ID: 1083390610

View in Genome Browser
Species Human (GRCh38)
Location 11:62347127-62347149
Sequence GCTGATATACAGGTTGTGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 113
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 104}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083390610_1083390617 27 Left 1083390610 11:62347127-62347149 CCCTCCACAACCTGTATATCAGC 0: 1
1: 0
2: 0
3: 8
4: 104
Right 1083390617 11:62347177-62347199 GTTTGACAGCACCTCTCTGAAGG 0: 1
1: 0
2: 1
3: 13
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083390610 Original CRISPR GCTGATATACAGGTTGTGGA GGG (reversed) Intronic
904200401 1:28815719-28815741 GCTCATGTACTGGTTGTGGCAGG - Intronic
906325311 1:44842097-44842119 GCAGATATACAGGGTGAGAAGGG - Intronic
910172677 1:84394596-84394618 GCTGATGTACTTGTTGTGGGAGG - Intergenic
915307706 1:154990182-154990204 GCGGATATACAGGATCTGGAGGG - Exonic
922273611 1:224056659-224056681 ACTCATATACAGATGGTGGAAGG - Intergenic
1062885256 10:1011187-1011209 GCGGAGATACAGGGTGGGGAAGG - Intronic
1063345137 10:5304687-5304709 GATGATATTCAGGTTGTGTGAGG - Intergenic
1066386736 10:34947675-34947697 GCTGAGACACAGGTAGTGCATGG + Intergenic
1067428154 10:46224707-46224729 GCTGACATCCAGGTTAAGGAAGG - Intergenic
1069878320 10:71576534-71576556 GCTGATAAACAGTGAGTGGAGGG + Intronic
1075394097 10:122114081-122114103 GCTGAAATAGACATTGTGGAGGG + Intronic
1076498692 10:130917121-130917143 GCTGAAATGCAGGTGGTGGCAGG - Intergenic
1076527579 10:131121935-131121957 GCTGACAGACAGTCTGTGGAGGG + Intronic
1081233319 11:40614276-40614298 GCTGATATAGAAGCTGTGGCAGG - Intronic
1082666591 11:55982626-55982648 GCTAATATCCAGGTTGGGGGAGG + Intergenic
1082936793 11:58664041-58664063 GCTAATATCCAGGTTGGGGGAGG - Intronic
1083390610 11:62347127-62347149 GCTGATATACAGGTTGTGGAGGG - Intronic
1083545938 11:63549449-63549471 GCTGAAAAACAGCTTGTGGAAGG - Intergenic
1084345415 11:68544054-68544076 GCTGATATCCAGATACTGGAAGG + Intronic
1086936318 11:92749005-92749027 GCTGTTATAAAGGTTGAGGCTGG - Intronic
1088760054 11:112920937-112920959 GCAGATATACAGGCAGCGGAAGG + Intergenic
1090810703 11:130239465-130239487 GCTGACATATTGTTTGTGGATGG - Intronic
1092448927 12:8584161-8584183 GCTGAAATATAGATTCTGGACGG + Intergenic
1099925283 12:89009448-89009470 GCATATATACATATTGTGGAGGG + Intergenic
1105663281 13:22523439-22523461 ACTGATATGCAGACTGTGGAAGG + Intergenic
1106467813 13:30028444-30028466 GCTGATAGCCAGTTTGTGGAAGG + Intergenic
1108434384 13:50387311-50387333 GCTGATATTTAGATTGTGGTGGG + Intronic
1114132493 14:19808361-19808383 ACTGATATACAGTTTTAGGAAGG + Intronic
1114239305 14:20851428-20851450 ACTAATAAACAGTTTGTGGAGGG - Intergenic
1121688967 14:95861373-95861395 GCAGTTATGCATGTTGTGGAAGG - Intergenic
1125528943 15:40398506-40398528 GCTGTTAAGCATGTTGTGGAAGG + Intergenic
