ID: 1083374510

View in Genome Browser
Species Human (GRCh38)
Location 11:62208737-62208759
Sequence GCTGCTGATGGTCCTCATGC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 227
Summary {0: 1, 1: 1, 2: 1, 3: 16, 4: 208}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083374506_1083374510 -8 Left 1083374506 11:62208722-62208744 CCGCCTCGCCATGAAGCTGCTGA 0: 1
1: 0
2: 2
3: 14
4: 137
Right 1083374510 11:62208737-62208759 GCTGCTGATGGTCCTCATGCTGG 0: 1
1: 1
2: 1
3: 16
4: 208
1083374503_1083374510 24 Left 1083374503 11:62208690-62208712 CCCTGCCACGCACGACTGAACAC 0: 1
1: 0
2: 1
3: 4
4: 34
Right 1083374510 11:62208737-62208759 GCTGCTGATGGTCCTCATGCTGG 0: 1
1: 1
2: 1
3: 16
4: 208
1083374505_1083374510 19 Left 1083374505 11:62208695-62208717 CCACGCACGACTGAACACAGACA 0: 1
1: 0
2: 0
3: 6
4: 85
Right 1083374510 11:62208737-62208759 GCTGCTGATGGTCCTCATGCTGG 0: 1
1: 1
2: 1
3: 16
4: 208
1083374504_1083374510 23 Left 1083374504 11:62208691-62208713 CCTGCCACGCACGACTGAACACA 0: 1
1: 0
2: 0
3: 3
4: 52
Right 1083374510 11:62208737-62208759 GCTGCTGATGGTCCTCATGCTGG 0: 1
1: 1
2: 1
3: 16
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083374510 Original CRISPR GCTGCTGATGGTCCTCATGC TGG Exonic
900118034 1:1036825-1036847 GCCTCTGAGGGGCCTCATGCCGG + Intronic
900205834 1:1431519-1431541 GCTGCTCCTGGCCCTCAGGCTGG - Intergenic
900462731 1:2809265-2809287 GCTGCTGCTGGTTCTAGTGCAGG - Intergenic
900704478 1:4071777-4071799 TCAGCTGATTGTCCTCATGGCGG - Intergenic
904330472 1:29755121-29755143 GCTGCTGTTGGCCCTCAAGCAGG + Intergenic
904659188 1:32072346-32072368 GCTGCTGATGGTCACCGTGTAGG - Intronic
905954280 1:41979069-41979091 GCTGCTGATGTTGCTGGTGCAGG - Intronic
906533991 1:46541315-46541337 GATGCTGAAGTTCCTCAGGCTGG - Intergenic
906791240 1:48660277-48660299 GCTGCTGATGCACCTGCTGCTGG - Intronic
907837232 1:58121585-58121607 GGTGCAGATGATCCTCATGCTGG - Intronic
910788697 1:91028400-91028422 GCTACTGATGAGCCTCCTGCTGG + Intergenic
913327739 1:117641720-117641742 GCTGCTGTTGCTCCACTTGCAGG + Intergenic
915472597 1:156134915-156134937 GCTCCACCTGGTCCTCATGCTGG - Exonic
916099202 1:161379278-161379300 GCTGCTGAAGGTTCTCAGTCTGG - Intergenic
918082450 1:181218030-181218052 TCTGCTGCTGCTCCTCATACAGG - Intergenic
919810063 1:201403429-201403451 GTTGCTGATGCTCCACATCCTGG - Intergenic
920031347 1:203039089-203039111 GCAGCTGATGGTGAACATGCTGG + Intronic
920079234 1:203360327-203360349 GCTCCTGGTGGCCCTCAGGCAGG - Intergenic
920376957 1:205513924-205513946 GCTGCTGTTGGGCCACATGCTGG + Intronic
921379900 1:214513927-214513949 GCTGCTGCTGGTTCTAATGATGG - Intronic
1062927786 10:1329845-1329867 TTTGCTGATGCTCCTCATGAAGG + Intronic
1063477704 10:6343308-6343330 GAGGCTGATGGTCCTGACGCTGG + Intergenic
1064552946 10:16521035-16521057 GCTGCTGGTGATCCTCATCCCGG - Exonic
