ID: 1083392151

View in Genome Browser
Species Human (GRCh38)
Location 11:62360432-62360454
Sequence TACTCATTTTCAATAATCTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 305
Summary {0: 1, 1: 0, 2: 0, 3: 24, 4: 280}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083392151_1083392152 -7 Left 1083392151 11:62360432-62360454 CCTTAGATTATTGAAAATGAGTA 0: 1
1: 0
2: 0
3: 24
4: 280
Right 1083392152 11:62360448-62360470 ATGAGTATAAGTCAAGATTTTGG 0: 1
1: 0
2: 0
3: 21
4: 212
1083392151_1083392153 17 Left 1083392151 11:62360432-62360454 CCTTAGATTATTGAAAATGAGTA 0: 1
1: 0
2: 0
3: 24
4: 280
Right 1083392153 11:62360472-62360494 AGAAAAAGAATGCTATAAAGTGG 0: 1
1: 4
2: 4
3: 73
4: 702

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083392151 Original CRISPR TACTCATTTTCAATAATCTA AGG (reversed) Intronic
901348566 1:8569969-8569991 TAATAATTTTTAAGAATCTAAGG - Intronic
901363471 1:8725119-8725141 TACTCAATAACAATAATCAAAGG + Intronic
905608230 1:39323867-39323889 TACTCATTTTCATAATTCTTAGG - Intronic
905751160 1:40465254-40465276 TAATCATTTTACATACTCTATGG - Intergenic
907327420 1:53648643-53648665 TATTCATTTTCACTGATGTATGG - Intronic
907955546 1:59224754-59224776 TTCTCACTTTCAAAAATCTCAGG - Intergenic
907962266 1:59294666-59294688 TACTCATTTACTATTGTCTATGG + Intergenic
907990447 1:59577407-59577429 TAATCACTTTCAATAATTCATGG - Intronic
908666609 1:66498764-66498786 TACCCATTGTCAATCATCTTAGG + Intergenic
910402556 1:86852062-86852084 TCCTCATTTGCAGTAATGTATGG - Intergenic
910977253 1:92919784-92919806 TACTCATTTCCATATATCTAAGG + Intronic
911522856 1:98948950-98948972 TTGACATTTTCAAAAATCTAAGG + Intronic
911908003 1:103594288-103594310 TTCTATTTTTCAATCATCTATGG + Intergenic
911913539 1:103666769-103666791 TTCTATTTTTCAATCATCTATGG + Intronic
911914913 1:103685178-103685200 TTCTATTTTTCAATCATCTATGG - Intronic
911955861 1:104234234-104234256 TACTTATTTTATGTAATCTATGG + Intergenic
912374424 1:109198739-109198761 TGCTCTTTTTCAGTAATCTCTGG - Intronic
912622745 1:111180387-111180409 TGCTCTTGTTCAATAAACTAGGG - Intronic
913124947 1:115778007-115778029 CACACATTTTCAATTTTCTAAGG - Intergenic
916848189 1:168674967-168674989 TACTCATTTTAAAAAAGATATGG + Intergenic
916890944 1:169111807-169111829 TTCTCATTTTTCATATTCTAGGG + Intronic
917069791 1:171137779-171137801 TCCTCATTTTGAATGCTCTAAGG - Intronic
917196502 1:172471696-172471718 AACTCATTTTCCAGAATCTGAGG + Intergenic
917367139 1:174244564-174244586 TAGTAGATTTCAATAATCTATGG + Intronic
917615168 1:176735315-176735337 TTTTCATTTTCACTCATCTATGG - Intronic
918581059 1:186130318-186130340 TTGTCAATTTCAATATTCTAAGG - Intronic
920954309 1:210603706-210603728 TACTGATTTTTAAAGATCTAAGG + Intronic
921176702 1:212601416-212601438 TGCTCATTTTCAACAAGGTAGGG + Intronic