1131606149 15:93904833-93904855 TCAGATATTCAGGTTGTTGATGG - Intergenic
1138952852 16:61934417-61934439 GCTTATGTAAAGATTGTGGAGGG + Intronic
1140674781 16:77317143-77317165 GCAGATGTACAGATTGTGGTAGG - Intronic
1150324411 17:64244667-64244689 GCTGCGATACAGTTTGTTGAGGG - Intronic
1151571946 17:74930879-74930901 GATGATAAACATGTTCTGGAAGG - Exonic
1155557330 18:27034260-27034282 GCTGATAGAGTGGATGTGGAAGG - Intronic
1159044196 18:63353361-63353383 GCTGAAGAACAGGTTGAGGAGGG + Intronic
1161804008 19:6431892-6431914 GCTGAGATTGAGGTTGTGGATGG - Intronic
1163350234 19:16772251-16772273 GCTAATATAGAGGCTGTGGCCGG + Intronic
1163606630 19:18279528-18279550 GCTGATGTCCAGGTTGGGGAGGG - Intergenic
1164462452 19:28460799-28460821 GATGATGAACAGGCTGTGGAAGG + Intergenic
1164690666 19:30208666-30208688 GCTGATATACAGCATTTGGCAGG - Intergenic
926311060 2:11676679-11676701 GCTGAAATACAGATGCTGGAAGG + Intergenic
927818976 2:26245376-26245398 GCGGCTATAGAGATTGTGGACGG + Intronic
927922013 2:26979937-26979959 GCTGAGGGTCAGGTTGTGGATGG + Intronic
928364453 2:30690495-30690517 GCTGAGCCACAGGTAGTGGATGG + Intergenic
930917542 2:56712149-56712171 GGTAATATACAGCTTCTGGAGGG - Intergenic
931640026 2:64373927-64373949 GCTGACAGATAGGATGTGGAGGG + Intergenic
933491767 2:82993500-82993522 GCTGATTTACAGGATAAGGAAGG + Intergenic
934614942 2:95764912-95764934 GCTGAAACCCAGGTTGTGGGAGG + Intergenic
934645961 2:96059575-96059597 GCTGAAACCCAGGTTGTGGGAGG - Intergenic
934839364 2:97615665-97615687 GCTGAAACCCAGGTTGTGGGAGG - Intergenic
937216051 2:120314288-120314310 GCTGAATTACAGGGTCTGGAAGG - Intergenic
937237550 2:120439944-120439966 GCTATGATGCAGGTTGTGGAGGG - Intergenic
937537639 2:122910669-122910691 GCTGATCTTCAGGTTTAGGAAGG - Intergenic
940984416 2:160038452-160038474 ACTGAGATACAGGTTGGAGAAGG + Intronic
945129588 2:206555360-206555382 GATGATGTATAGGATGTGGAAGG - Intronic
947451470 2:230212724-230212746 GAGGATATACAGGTGTTGGATGG + Intronic
947665174 2:231900928-231900950 GCTGGTATACAGGTGGGGAAAGG - Intergenic
948200453 2:236126575-236126597 TCTGGCATTCAGGTTGTGGAAGG - Exonic
1178943532 21:36927205-36927227 GCTGAGATGCAGGCTGTGGGCGG - Intronic
1181909190 22:26224719-26224741 GCTAATAGACTGGCTGTGGAGGG + Intronic
1185309674 22:50147138-50147160 GCTGATGTTCAGGTAGTGGGAGG + Intronic
950489356 3:13294140-13294162 GCTCATATACAGAAGGTGGAGGG + Intergenic
953135395 3:40177366-40177388 CCTGACCTACAGGCTGTGGAGGG + Intronic
957747896 3:84368245-84368267 TCTGATATACAGCTTGGGCAGGG + Intergenic
960408252 3:117288475-117288497 GCTGATAAATAGGATGTGGTAGG - Intergenic
961341748 3:126227780-126227802 GCAGCTCTACAGGTTGTAGAAGG - Intergenic
961641003 3:128364820-128364842 GCTGCCATGCAGGCTGTGGAGGG - Intronic
963866211 3:150364412-150364434 GATTATATACAGGTTGTGATTGG - Intergenic
964545110 3:157825996-157826018 ACTGCTATACAGGTTGCGGATGG + Intergenic