1065140403 10:22714197-22714219 GCTGCTCAGCGTCCTCATGTGGG - Exonic
1066200749 10:33140986-33141008 ACTGCAGATGGTCCTGATGTGGG - Intergenic
1071309196 10:84327664-84327686 GCTGCTGAGAGTCCTCAGCCTGG - Intergenic
1072675147 10:97460189-97460211 GCTGCTGCTGGACCTAATTCTGG + Exonic
1073059707 10:100726140-100726162 GATCCTGATGGGCCACATGCAGG - Intergenic
1074014694 10:109522243-109522265 TCTGGTGAGGGTCCCCATGCTGG + Intergenic
1074769413 10:116723711-116723733 GGTCCTCATGGTCCTCAGGCTGG - Intronic
1075194764 10:120346689-120346711 GCTGCTGTTTGTCCTGAGGCAGG + Intergenic
1075928207 10:126270689-126270711 GCTCCAGGTGGTCCTGATGCTGG + Intronic
1077111596 11:864448-864470 GCTGCTGCTGGTGTTCCTGCTGG + Exonic
1077417125 11:2429523-2429545 GGTGCTGATGGTCATGATGGTGG + Intergenic
1082270803 11:50167349-50167371 GCTTGTGATGGTGCACATGCTGG + Intergenic
1083374510 11:62208737-62208759 GCTGCTGATGGTCCTCATGCTGG + Exonic
1083381229 11:62270222-62270244 GTTGCTGATGGTCCTCATGCTGG + Exonic
1084178700 11:67436215-67436237 GCTGCTGCTGCTCCTACTGCTGG - Exonic
1084362410 11:68677550-68677572 GCTGCTGATGGGCCTGACTCAGG + Intergenic
1084556986 11:69881276-69881298 GCTCCTGATGGTACTCAGGCAGG - Intergenic
1084718558 11:70889566-70889588 CCCGCTGGTGGTTCTCATGCCGG - Intronic
1084840752 11:71844209-71844231 TGTGCTGATGGGCCTCCTGCTGG - Intergenic
1085471439 11:76760952-76760974 GGTGCTGATGGGCATGATGCTGG + Intergenic
1085596838 11:77819442-77819464 GCTGCTGCTGGTTCTTTTGCTGG - Intronic
1087272864 11:96129411-96129433 GATGCTGATGCTGCTCATCCAGG + Intronic
1088252709 11:107875025-107875047 GCTGCTGATGTTTCTGATTCAGG - Intronic
1088807195 11:113363408-113363430 GTTCCTGAAGTTCCTCATGCAGG + Intronic
1089561615 11:119346049-119346071 GCTGCTGGTGGCCATCATCCTGG - Exonic
1089822701 11:121242131-121242153 GCAGCTGCTAGTCATCATGCTGG - Intergenic
1090419814 11:126566945-126566967 GCTGGTGATAGTGCCCATGCTGG + Intronic
1092570377 12:9715059-9715081 GCTGCAGCTCCTCCTCATGCAGG + Intergenic
1093170855 12:15858840-15858862 GCTGGTGGTGGTCCTGAGGCTGG - Intronic
1102260122 12:111438329-111438351 GCTCCTGATGGTGCCCTTGCGGG + Intronic
1104422843 12:128651360-128651382 GGTCCTGATGGTGCTCCTGCAGG + Intronic
1105286947 13:19012230-19012252 GGTTCTGATGGACCTCATCCGGG - Intergenic
1105583868 13:21725954-21725976 GGTGCTGATGGTGCTGATGGTGG - Intergenic
1106782835 13:33076870-33076892 GCTGCTGCTGTTACACATGCTGG - Intergenic
1110169960 13:72488583-72488605 GCTGCTGCTTCTCCTCATGTTGG - Intergenic
1110225075 13:73111062-73111084 GCAGCTGATGCTCTTGATGCGGG + Intergenic
1111888674 13:94054485-94054507 GCTGCTGATGCTGCTGATACTGG + Intronic
1112071825 13:95861306-95861328 GCTGCTGATGGGGCTCATCCAGG + Intronic
1114454417 14:22845928-22845950 GCTGCTGCTGCTCCTGGTGCTGG + Exonic
1116657879 14:47674541-47674563 GCTGCTGACAGTCCTCCTGGAGG - Exonic
1119886444 14:78147360-78147382 GCTGATGATGGTCTCCTTGCTGG + Intergenic
