ID: 1083389487

View in Genome Browser
Species Human (GRCh38)
Location 11:62337553-62337575
Sequence TCCGCGTCCTGCGGTGCCCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 70
Summary {0: 1, 1: 0, 2: 0, 3: 5, 4: 64}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083389483_1083389487 -3 Left 1083389483 11:62337533-62337555 CCCAGCTTGAGGTCTCGGCGTCC 0: 1
1: 0
2: 0
3: 3
4: 53
Right 1083389487 11:62337553-62337575 TCCGCGTCCTGCGGTGCCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 64
1083389480_1083389487 22 Left 1083389480 11:62337508-62337530 CCGGGCGGCTGCGGGGCTGGCTC 0: 1
1: 0
2: 2
3: 28
4: 321
Right 1083389487 11:62337553-62337575 TCCGCGTCCTGCGGTGCCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 64
1083389484_1083389487 -4 Left 1083389484 11:62337534-62337556 CCAGCTTGAGGTCTCGGCGTCCG 0: 1
1: 0
2: 0
3: 2
4: 31
Right 1083389487 11:62337553-62337575 TCCGCGTCCTGCGGTGCCCTGGG 0: 1
1: 0
2: 0
3: 5
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083389487 Original CRISPR TCCGCGTCCTGCGGTGCCCT GGG Exonic
902053914 1:13584550-13584572 TCCCCGCCCTGCGGTGGCCCTGG + Intronic
902961867 1:19969218-19969240 TCAGCATCCTGCTGTGCCCTAGG + Intergenic
904799996 1:33085900-33085922 ACTTCTTCCTGCGGTGCCCTGGG + Intronic
908877558 1:68695282-68695304 TCAGAGTCCTGCAGTGCCCTAGG + Intergenic
910760326 1:90726170-90726192 TCCGCGTCCCGGGCTGCGCTAGG + Intergenic
911626713 1:100132721-100132743 TCCGCGTCATCCAGTGCCCGCGG - Intronic
914817120 1:151071188-151071210 TCCGCGGCCTGGGCTTCCCTTGG - Intronic
917541327 1:175917431-175917453 TCCTAGTCCTGCAGTGGCCTAGG - Intergenic
918487561 1:185045612-185045634 GCCGCGGCCAGCGGAGCCCTGGG + Exonic
919796896 1:201326357-201326379 TCCTTGTCCTGTGGTGACCTTGG + Intronic
922167313 1:223127085-223127107 TCCGCATGCTGTGGTGCCCCAGG - Intronic
924941987 1:248818423-248818445 TCTGTGTCCTGCGTTGCCTTGGG - Intronic
1063170993 10:3509859-3509881 TCTGCCTCCTGCTGAGCCCTCGG - Intergenic
1069878821 10:71579298-71579320 TCTGGGTCCTGGGGTTCCCTGGG - Intronic
1077211314 11:1372082-1372104 TTGGCGGCCTGCAGTGCCCTTGG + Intergenic
1083389487 11:62337553-62337575 TCCGCGTCCTGCGGTGCCCTGGG + Exonic
1103898902 12:124293288-124293310 CCCGCATCCTGCCCTGCCCTGGG + Intronic
1105004137 12:132710741-132710763 CCCGCGTCCTGCCGCGCCCCAGG + Intergenic
1105409568 13:20160828-20160850 TCCCCGCCCCGCGCTGCCCTCGG + Intronic
1105507515 13:21023159-21023181 TCCCCGGCCTTCGGAGCCCTCGG - Intronic
1111951629 13:94712934-94712956 GCCGCGTCCGGCCGTCCCCTGGG + Intergenic
1113809077 13:113126702-113126724 ACCGCGTTCTGCCTTGCCCTCGG - Intronic
1117804767 14:59480311-59480333 TCCTGCTCCTGTGGTGCCCTGGG - Intronic
1122370760 14:101227764-101227786 TCCCCGGCCTGCGGTGTCCAGGG - Intergenic
1124501028 15:30226029-30226051 CGCGCGTCCCGCGGTGACCTTGG + Intergenic
1124742541 15:32312638-32312660 CGCGCGTCCCGCGGTGACCTTGG - Intergenic
1129413427 15:75361974-75361996 TCCCCGTCCAGCGCTGACCTGGG - Intronic