921202482 1:212820917-212820939 TCCTGATTTGCAATACTCTAAGG - Intergenic
922074898 1:222233895-222233917 TATACATATTCAATAAGCTATGG - Intergenic
923315548 1:232776639-232776661 TACACATTGTCAATAAACTTGGG - Intergenic
924254276 1:242166571-242166593 TATTCACTTTTAATAATCTTGGG - Intronic
924482463 1:244449950-244449972 TCCTCAATTTTAATATTCTATGG - Intronic
1063326154 10:5104799-5104821 TAATAATTTTCAGTATTCTATGG - Intronic
1064521900 10:16211257-16211279 TTATCATTTTCAATGATCTTAGG + Intergenic
1067991536 10:51219155-51219177 TACTCATTTTCAAAAATTAGTGG + Intronic
1068168086 10:53357450-53357472 TTCTCATTCTCAATATTCTCGGG - Intergenic
1068329332 10:55540729-55540751 TCATCATTTTCAATAATATTGGG - Intronic
1068799302 10:61121460-61121482 TACTCATTCTCAAGTATCTAGGG + Intergenic
1069062753 10:63911440-63911462 TTCTGATTCTCAATAATCTTGGG + Intergenic
1074778085 10:116780906-116780928 TCCTTATTTTCATTAATCTCTGG - Intergenic
1075320690 10:121489598-121489620 TTCTCATTTTCAACTGTCTATGG + Intronic
1077747299 11:4920801-4920823 TTCTCATTTTGAATATTTTATGG - Intronic
1079492426 11:21003835-21003857 TACTGAACTTCAATAATTTATGG - Intronic
1080053068 11:27876578-27876600 ATCTCATTTTCATTAATCTAGGG + Intergenic
1080166619 11:29244733-29244755 TAAGAATTTTCAATAATCTTGGG + Intergenic
1083392151 11:62360432-62360454 TACTCATTTTCAATAATCTAAGG - Intronic
1083916486 11:65747813-65747835 TACACATTTTCAGTTATCTTGGG + Intergenic
1085661865 11:78375382-78375404 TACACAGTTTGAAAAATCTAAGG + Intronic
1086552394 11:88068216-88068238 TACACATTTTAAATAATGTGTGG + Intergenic
1086824324 11:91476282-91476304 AACTCAATTCCAGTAATCTAAGG + Intergenic
1087782496 11:102316286-102316308 AAATTATTTTCAATAATCTCAGG + Intergenic
1087869113 11:103269868-103269890 TATTCATTTTCAACTATATAGGG + Intronic
1088563261 11:111137372-111137394 TACATATTTTCAATTATCTTGGG + Intergenic
1092157923 12:6296395-6296417 TACTCATTTACAATTCTCTAAGG - Intergenic
1093845356 12:23964826-23964848 TACATATTTTCATTAATTTATGG + Intergenic
1094020872 12:25912847-25912869 AACACATTCTAAATAATCTATGG - Intergenic
1094040773 12:26119669-26119691 TAAACATTTTCAAAAATCAAGGG + Intergenic
1098622474 12:72619663-72619685 TAATCATTTTCAATAATATTAGG + Intronic
1098728251 12:73997401-73997423 TGCCCATTTTCTATAATTTACGG + Intergenic
1098791920 12:74835195-74835217 CACTCACTTTCATTAATCCACGG + Intergenic
1099632619 12:85169349-85169371 TCCTGATCTTCAATTATCTAAGG - Intronic
1099975168 12:89539132-89539154 TACACATTTGCAATTATCTGAGG - Intergenic
1103510864 12:121473082-121473104 ATCTCATTTTGAATAATCTTTGG - Intronic
1106277436 13:28225587-28225609 TAGTCATTTACAGTAATATAAGG + Intronic
1106656092 13:31748065-31748087 TGCTCATTTTCAAGACTATATGG + Intronic
1107027122 13:35813569-35813591 TACTCATTTTCTTTATTTTAAGG - Intronic