1121600989 14:95202876-95202898 TTTGCTGGTGGTCCTCATGGGGG + Exonic
1122261645 14:100526798-100526820 GATGCTGATGGTGCTGGTGCTGG - Intronic
1122703441 14:103605581-103605603 GCTGCTGGTGCTCCTCAATCTGG - Intronic
1122852844 14:104546241-104546263 GCAGCTCAGTGTCCTCATGCGGG - Intronic
1124181118 15:27475512-27475534 GATGATGATGGTCATCATGATGG + Intronic
1124358176 15:29014153-29014175 CCTGCTTATTGTGCTCATGCAGG + Intronic
1124362303 15:29046607-29046629 GCTGCAGGTGGTTCTCATGTTGG - Intronic
1124512809 15:30340974-30340996 GCTGATCGTGGTGCTCATGCTGG - Intergenic
1124730106 15:32189776-32189798 GCTGATCGTGGTGCTCATGCTGG + Intergenic
1126344646 15:47680032-47680054 GCTTCTTGGGGTCCTCATGCAGG - Intronic
1129164264 15:73767415-73767437 CCAGCTGTTGGCCCTCATGCTGG + Intergenic
1135278797 16:21136366-21136388 CCTGATGGTGGTCCTCGTGCAGG - Exonic
1136512790 16:30749105-30749127 GCTGCTGGTGGTGCTGGTGCTGG + Intronic
1137726282 16:50658892-50658914 GCTCCTGTTGCTCCACATGCTGG - Intergenic
1141642838 16:85351287-85351309 GCTGCTGTGGGTCCTCAAACTGG + Intergenic
1144640770 17:16935396-16935418 GCTGCTGGGTGACCTCATGCAGG - Intronic
1146837577 17:36124953-36124975 GCTCCAGAGGGTCCTCCTGCAGG + Intergenic
1147132095 17:38415568-38415590 GAGGCTGAGGGTCCTCATGAAGG + Intergenic
1147145837 17:38484026-38484048 GCTTCTGATGGTTCTTAAGCTGG + Intronic
1147969325 17:44211128-44211150 GCTGCTGCTCCTCCTCAGGCAGG + Exonic
1149155856 17:53629492-53629514 GCTGCAGATGGTTCCCATGGAGG - Intergenic
1151957177 17:77386241-77386263 CCTGCAGAGGGGCCTCATGCTGG + Intronic
1152555210 17:81049691-81049713 GCTGCTGTTGGTTTTCATTCCGG + Intronic
1153839073 18:8990107-8990129 CCTGCTGAGGAACCTCATGCAGG - Intergenic
1154039818 18:10843864-10843886 GCTACAGATGTCCCTCATGCAGG + Intronic
1159743285 18:72200048-72200070 GCTGCTGTTTGTACTCATGGTGG - Intergenic
1160542680 18:79633766-79633788 GCTGATGATGGTGCTGATGATGG + Intergenic
1160689733 19:456037-456059 GGGGCTGAGGGTCCTCCTGCGGG - Intronic
1160694215 19:474730-474752 GCAGCTGAGGGTCCCCATGGTGG + Exonic
1161062092 19:2220261-2220283 GCTGCTGCTGCTCTTCAGGCAGG + Intronic
1162481107 19:10927692-10927714 GCTGCTGCTGCTGCTCCTGCAGG + Exonic
1164721489 19:30435056-30435078 GCTGATGATGGTGATAATGCTGG + Intronic
1164721519 19:30435399-30435421 GCTGTTGATGGTGATGATGCTGG + Intronic
1165087477 19:33361150-33361172 GCTGCTGAGGGTCTTCTGGCAGG + Intergenic
1166067202 19:40366784-40366806 GGTCCTGCTGGTCCTCATTCTGG + Exonic
1168580823 19:57554366-57554388 GCTTCTGATTGTCCTCAGGCTGG - Intronic
926310262 2:11669865-11669887 GCTGCTGCTGGTCGGCGTGCCGG - Exonic
927878920 2:26676722-26676744 GCTGCTGAGGGTCTTCTTGCTGG - Intergenic
928328326 2:30337521-30337543 GCTGCTGAGGGACCTCCTCCCGG + Intergenic
928491906 2:31793073-31793095 GCTCCTAAAGGTCCACATGCAGG - Intergenic
929846288 2:45532162-45532184 GGTGCTGATGGTGCTGATGGTGG - Intronic