1130224177 15:82045339-82045361 TCCGCGGCGTGGGGTGCCTTGGG - Intronic
1132544544 16:527343-527365 TCCGTGTCCCGCGGGGCTCTGGG - Intergenic
1132593153 16:735217-735239 GCTGCGTCCAGCTGTGCCCTAGG - Intronic
1133001328 16:2853075-2853097 CCCGCGTCCCGCTGCGCCCTAGG + Exonic
1136318100 16:29465857-29465879 TCACAGTCCTGCTGTGCCCTCGG - Intronic
1136432675 16:30205206-30205228 TCACAGTCCTGCTGTGCCCTCGG - Intronic
1142561426 17:811634-811656 CCGGCTTCCTTCGGTGCCCTGGG - Intronic
1143862187 17:9899003-9899025 TCCGCTCCCTGTGGTGGCCTTGG - Intronic
1145271721 17:21408391-21408413 TCCACCTCCTGTGGGGCCCTGGG + Intronic
1146182929 17:30709048-30709070 CGCGCGTCCTGCGGTGCCCACGG + Intergenic
1152197984 17:78928680-78928702 TCCCCTCCCTGCTGTGCCCTTGG - Intergenic
1160500640 18:79399883-79399905 TGCGCGCCCTGCGGAGCCCCGGG - Intronic
1160858409 19:1227523-1227545 TCCGCCTCCCGCGGGCCCCTGGG - Intronic
1161072163 19:2267988-2268010 TCAGCGCCCTGCAGTGCCCAGGG + Intronic
1161086397 19:2337576-2337598 CCCGCGTGCTCCGCTGCCCTGGG - Exonic
1162975881 19:14206757-14206779 CGCGCGTCCTGCGGTGCCCACGG - Intergenic
1163404477 19:17113652-17113674 TTCGCTTCCTGTGGTGCCCGGGG - Intronic
1163551798 19:17969566-17969588 GCCGCGTCCTAAGGTGCCCTGGG - Intronic
1167410126 19:49339476-49339498 TTCGCGTCCTTCGGTTGCCTGGG + Intronic
1168705765 19:58469521-58469543 TCCCCTTCCTTTGGTGCCCTGGG + Intronic
1178989756 21:37342966-37342988 TCCGCCTCCTGGGTTGCCCCCGG - Intergenic
1184879846 22:47297789-47297811 TCTGGGACCTGAGGTGCCCTGGG + Intergenic
953570843 3:44070408-44070430 TCAGAGTTCTGCAGTGCCCTGGG - Intergenic
954284538 3:49609498-49609520 TCCTCTTCCTGCAGTGCCGTTGG - Intronic
968908910 4:3466794-3466816 GCCTCGTCCTGGGCTGCCCTTGG + Intronic
969100489 4:4764698-4764720 GCCGTGGCCGGCGGTGCCCTGGG + Intergenic
984778387 4:183504209-183504231 CCCGCCTCCTGCCGGGCCCTCGG - Intergenic
985488979 5:168057-168079 TCTGGGTCCTGCCCTGCCCTGGG + Intronic
985806945 5:2052858-2052880 TCCGCCTCCTCCGGTCCTCTGGG + Intergenic
1002182806 5:177440295-177440317 TCCCCGCCCTGCGATGACCTGGG - Intronic
1006302254 6:33200010-33200032 CCCGCGACCTCCGGTGCCCAAGG + Intronic
1007098675 6:39229698-39229720 TGCACGCCCTGCGGTGCCCGAGG + Intergenic
1012977548 6:105796131-105796153 TGCGCTTTCTTCGGTGCCCTAGG - Intergenic
1019828230 7:3301299-3301321 TCCGCGCCCGGCGGACCCCTCGG + Intergenic
1030659743 7:112206474-112206496 CCAGCGTGCTGCGGGGCCCTGGG - Intergenic
1032274359 7:130441166-130441188 CCGGCGTCCCGCGTTGCCCTTGG - Exonic
1049718587 8:144105145-144105167 TCCGGGCCCTGCGGTCACCTGGG - Intronic
1049769522 8:144373434-144373456 ACAGCCTCCTGCAGTGCCCTAGG - Intronic
1049777558 8:144413634-144413656 TCCGCCTCCCGCGGTGATCTGGG - Intronic
1049830948 8:144700424-144700446 TCCGCCTGCTCCGGTGCCCATGG - Intergenic
1055513435 9:77016303-77016325 GCCGCGTCCGGCTGTGGCCTAGG + Intergenic
1061478420 9:130884442-130884464 TCCGCCTCCTGCGTTCCCCATGG + Exonic
1061974157 9:134059974-134059996 TCCCTGTCCTGCAGTGCCCAGGG - Intronic