1108488589 13:50954798-50954820 TACTCATTGGCAATAATGTTTGG - Intronic
1110058450 13:71008879-71008901 TCCTTGTTTTAAATAATCTATGG - Intergenic
1111500192 13:89108766-89108788 TAGTCATTTTCAATAATGAATGG + Intergenic
1111876778 13:93907157-93907179 TATTTATTTTCAATAATTGAAGG - Intronic
1112312091 13:98327918-98327940 TAGGCATATTCAATAAGCTATGG + Intronic
1112600892 13:100854901-100854923 TACTCATTTTCTATCAACAAAGG - Intergenic
1112701199 13:102010848-102010870 TGCTCAATTTCAATCATCTGTGG + Intronic
1112720484 13:102238302-102238324 TACACATTTTAAATCATCTCTGG - Intronic
1112963074 13:105152083-105152105 TATTAATTTTCATTGATCTAAGG - Intergenic
1114790601 14:25653893-25653915 TATTCATTGTCCATAATCTTTGG - Intergenic
1116356946 14:43941157-43941179 TACTCTTTTTAAAAAATCTATGG + Intergenic
1116528541 14:45936748-45936770 TGCTCATTATCACTAATCAAAGG + Intergenic
1116672127 14:47856412-47856434 TGCTCATTTTGAATGATATAAGG + Intergenic
1120020088 14:79519575-79519597 CACTCATATTCTATAATCTATGG - Intronic
1120299586 14:82689846-82689868 TCCTCACTTTCAATCATCTTGGG - Intergenic
1120448784 14:84638906-84638928 TATTCATTTTCATTTCTCTAGGG - Intergenic
1121479473 14:94252348-94252370 TACTGGATTTCAATAATATAAGG - Intronic
1123907732 15:24936881-24936903 TACTTATTTTCAGTTATCAATGG + Intronic
1125188389 15:36959803-36959825 TATTCATTTTAAATAGGCTAAGG + Intronic
1125289673 15:38131834-38131856 TACTCATATTCAACAATCATTGG + Intergenic
1126462578 15:48928997-48929019 TCCTCATTGTCAATCATCTCAGG - Intronic
1131298109 15:91170046-91170068 TACTCGTTTTAAATCATCAAAGG + Intronic
1133995645 16:10745977-10745999 TACTCATCTTCAAAGATTTAGGG + Intronic
1134340586 16:13341471-13341493 TCCTCATTTTGAATCATCTTGGG - Intergenic
1135727378 16:24866948-24866970 ATCTCATTTTCAATAATGTATGG + Intronic
1137405446 16:48185603-48185625 TATTTAATTTCAATAATCAAAGG - Intronic
1138978001 16:62231407-62231429 TCCTCTTTTTCAAAAATATATGG + Intergenic
1146360400 17:32170938-32170960 TACTCATTAGCTAAAATCTAAGG - Intronic
1146558064 17:33844074-33844096 AACTCATTTTCAATAAGCTCTGG + Intronic
1149453959 17:56772158-56772180 TACTCATTTTCAAATGTCTTTGG + Intergenic
1153374887 18:4364566-4364588 TACACATTTTAAATAATATATGG - Intronic
1154240916 18:12653505-12653527 TACTCACTGTCACTTATCTAAGG + Intronic
1155219402 18:23670915-23670937 TTCTCATATTCAGAAATCTAAGG + Intergenic
1157430747 18:47623085-47623107 TACATATTTTAAATAACCTAAGG - Intergenic
1157712788 18:49861487-49861509 TAGTCATTTTAAATTATCTTGGG - Intronic
1158050677 18:53214565-53214587 CAGGCATTTTCAAGAATCTAAGG - Intronic
1161626669 19:5330936-5330958 TACCCACTTCCAATAATCAATGG + Intronic
925591936 2:5518286-5518308 TTTTCATTTTCAGTAATCAATGG - Intergenic
926758482 2:16254673-16254695 TATACATATTCAATAAGCTATGG - Intergenic
928239228 2:29572110-29572132 GTCACATTTTCAAGAATCTAAGG + Intronic
