ID: 1083381869

View in Genome Browser
Species Human (GRCh38)
Location 11:62275767-62275789
Sequence ATGTATATTCATCTGTTGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083381867_1083381869 26 Left 1083381867 11:62275718-62275740 CCAGATGGATGAGTGTGAGCACT No data
Right 1083381869 11:62275767-62275789 ATGTATATTCATCTGTTGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083381869 Original CRISPR ATGTATATTCATCTGTTGTC TGG Intergenic
No off target data available for this crispr