 2:198756704-198756726 TCATCTGTTGAGGTTAAGGAGGG - Intergenic
944872967 2:203932863-203932885 TCACCTCCTAAGGGTAAGGAGGG + Intergenic
1169725778 20:8728321-8728343 TCACCAAGTTAGGTGAAGGTTGG - Intronic
1174859705 20:54079292-54079314 TCACCTACTAAGGTTCTTGTGGG + Intergenic
1177773905 21:25546834-25546856 TCAACTATGAAGGCTAATGTGGG + Intergenic
1182643370 22:31787195-31787217 TCAGCTACTAAGGCTAAGGCAGG - Intronic
967655211 3:192040101-192040123 TCACTTATTAAGGCTAAGTTAGG + Intergenic
967974169 3:195022464-195022486 TCACCTTTTTAGATAAAGGTAGG + Intergenic
972086175 4:35219535-35219557 TCACTTTTTATGGTTAAGGAAGG - Intergenic
974216977 4:58860807-58860829 TCAGGTTGTAAGGTTAAGGTAGG - Intergenic
974751469 4:66146619-66146641 TCACCTATCAGGGCTAAGTTTGG + Intergenic
975195667 4:71520561-71520583 TCACCTATAAAGGGAAAGTTTGG + Intronic
977276023 4:94978264-94978286 TCACCTTTTAAGGTTTCTGTGGG + Intronic
977516297 4:98024404-98024426 TGACCTATTAATGTTATGGAAGG - Intronic
984737298 4:183121739-183121761 TCACCTATTATGAGTGAGGTTGG + Intronic
991041799 5:62183749-62183771 TAACATGTTATGGTTAAGGTAGG + Intergenic
996165182 5:120214305-120214327 TCAACCATTAAGGGCAAGGTGGG - Intergenic
998589074 5:143458358-143458380 TCTCTTATAAAGGGTAAGGTTGG - Intergenic
999220964 5:149977191-149977213 GCAGGCATTAAGGTTAAGGTAGG + Intronic
1006488397 6:34364603-34364625 TCACTTATCAAGGTAAAGGTTGG - Intronic
1007253691 6:40513830-40513852 TCACTTTTTAAGGTTCAGGCTGG - Intronic
1008728667 6:54453095-54453117 TCACCTGCTGAGGTTAAGGGAGG + Intergenic
1009993100 6:70868194-70868216 TCACCAATTAAGTATAATGTTGG - Intronic
1013445837 6:110225647-110225669 TCACCTCCTCAAGTTAAGGTAGG + Intronic
1013740782 6:113281605-113281627 CCATCTACTAAGGTTATGGTAGG - Intergenic
1016720335 6:147288926-147288948 TCACCTACCAAGGGTAAGGAGGG - Intronic
1019462039 7:1165047-1165069 TCACCGATGGAGGTTAAGGTGGG - Intergenic
1021151551 7:17157424-17157446 TCACCTAATATTGGTAAGGTGGG - Intergenic
1024143582 7:46487271-46487293 TCACCTATTCAGGTTATCTTTGG + Intergenic
1030257711 7:107529568-107529590 TCACCTCTTAAGGGTAAGGAGGG + Intronic
1031333412 7:120495772-120495794 TTGCCTACTAAGCTTAAGGTAGG - Intronic
1033571284 7:142631287-142631309 TCTCCTATTAAGCTTTATGTTGG - Intergenic
1036405960 8:8455543-8455565 TCATCTTTCAAGGTTAACGTAGG - Intergenic
1038953805 8:32445723-32445745 TCATCTATTAAGATTAAGTAAGG + Intronic
1041380895 8:57253641-57253663 CCACCTATTAAGGTTATAATAGG - Intergenic
1045609171 8:103814973-103814995 TCACATATTAAGTATAATGTTGG - Intronic
1050447279 9:5738910-5738932 TCAACTATCAAAGGTAAGGTGGG - Intronic
1051777370 9:20650677-20650699 TCAGCTACTCAGGTTGAGGTGGG - Intergenic
1051798966 9:20909539-20909561 TCTGCTATTAAGGTGATGGTTGG + Intronic
1052629407 9:31018595-31018617 TCATCTAATAGGGTTAAGGCAGG + Intergenic
1053087009 9:35233726-35233748 TCATTTCTTAAGGGTAAGGTGGG + Intronic
1055574788 9:77649843-77649865 TGACCTATTAGGTTTAAAGTTGG + Intergenic
1185764692 X:2715947-2715969 TCACCTATTGAGGTTTGGGGTGG + Intronic
1187979770 X:24743794-24743816 TCTCCTATTAAAGTTAAATTTGG - Intronic
1192566518 X:72168599-72168621 TCACCTATTAAGGGACAGTTTGG - Intergenic
1195860037 X:109373780-109373802 TCACCTACTGAGGTTAATTTTGG - Intronic
1197451433 X:126623543-126623565 TCACAAATTAAGGTTAACATCGG - Intergenic
1199369172 X:147025253-147025275 TCACCTATTAAGGGAAATCTGGG + Intergenic
1200839704 Y:7768467-7768489 TTAGCTATGAGGGTTAAGGTAGG - Intergenic