928909494 2:36404659-36404681 AACACATTTTCAATATACTATGG + Intronic
929475218 2:42239871-42239893 TTCTCATTCACAATAAACTAAGG - Intronic
931157472 2:59651923-59651945 TACTTATCTTCTATAATTTAGGG + Intergenic
934631897 2:95934909-95934931 TACTCATTTTCCAGAATCAGAGG + Intronic
936381414 2:111989695-111989717 TACTTGTTTTCAATGATCAAAGG - Intronic
939884249 2:147664119-147664141 TAGTCATTTTCCATCATCAAAGG - Intergenic
940569601 2:155414261-155414283 TAGTTATTTACAATTATCTATGG - Intergenic
941400781 2:165027950-165027972 TACTAATTTTCTATAAAATATGG + Intergenic
943738446 2:191384155-191384177 AATTCATTTACAATAAACTACGG - Intronic
944316910 2:198293869-198293891 TACTGAATTTTAATAATCTTTGG + Intronic
944467130 2:200013861-200013883 TACTCATTTGTAATTATCTGTGG + Intergenic
946425386 2:219592526-219592548 TACTTATTTACAATATTCTTCGG + Intergenic
946836924 2:223781929-223781951 TTCTCTTTTTATATAATCTATGG - Intronic
1169739146 20:8871111-8871133 TACTCTGTTTTCATAATCTATGG - Intronic
1170085082 20:12521961-12521983 TATTCATTTTCAAAAATCTTTGG - Intergenic
1170252079 20:14294830-14294852 TACTCATTTTTATTCATCAATGG - Intronic
1171522390 20:25785822-25785844 AAATCATTTTCAATATTCAAAGG + Intronic
1171530139 20:25847767-25847789 AAATCATTTTCAATATTCAAAGG + Intronic
1171554437 20:26070061-26070083 AAATCATTTTCAATATTCAAAGG - Intergenic
1173458972 20:43226596-43226618 TACTACTTTTCAACAATCTTAGG + Intergenic
1176656194 21:9590820-9590842 AAATCATTTCCAATAATCAAAGG + Intergenic
1176925969 21:14749131-14749153 TTGTCATTTTTAATACTCTATGG - Intergenic
1177090979 21:16768219-16768241 AACTAATTTTCAAGAATCTGCGG + Intergenic
1177249308 21:18571125-18571147 TAATCATTTAAAAAAATCTATGG + Intergenic
1177345645 21:19865418-19865440 AAATAATTTTCAATCATCTAGGG + Intergenic
1177818693 21:26006562-26006584 TAATCATTTTGTATAATCCAGGG - Intronic
1181121881 22:20674081-20674103 TACTCTTTTTCAATAGAGTATGG + Intergenic
949168986 3:976174-976196 TACTCATTTTGCATTATCTATGG - Intergenic
949358241 3:3204136-3204158 TACTCACTTCCAATATTCAATGG - Intergenic
949758975 3:7447378-7447400 TACCCATTTACAAAATTCTAAGG - Intronic
950763371 3:15254727-15254749 TAATCATTTTCAATTAATTAAGG - Intergenic
951102853 3:18709548-18709570 TGCTCATTTCCAATAAGCAATGG + Intergenic
951102969 3:18710676-18710698 TGCTCATTTCCAATAAGCAATGG + Intergenic
951392047 3:22117707-22117729 TAATCATTATTAATAATCAATGG - Intronic
951507297 3:23462063-23462085 TTCTCATTTTTAATAATATAAGG + Intronic
951573407 3:24089401-24089423 TAATTATTATCAATACTCTATGG - Intergenic
951645582 3:24887055-24887077 TACTCATTTTCATGCCTCTATGG - Intergenic
952357954 3:32602106-32602128 TACTATTTTTCAAAATTCTATGG + Intergenic
953977306 3:47391765-47391787 TACTCATTTTCTCTAACCTAAGG + Intronic
955181889 3:56680097-56680119 TACCCAGTTTGAATAATCTAAGG - Intronic
