ID: 1083376656

View in Genome Browser
Species Human (GRCh38)
Location 11:62228828-62228850
Sequence ATACCCTTCTGGAAGTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083376656_1083376659 2 Left 1083376656 11:62228828-62228850 CCTTCACACTTCCAGAAGGGTAT No data
Right 1083376659 11:62228853-62228875 TTTGTTTGGTCCTTTTTATGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083376656 Original CRISPR ATACCCTTCTGGAAGTGTGA AGG (reversed) Intergenic
No off target data available for this crispr