932744746 2:74324522-74324544 GCTGCTGATGATGCTGATCCAGG + Intronic
937079941 2:119133649-119133671 GCTGCTGATGGTCATGCTGGTGG - Intergenic
939501112 2:142986017-142986039 GCTGAAGATGGTACTCACGCAGG - Exonic
942780594 2:179637293-179637315 GCTGCTGCTGGTCCTAGGGCAGG - Intronic
944539225 2:200740675-200740697 CCTGCTGATGGTCCTCTTAGTGG - Intergenic
946109390 2:217401091-217401113 GCTGCTGCTGCTCTTCCTGCAGG - Intronic
948816631 2:240513613-240513635 CCTGTGGCTGGTCCTCATGCTGG - Intronic
1170548290 20:17453827-17453849 GATGGAGATGGTCCACATGCTGG - Exonic
1170664886 20:18378283-18378305 GCTGCTTCTGGTCCTGCTGCTGG - Intergenic
1172940655 20:38651724-38651746 GCTGCTGATGGTGATGATGGTGG + Intergenic
1172940832 20:38653310-38653332 GCTGCTGATGATAATCATGGTGG + Intergenic
1179297338 21:40075082-40075104 GCTGCTGTTTGTGCTCCTGCTGG - Exonic
1180222286 21:46366641-46366663 GCTGCTCCTGGGCCTCCTGCAGG - Exonic
1180801772 22:18635188-18635210 GCTGGTGATGGCCCTCAGGACGG + Intergenic
1180853014 22:19030729-19030751 GCTGGTGATGGTCCTCAGGATGG + Intergenic
1180961239 22:19763301-19763323 GCTGCTCATGGACTTCGTGCCGG + Exonic
1181118966 22:20652738-20652760 GCTGCTGATGGCACTGGTGCTGG + Intergenic
1181219950 22:21360073-21360095 GCTGGTGATGGCCCTCAGGACGG - Intergenic
1181750796 22:24987943-24987965 GCTGCAGATGGACCCCCTGCAGG - Intronic
1182418174 22:30234858-30234880 GCTGCCCAGGGCCCTCATGCAGG - Intergenic
1184691231 22:46118232-46118254 GTCCCTGAAGGTCCTCATGCAGG + Intergenic
1185041779 22:48507891-48507913 GCTGCAGATGGGCCTCGTGCTGG - Intronic
1185188416 22:49417394-49417416 GCTTCTGATGCACCTCATTCTGG + Intronic
950161945 3:10766846-10766868 TGTGCTGATGGTCCCCATGTTGG + Intergenic
950304602 3:11908235-11908257 GCTGCTGCTGGTGCTCAGGGTGG - Intergenic
950405513 3:12801870-12801892 GCTGCTGGTGATTCTGATGCTGG + Intronic
952353096 3:32559704-32559726 TCTCCTGATGTTCCTGATGCTGG - Intronic
953457336 3:43053622-43053644 GCTGCGGCTGGTCCACATCCTGG + Exonic
954131433 3:48563082-48563104 GTTGCTGATGGTCCTGATGTTGG - Exonic
960874673 3:122284771-122284793 GCTGCTGCTGCTGCTCTTGCTGG - Exonic
961345192 3:126259651-126259673 GCTGCTGATGGCCCCAATCCCGG + Intergenic
961371724 3:126435592-126435614 GCTGCAGATGCTCCTCCTGTAGG - Exonic
961534869 3:127564149-127564171 GGTGCTGATGATGGTCATGCTGG - Intergenic
961556473 3:127699773-127699795 TCTGCTTATGGTCCTCATCAGGG - Intronic
962390249 3:134965761-134965783 GCTGCAGAAGGTCCTCAAGGTGG - Intronic
962775245 3:138652933-138652955 GATGCTGATGCTCCTCATCAGGG + Exonic
964155079 3:153575531-153575553 TCTGCTGAGGGTCCTCTTCCTGG + Intergenic
968291896 3:197545617-197545639 GCTGCTGATGGACCTTTTTCTGG - Intronic
968501363 4:951683-951705 GAAGGTGATGGTCATCATGCAGG - Exonic
968592923 4:1468449-1468471 GCTGCTGATGGTGGTGATGGTGG + Intergenic
969208773 4:5670286-5670308 GCTGCTGATGGTGATCATGATGG - Intronic