955436649 3:58907021-58907043 AAGTCATTTTCACTAGTCTATGG + Intronic
955441286 3:58957689-58957711 TAGTCATTTCCAACAATATATGG + Intronic
955895138 3:63691157-63691179 CTCTCATTTTCCATAAGCTATGG - Intergenic
956072241 3:65466071-65466093 TACTTTTTTTAAATCATCTATGG + Intronic
956350875 3:68335011-68335033 TACTAAGGTTCACTAATCTATGG - Intronic
956846053 3:73183847-73183869 TACTCAGGTTGAATAATTTAAGG - Intergenic
957134981 3:76275158-76275180 TACTTATATTCAATAATATCAGG + Intronic
957835340 3:85581076-85581098 TAATCATTAAAAATAATCTATGG - Intronic
957863289 3:85988286-85988308 TACTCATTTAAATTAAGCTATGG + Intronic
958644225 3:96848797-96848819 TACTCATTTTCCTTATTCTTAGG + Intronic
959502478 3:107122434-107122456 TACTTTTTTTCTATAATGTAAGG + Intergenic
959988982 3:112609880-112609902 GAATCATTTTGAATGATCTAAGG + Intronic
960437616 3:117646396-117646418 TAATCATTTTCAAGATACTAGGG + Intergenic
960977663 3:123191133-123191155 TACACATTTTCAATAATAAATGG - Intronic
961596860 3:128024626-128024648 CACTCATTTACTATAATCTATGG + Intergenic
962360390 3:134737606-134737628 TACTCTTTTTCACTATTCTGTGG + Intronic
964076349 3:152697408-152697430 TACTAATTTTCAAAAAACTTTGG + Intergenic
964095010 3:152921154-152921176 TACTCATTTTCAATTCTTTTGGG + Intergenic
964637299 3:158871518-158871540 TAGTCAATTACAATAATATATGG - Intergenic
965053576 3:163684298-163684320 TACTAATTTTCAAAAGTTTATGG + Intergenic
965235344 3:166111537-166111559 TACTCATTTTCAAAAGTGAAGGG + Intergenic
965369957 3:167849499-167849521 TATTCATTTTCACTGACCTAAGG - Intergenic
965421787 3:168468616-168468638 TACTCATTTACAATATATTACGG - Intergenic
965749920 3:171965382-171965404 TACTCATATTAAAAAATTTAAGG + Intergenic
965953486 3:174339290-174339312 TACTCATTTTAAGTAATTTTAGG - Intergenic
966447090 3:180013478-180013500 TACTTATTTTCTATAATATTTGG + Intronic
967403100 3:189085399-189085421 TACACATTTTCATTAATGTTTGG + Intronic
967411937 3:189175098-189175120 TACACATTTTCAATACTAGATGG - Intronic
967490059 3:190080105-190080127 AACTGATTTTCAAGATTCTACGG - Intronic
967598457 3:191356087-191356109 TACTCAATTGCAGTAATCTGAGG + Intronic
967824056 3:193864413-193864435 TACTCTTTTTCAATCATCCAAGG - Intergenic
970210808 4:13708076-13708098 TACTCCTCATCAATAATCTCTGG - Intergenic
972881619 4:43430601-43430623 TACTAATTTTATATAAACTATGG - Intergenic
973710262 4:53622996-53623018 GACTCATTTTCCCTAATCTCTGG - Intronic
973966292 4:56165416-56165438 TAATCATTATTAATAATCAATGG - Intergenic
974154384 4:58052104-58052126 TACTCATTTACTGTTATCTATGG - Intergenic
974219681 4:58950145-58950167 TACCGGTTTTCTATAATCTATGG - Intergenic
974305340 4:60130121-60130143 TATTCTTTTTCAATTAACTAAGG + Intergenic
974511558 4:62848953-62848975 TACTGATTTGTAATAATCTATGG - Intergenic