967432907 3:189408227-189408249 GCTCATATACTGCTAGTGGAAGG + Intergenic
968893333 4:3384523-3384545 GCTGACATACACATTTTGGAAGG - Intronic
969091746 4:4699156-4699178 GCTGCTATACAGCTAGTTGAGGG + Intergenic
977650305 4:99461441-99461463 GCTTATAAAGAAGTTGTGGATGG - Intergenic
978651116 4:111006321-111006343 GGTGATATGAAGGTTGTAGAAGG - Intergenic
994501265 5:100581260-100581282 GGTGATATAGAAGTTGTAGAAGG - Intronic
997480656 5:134182132-134182154 ACTGATATACACAATGTGGATGG + Intronic
998618460 5:143767754-143767776 CCTGATTTAGAGGATGTGGATGG + Intergenic
1000866365 5:166519402-166519424 GCTGTGGTACAGGTTGGGGAGGG + Intergenic
1002040515 5:176510598-176510620 TCTGATTTACAGATTCTGGATGG + Intergenic
1006808021 6:36801258-36801280 GGTAAAATACAGATTGTGGAGGG + Intronic
1008084189 6:47226788-47226810 TCTCATAAAGAGGTTGTGGAGGG + Intergenic
1008336204 6:50307713-50307735 GCTGATATGCATGTAGTTGAGGG - Intergenic
1014142638 6:117962216-117962238 GCTGATAGACAGGATGGGAAAGG - Intronic
1014365477 6:120535907-120535929 AATGATATAAAGGTTATGGATGG + Intergenic
1014494219 6:122100533-122100555 GGTAATATCCAGGTTGTTGATGG + Intergenic
1019819702 7:3233389-3233411 GCTGATATACAGGGTCTGTTTGG - Intergenic
1023702293 7:42904721-42904743 GCTGATTTGCTGGTGGTGGAAGG + Intergenic
1035564687 8:633668-633690 CCTGATATAAAGGTGGTGTATGG + Intronic
1036436558 8:8739704-8739726 TTTGATATCCAGTTTGTGGAGGG - Intergenic
1038213079 8:25538109-25538131 GCTGTTATAAATGTTGTGTAGGG + Intergenic
1038547702 8:28438480-28438502 GCTGAGAGACAGGTGGAGGAGGG - Intronic
1038637566 8:29300039-29300061 TGTAATATACAGGTTGTGGGAGG + Intergenic
1039033487 8:33333868-33333890 GCTGAAATACAGAGTGAGGAAGG + Intergenic
1039306262 8:36266675-36266697 GCTGATATGGAGGCTGTAGAAGG - Intergenic
1043350588 8:79355786-79355808 GCTGAAAAACAGTTTGTTGAAGG + Intergenic
1048249292 8:132846718-132846740 GGTGATATATAGGTTTTGGATGG - Exonic
1048641652 8:136369974-136369996 GGTGACATCCAGGTTGTGGGGGG + Intergenic
1050387648 9:5108005-5108027 GCTGATAAGTAGGCTGTGGATGG - Intronic
1051121588 9:13758036-13758058 GCTGATATCCCTGTTGTGGTAGG - Intergenic
1052772497 9:32702701-32702723 CCTGATAGACAGGGTGTGGGTGG + Intergenic
1059100187 9:111463945-111463967 GGTGATAAACAGTTTGTAGATGG - Intronic
1060206222 9:121684399-121684421 GCTGATATCCAGGTGCTGGGAGG - Intronic
1185623478 X:1467160-1467182 GCTGATAGACACTTTGTGGGTGG - Intronic
1185921064 X:4093533-4093555 ACTGATATACAGGATGTCAAAGG + Intergenic
1186786590 X:12961887-12961909 GCTGATCTACAGGGTATGGAGGG - Intergenic
1186925526 X:14329583-14329605 GCTGTTATAAAGGTTGGAGAAGG + Intergenic
1189820950 X:44870004-44870026 GCTTATAGTGAGGTTGTGGAGGG + Intergenic
1190259187 X:48787335-48787357 GCTGAGATACGGTTTGGGGAAGG - Intronic
1195776033 X:108406921-108406943 GGTGATATAATGATTGTGGAAGG + Intronic
1196045195 X:111249497-111249519 CCAGACATACAGCTTGTGGAAGG + Intronic