ID: 1083383294

View in Genome Browser
Species Human (GRCh38)
Location 11:62286591-62286613
Sequence ATAATTTCTGTCCCTTTTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083383289_1083383294 3 Left 1083383289 11:62286565-62286587 CCTTAAAATCCAAGCTCCCTGAG No data
Right 1083383294 11:62286591-62286613 ATAATTTCTGTCCCTTTTAAGGG No data
1083383290_1083383294 -6 Left 1083383290 11:62286574-62286596 CCAAGCTCCCTGAGTGCATAATT No data
Right 1083383294 11:62286591-62286613 ATAATTTCTGTCCCTTTTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083383294 Original CRISPR ATAATTTCTGTCCCTTTTAA GGG Intergenic
No off target data available for this crispr