974813343 4:66973846-66973868 GACTCATTTTCACTAAGCCAGGG + Intergenic
975422681 4:74186850-74186872 TACTCATTTTCAAAATTGTTTGG - Intronic
978074021 4:104506812-104506834 CACTCATTCTCAAGAATCAACGG - Intergenic
978833324 4:113116228-113116250 TACTCATTATTAATTATCAAAGG - Intronic
979425723 4:120563144-120563166 TACTTATGTTCAATTATCTTGGG + Intergenic
979657458 4:123212190-123212212 TACTCGTTTTTAACAATCTGTGG + Intronic
980159826 4:129147008-129147030 TACTCATGTTGAATAAGCTGAGG - Intergenic
980382912 4:132048571-132048593 TCCTCAATTTCACTTATCTAGGG - Intergenic
980397230 4:132230096-132230118 AACTCACTTTTAATATTCTAAGG - Intergenic
982888748 4:160819762-160819784 TACTCATTTTCTACAGTCTTTGG + Intergenic
983381990 4:167007346-167007368 TAGGCATTATGAATAATCTAGGG - Intronic
983799579 4:171909659-171909681 TCTTCATTTTCAAAAGTCTATGG - Intronic
984029877 4:174590387-174590409 TATTTATTTTCAAAAATCCATGG - Intergenic
984520761 4:180798106-180798128 TATTCATTTTCTATAATATTTGG + Intergenic
984622466 4:181969242-181969264 TAGTAATTTTAAATAATCAAGGG - Intergenic
985181152 4:187264844-187264866 TATTCATTTTCACTACTGTATGG + Intergenic
986730477 5:10631636-10631658 TACACATATTCCATAAGCTATGG + Intronic
988318928 5:29668042-29668064 GACTCATTTTCAATTATATATGG + Intergenic
988378197 5:30466569-30466591 ATCTCATTTTCAATAATGGATGG + Intergenic
988427830 5:31084365-31084387 TAGTCATTTTAAAAAATCTCTGG - Intergenic
988443766 5:31262045-31262067 TATTAATTTCCAATAACCTAGGG + Intronic
990964184 5:61427334-61427356 TATTCACTTTAAATAATCTCTGG + Intronic
993858129 5:93100369-93100391 TATTTATTTTCTATAATTTATGG - Intergenic
994272665 5:97800146-97800168 TACTTATGTTTAAAAATCTAAGG - Intergenic
995346456 5:111125432-111125454 TACTGATTTTCAATTATTTTGGG + Intronic
995375762 5:111472545-111472567 TACCCATTTTCACAAATCTAAGG + Intronic
995461133 5:112404405-112404427 TAATGATTTTTAAAAATCTATGG + Intronic
995821638 5:116241215-116241237 AACTAATTTTCAATATTATAAGG - Intronic
996075770 5:119191885-119191907 TATTTATTTTTAAAAATCTATGG - Intronic
996273189 5:121633561-121633583 TTGTTATTTTCAATATTCTATGG + Intergenic
996767860 5:127052958-127052980 TTCTCTTTTTCACTGATCTAAGG + Intronic
999533539 5:152489521-152489543 AACTCTTGTTCAGTAATCTAAGG + Intergenic
999823525 5:155252256-155252278 TATTCATTTTGAATATTCTTAGG + Intergenic
1001988529 5:176096250-176096272 TGCTCATTTTCTATAGTCTCCGG + Intronic
1002228339 5:177741883-177741905 TGCTCATTTTCTATAGTCTCCGG - Intronic
1004762861 6:18689800-18689822 AAATCATTTCCAATAATCAATGG - Intergenic
1006839050 6:37016424-37016446 TGCTCATTTGCCATAATCTCTGG - Intronic
1007028776 6:38606489-38606511 TAATCATTTAAAATAATCAAAGG - Intronic
1007461033 6:42018982-42019004 AACTCATTTTGATTAATCAATGG + Intronic
1009569248 6:65361012-65361034 TACAGATATTCAATAATTTATGG - Intronic
