ID: 1083383290

View in Genome Browser
Species Human (GRCh38)
Location 11:62286574-62286596
Sequence AATTATGCACTCAGGGAGCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083383290_1083383294 -6 Left 1083383290 11:62286574-62286596 CCAAGCTCCCTGAGTGCATAATT No data
Right 1083383294 11:62286591-62286613 ATAATTTCTGTCCCTTTTAAGGG No data
1083383290_1083383293 -7 Left 1083383290 11:62286574-62286596 CCAAGCTCCCTGAGTGCATAATT No data
Right 1083383293 11:62286590-62286612 CATAATTTCTGTCCCTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083383290 Original CRISPR AATTATGCACTCAGGGAGCT TGG (reversed) Intergenic
No off target data available for this crispr