969283985 4:6190998-6191020 GCTGCTGTTTGTCCCCATCCTGG - Intronic
969781848 4:9410202-9410224 TGTGCTGATGGGCCTCCTGCTGG - Intergenic
971796575 4:31236259-31236281 GTTGCTGATGCTCGTAATGCTGG - Intergenic
974729438 4:65842989-65843011 TCTGCTGAGGGTCCTCTTCCAGG + Intergenic
974750784 4:66138116-66138138 GCTTCTGATGTTCCAAATGCTGG - Intergenic
977288931 4:95142621-95142643 CATGCGGATGGTCCTCCTGCTGG - Intronic
977289592 4:95149695-95149717 GCTGCTGCTGTTCCTCATAATGG + Intronic
977920380 4:102636727-102636749 GCTGGTGATCCTCCTCAGGCAGG + Intronic
979582788 4:122379622-122379644 GCTGCTGCTGCGCCTCAGGCCGG - Intronic
981277679 4:142920923-142920945 GATGCTGATGTTGCTCATTCTGG - Intergenic
982090829 4:151878700-151878722 ACTGCTGATGTTCTTCCTGCTGG + Intergenic
984474288 4:180216576-180216598 GCTGCTGCTGGCCCACATGTGGG - Intergenic
985279461 4:188270895-188270917 GCTGCTGCTGGTGCTGGTGCTGG - Intergenic
987156915 5:15097684-15097706 GCTGCTGATGATTCTGATGATGG + Intergenic
988280194 5:29135250-29135272 GCTGGTGATGATCCTGGTGCTGG + Intergenic
990407099 5:55502644-55502666 GCAGCTAATGGATCTCATGCTGG + Intronic
990528237 5:56649827-56649849 TCTGCAGCTGCTCCTCATGCTGG - Intergenic
992467046 5:77016248-77016270 GCTTCTAATGGTCCACATTCTGG - Intergenic
999486457 5:152001906-152001928 GCTGCTGTTGGCCCTCATACAGG - Intergenic
1001898645 5:175403849-175403871 GGTGCTGATGTTACTGATGCAGG - Intergenic
1002220915 5:177680754-177680776 CCTGGTGATGGTGGTCATGCTGG - Intergenic
1002810678 6:625215-625237 GCTGCAGAGAGTCCTCATACTGG - Intronic
1005973537 6:30779879-30779901 GCCGCTCAGGGGCCTCATGCTGG + Intergenic
1006614965 6:35319948-35319970 GCTGCTGCTGGGCCTGCTGCAGG - Exonic
1011596654 6:89023148-89023170 GCTGCTGATCCTCCAAATGCAGG - Intergenic
1012057746 6:94436161-94436183 GCCTCTGATGTTACTCATGCTGG - Intergenic
1012400053 6:98835242-98835264 GCTGCTGATGCTGCTGCTGCAGG - Exonic
1012925980 6:105268265-105268287 GCTCCTGTTGGTCCACATTCTGG - Intergenic
1016502462 6:144736939-144736961 GCAGCTGCTGGTCATCCTGCCGG + Intronic
1016873345 6:148840247-148840269 GCTGCTTCTGGTGCTCATGCTGG + Intronic
1019340024 7:504530-504552 GCTGGTGCTGTTCCTCCTGCTGG - Intronic
1019614738 7:1954100-1954122 GGTTCTGATGGGCCACATGCGGG - Intronic
1021027360 7:15686156-15686178 GCTGCTGATGGTGGTGATGGTGG + Exonic
1021856694 7:24864131-24864153 GCTTATTATGGTCCTCAGGCAGG - Intronic
1024598674 7:50961330-50961352 GATGCTGATGCTGCTCATCCAGG + Intergenic
1024604791 7:51014479-51014501 CCTGCTGATTGTCCTGAGGCAGG - Intergenic
1024922613 7:54575313-54575335 GTTGCTGCTGGTCCTCATGTGGG + Intergenic
1027179709 7:75929901-75929923 GGTCTTGATGGTTCTCATGCTGG - Intronic
1032074656 7:128830633-128830655 GCCGCTGTTGTTCATCATGCTGG - Exonic
1032189863 7:129758502-129758524 GGTGCTGATTGTCACCATGCAGG + Intergenic
1033838713 7:145347595-145347617 TCTGGCGATGGTCCTCTTGCAGG - Intergenic