1010013110 6:71073025-71073047 ATCTCATTTTCAATATTTTATGG + Intergenic
1011028192 6:82892415-82892437 TATTAATTTGCAATAATGTATGG + Exonic
1012013060 6:93816524-93816546 TTCTCTTTGTCAATACTCTATGG + Intergenic
1014847284 6:126292971-126292993 TACAAATTTTGGATAATCTATGG + Intergenic
1015305652 6:131704379-131704401 GATTCATTTTAAATAATCTGTGG + Intronic
1015757740 6:136625105-136625127 TTTTCAGTTTCATTAATCTAGGG + Intronic
1016250982 6:142042739-142042761 TAATCATTTTCTATAATTCAGGG - Intergenic
1017307021 6:152930347-152930369 TACTCAGTTTAAATAATCCCAGG - Intergenic
1017354244 6:153483351-153483373 TATACATATTCAATAAGCTATGG - Intergenic
1018933300 6:168256486-168256508 TATACATATTCAATAAGCTATGG - Intergenic
1021320213 7:19200173-19200195 CACATATTTTCACTAATCTATGG + Intergenic
1021668312 7:23010769-23010791 TAATAATTTACAATAATCTCAGG - Intronic
1022161695 7:27717307-27717329 GACTCATTTAAAATAATGTATGG + Intergenic
1022233172 7:28434569-28434591 TATTGAGTTACAATAATCTATGG - Intronic
1025282878 7:57640999-57641021 AAATCATTTTCAATATTCAAAGG + Intergenic
1026003073 7:66578155-66578177 TACACATTTTTAAGAAACTATGG - Intergenic
1026281504 7:68926261-68926283 TAAACATTTTCAAGAATTTATGG - Intergenic
1027574996 7:79920765-79920787 TACTCATATTCATTTATATAAGG + Intergenic
1027641271 7:80736368-80736390 TATACATATTCAATAAGCTATGG + Intergenic
1027691138 7:81346168-81346190 TTCTCATTTTCTATACTGTATGG - Intergenic
1027817365 7:82993093-82993115 TACATATTTTCAATAATATGTGG - Intronic
1028111942 7:86950981-86951003 TGCTTATTTTCAATGGTCTATGG + Intronic
1028466383 7:91157213-91157235 TGCTCATGTTCCAAAATCTAAGG - Intronic
1030551284 7:110963742-110963764 TTCTCATTTTAAATAAACTCTGG + Intronic
1030710794 7:112746815-112746837 TACTCATATTCAGGAATTTATGG - Intergenic
1030808212 7:113943203-113943225 TACTCTTTTTCAATATACTGTGG + Intronic
1031293026 7:119963598-119963620 AATTCATTTTCATGAATCTATGG + Intergenic
1032269555 7:130391366-130391388 TACACATTTTTACAAATCTATGG + Intergenic
1033262592 7:139856579-139856601 TATACATATTCAATAAGCTATGG + Intronic
1033739768 7:144262610-144262632 GATTCATTTTAAATAATCTGTGG + Intergenic
1034609819 7:152356271-152356293 TAATCATCTTCAATAATCAAAGG + Intronic
1035143727 7:156791293-156791315 CACTCATTTCCAACAATTTATGG + Intronic
1037209786 8:16372525-16372547 TATTCATTTTCAAAGAGCTATGG + Intronic
1037220380 8:16512426-16512448 TATTCATTTTCAATCCTCTCTGG - Intronic
1038121211 8:24617856-24617878 TACTCATTTTCATTAACACAAGG + Intergenic
1038694086 8:29790249-29790271 TACTCATGCTCATCAATCTAAGG + Intergenic
1040753690 8:50743662-50743684 TACTAATTTTCAATTTTCTTTGG - Intronic
1042331988 8:67590158-67590180 TAATCATTCTCAGTAAACTATGG - Intronic
1043581232 8:81718058-81718080 TACTGAATATCAATAATCAATGG + Intronic
1043935270 8:86135647-86135669 TACTCAATTTCAAAAATTTTAGG - Intronic
