ID: 1083383293

View in Genome Browser
Species Human (GRCh38)
Location 11:62286590-62286612
Sequence CATAATTTCTGTCCCTTTTA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083383290_1083383293 -7 Left 1083383290 11:62286574-62286596 CCAAGCTCCCTGAGTGCATAATT No data
Right 1083383293 11:62286590-62286612 CATAATTTCTGTCCCTTTTAAGG No data
1083383289_1083383293 2 Left 1083383289 11:62286565-62286587 CCTTAAAATCCAAGCTCCCTGAG No data
Right 1083383293 11:62286590-62286612 CATAATTTCTGTCCCTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083383293 Original CRISPR CATAATTTCTGTCCCTTTTA AGG Intergenic
No off target data available for this crispr