1034386892 7:150747707-150747729 GCTGCTGCTGATCCTCCTGGTGG - Intronic
1034479338 7:151307733-151307755 GCTGCTCAGGGCCCTCAGGCAGG - Intergenic
1036837574 8:12088528-12088550 TGTGCTGATGGGCCTCCTGCTGG + Intergenic
1036859368 8:12334776-12334798 TGTGCTGATGGGCCTCCTGCTGG + Intergenic
1037474246 8:19240687-19240709 ACTGGTGATGGTCCTCGTGATGG + Intergenic
1039804297 8:40985292-40985314 CCTGCTGATCCTCCTCAAGCGGG + Intergenic
1040419006 8:47221813-47221835 GCTGGTGATGGTGTTGATGCTGG - Intergenic
1040419019 8:47221892-47221914 GCTGGTGATGGTGATGATGCTGG - Intergenic
1040444115 8:47476425-47476447 GCTGCTTATTGGCCGCATGCTGG - Intronic
1040951163 8:52940104-52940126 GTTGGTGACGGTCTTCATGCGGG - Exonic
1044138152 8:88612730-88612752 GCTGCTGCTGGTGCTTATGTGGG + Intergenic
1044834319 8:96280987-96281009 GCTACAGATGGGGCTCATGCCGG + Intronic
1045411614 8:101926169-101926191 GCTGCTGATGGCTCTGCTGCTGG - Intronic
1046652488 8:116852561-116852583 GCTGCTGATGCTGCTGTTGCTGG + Exonic
1047807257 8:128373393-128373415 GCTGCTGGTGGTACTGGTGCTGG + Intergenic
1047807260 8:128373429-128373451 GCTGCTTGTGGTACTGATGCTGG + Intergenic
1048007164 8:130428731-130428753 GCTGCTGATGGTGGTGATGTTGG - Intronic
1048427440 8:134336141-134336163 CCTGCAGATGGACCTCAGGCAGG + Intergenic
1048861432 8:138727052-138727074 GTTCCTGATAGTCCTCACGCAGG + Intronic
1049089721 8:140505607-140505629 GCTGCTGAAGGGCTCCATGCGGG + Intergenic
1049481045 8:142822968-142822990 GCCGCTGATGGTCCTAAGGAAGG + Intergenic
1049735002 8:144200113-144200135 GCTACTGATGGCCCTCTTGTGGG + Intronic
1050633162 9:7581792-7581814 TCTGCTGAGGGTCCTCTTCCTGG - Intergenic
1053351457 9:37416097-37416119 GCTGCTGGTGGTGCTGCTGCTGG - Intergenic
1054769212 9:69068550-69068572 GCTGCTGCTGGCCCTCCTGTGGG + Intronic
1056717028 9:89040117-89040139 GCTGCTGATGGTGCTGGTGGTGG - Intronic
1057498507 9:95578607-95578629 CCTGCTGTTGTTCCCCATGCTGG + Intergenic
1060960357 9:127676451-127676473 GCTGCTGATGGTCCTCACTCAGG + Intronic
1061492705 9:130955032-130955054 GCTGCTGATGATGCTGATGATGG - Intergenic
1061562482 9:131414880-131414902 GCTTCTGTTGGTCGTCATTCTGG + Intronic
1061648438 9:132026141-132026163 GCTGCTGCTGCTCCTCATTTTGG - Intronic
1062702995 9:137917878-137917900 GCTGCCCATGGTCCTCGGGCTGG - Intronic
1188024890 X:25197936-25197958 GCTGCTGATGCTCCTCCAGTTGG - Intergenic
1192451928 X:71250094-71250116 GCTGCTGCTGGGCCTCATACAGG + Exonic
1192457677 X:71290709-71290731 GCTGCTGGTGGTGCTGCTGCTGG - Exonic
1193092344 X:77508566-77508588 GCTGCTGATTGTACTGCTGCTGG + Exonic
1196517058 X:116626507-116626529 TCTGCTGAGGGTCCTCTTCCAGG - Intergenic
1198707612 X:139465684-139465706 GCTGCTGCTGCTTCTCCTGCTGG - Intergenic
1199264929 X:145818370-145818392 GCGGCTGTAGGTCCGCATGCCGG + Exonic
1200064732 X:153498870-153498892 GCTACTGATGGTCCTCAGAAGGG + Intronic