1044572088 8:93731328-93731350 CACCCATTTTGAATAATATATGG - Exonic
1044822556 8:96164782-96164804 TATTATTTTACAATAATCTAGGG + Intergenic
1045379267 8:101606920-101606942 TACTCCTTTTTCATAAGCTATGG - Intronic
1048854615 8:138675857-138675879 TACTGAATTTCCATTATCTATGG + Intronic
1050108274 9:2188298-2188320 TACATCTTTTCAATAATCTATGG - Intronic
1050599989 9:7240917-7240939 TACTCATCTTCTTTAATCTGCGG - Intergenic
1050851604 9:10294192-10294214 TACTCTTTATCAATAAACTTGGG - Intronic
1052208131 9:25868617-25868639 TACTAATCTTCAATTATCAATGG - Intergenic
1052541983 9:29823531-29823553 TACTCATTTTCAATACTAGATGG + Intergenic
1052681765 9:31701798-31701820 TACACATCTTGAATAATCCAAGG - Intergenic
1053491398 9:38507174-38507196 TACTAATTTTCCATAATATTTGG - Intergenic
1055032881 9:71788498-71788520 TTCTCATTTTCTATAAAATAAGG - Intronic
1055100987 9:72465377-72465399 TGCTCAGTTTGAATAATTTAGGG + Intergenic
1055313616 9:75010931-75010953 TAATCATTTTAAATAATTCAGGG - Intronic
1055845723 9:80560482-80560504 TATTCATTTTCTAAACTCTATGG + Intergenic
1057671699 9:97096363-97096385 TACTAATTTTCCATAATATTTGG - Intergenic
1058293702 9:103278062-103278084 TACTCATTTTTAATGAATTATGG + Intergenic
1058628260 9:106958569-106958591 TACTCATTTTGAGAAATCTTAGG - Intronic
1060121527 9:120995024-120995046 TGCTCATTGTGAATGATCTATGG - Intronic
1060585910 9:124785706-124785728 TACCCATTTTCAATTCTCTTGGG + Intronic
1060608962 9:124943035-124943057 TTCTCAATTTCTAAAATCTATGG + Intronic
1203633910 Un_KI270750v1:94280-94302 AAATCATTTCCAATAATCAAAGG + Intergenic
1188231300 X:27667274-27667296 TACTTATTCTTAATAATCAAAGG - Intronic
1188639661 X:32485105-32485127 TACTTACTTTCCATACTCTATGG - Intronic
1188900438 X:35726107-35726129 TATTCCTTTTCCATATTCTAAGG - Intergenic
1189109787 X:38277150-38277172 TATTCATTTTCCAAAATATAGGG + Intronic
1190560932 X:51684368-51684390 TGCTCGTTTTCCAGAATCTATGG + Intergenic
1190563359 X:51708953-51708975 TGCTCGTTTTCCAGAATCTATGG - Intergenic
1191237508 X:58146065-58146087 TGCTCTTTTTGAAGAATCTATGG + Intergenic
1191839972 X:65505474-65505496 TACTCTTTTTCAATATGCTGGGG - Exonic
1197483275 X:127013934-127013956 TCCTCACTTTCTATAATCTTTGG + Intergenic
1197889393 X:131252966-131252988 TACTGATTTTCAAAATTTTATGG + Intergenic
1198066684 X:133104780-133104802 AACTCACTTTCAATAATAAATGG + Intergenic
1198424921 X:136508039-136508061 TACTCATTTGCATAAATCTGAGG - Intronic
1199135787 X:144250563-144250585 TACTAATTTTCAATAGTAAATGG - Intergenic
1199550789 X:149058980-149059002 AACAAATTTTCAATAATATAAGG - Intergenic
1199797515 X:151214682-151214704 TCCTCAGTTTCAGTTATCTATGG + Intergenic
1201447214 Y:14070644-14070666 TACTCAACTTGAATAATCAAGGG + Intergenic
1201950368 Y:19557049-19557071 TAGTAATTATAAATAATCTAGGG - Intergenic