ID: 1083395262

View in Genome Browser
Species Human (GRCh38)
Location 11:62386857-62386879
Sequence CCATTCTACTGGAGGGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 187
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 176}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083395255_1083395262 5 Left 1083395255 11:62386829-62386851 CCAGGTTTGATGTGCCTCTTCAT 0: 1
1: 0
2: 0
3: 10
4: 172
Right 1083395262 11:62386857-62386879 CCATTCTACTGGAGGGCAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 176
1083395251_1083395262 25 Left 1083395251 11:62386809-62386831 CCACTTCCTGCACATCCTTGCCA 0: 2
1: 6
2: 159
3: 1338
4: 5023
Right 1083395262 11:62386857-62386879 CCATTCTACTGGAGGGCAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 176
1083395254_1083395262 10 Left 1083395254 11:62386824-62386846 CCTTGCCAGGTTTGATGTGCCTC 0: 1
1: 0
2: 0
3: 5
4: 130
Right 1083395262 11:62386857-62386879 CCATTCTACTGGAGGGCAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 176
1083395256_1083395262 -9 Left 1083395256 11:62386843-62386865 CCTCTTCATTTTAGCCATTCTAC 0: 1
1: 1
2: 5
3: 47
4: 331
Right 1083395262 11:62386857-62386879 CCATTCTACTGGAGGGCAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 176
1083395253_1083395262 19 Left 1083395253 11:62386815-62386837 CCTGCACATCCTTGCCAGGTTTG 0: 1
1: 0
2: 2
3: 16
4: 194
Right 1083395262 11:62386857-62386879 CCATTCTACTGGAGGGCAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 176

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083395262 Original CRISPR CCATTCTACTGGAGGGCAGG TGG Intronic
900981574 1:6048964-6048986 CGATTCTCCTGGAAGGCAGACGG + Intronic
902806710 1:18865599-18865621 CCATCCAACCGCAGGGCAGGGGG - Intronic
904606975 1:31703465-31703487 CCCTTCTATTGGCTGGCAGGAGG - Intronic
904696600 1:32335090-32335112 CCATTCTCCTGCAGGGCAGAGGG + Exonic
905031058 1:34884991-34885013 CCACTCTATTGGCGTGCAGGTGG - Exonic
905907898 1:41631787-41631809 GCAATCTATTGGAGGGCATGAGG - Intronic
906077173 1:43060598-43060620 CAATTCTACTGGTGGGGCGGGGG + Intergenic
906986400 1:50687818-50687840 CCATTCTAATGGAGGTAAAGTGG - Intronic
907043905 1:51288032-51288054 CCATCCAACTGGAGTGCCGGTGG + Exonic
907488386 1:54792862-54792884 CCCTTCTCCAGGAGGGGAGGGGG - Intronic
908648749 1:66309165-66309187 ACATACTACTGAAAGGCAGGTGG - Intronic
908787426 1:67749032-67749054 CCACTCCCCTGGAGGGGAGGAGG + Intronic
916191898 1:162187584-162187606 GTATAATACTGGAGGGCAGGAGG - Intronic
917587459 1:176442192-176442214 TTATTCTACTGGAGGGCTGGTGG + Intergenic
921525226 1:216209317-216209339 CCAAACATCTGGAGGGCAGGTGG - Intronic
922940747 1:229463273-229463295 CCCATCTACTGGAAAGCAGGAGG + Intronic
1063731368 10:8700693-8700715 CCCTTCTCATAGAGGGCAGGTGG - Intergenic
1064002403 10:11674576-11674598 CCATTCTTCCAGTGGGCAGGTGG - Intergenic
1064881890 10:20064834-20064856 TCATTTCACTGGAGGTCAGGAGG - Intronic
1067079762 10:43206263-43206285 CCATTCCAGGGCAGGGCAGGCGG + Intronic
1067294241 10:44965715-44965737 CCATCCCAGGGGAGGGCAGGGGG - Intronic
1068469264 10:57440006-57440028 CCATTCTAATGGATGTGAGGTGG - Intergenic
1068557034 10:58469617-58469639 CCATTCTTCTCCAGAGCAGGAGG + Intergenic
1069088198 10:64166696-64166718 CACTTCTACTGGAGGGAAAGGGG + Intergenic
1069181655 10:65368359-65368381 CCATTTTACTGGACAGTAGGTGG + Intergenic
1069545569 10:69325650-69325672 CCCAGCTACTGGGGGGCAGGGGG - Intronic
1071473805 10:86007446-86007468 CCATTCTCCTGCAGAGCAGTTGG - Intronic
1072191387 10:93079389-93079411 TCATTCTTCTGGAGGACAGCTGG + Intergenic
1073247900 10:102104659-102104681 CCATCCTACTTGGGGGCAGGGGG - Intergenic
1074480903 10:113819871-113819893 CCACTCTACTGAAAGTCAGGCGG - Intergenic
1075258395 10:120943392-120943414 CCATGGTGCTGGGGGGCAGGAGG + Intergenic
1075960253 10:126562286-126562308 ACAGTCTAAGGGAGGGCAGGGGG - Intronic
1077232619 11:1464833-1464855 CCACACCACTGGAGGGCAGGAGG - Intergenic
1077378525 11:2216646-2216668 CCTTTCTCCTGGAGGGCACCAGG + Intergenic
1078063644 11:8063830-8063852 CCTTTATACTGGAGGGCTGTGGG - Intronic
1078239808 11:9520863-9520885 CCATTCTACTGGATGTTAAGTGG + Intronic
1078602046 11:12741746-12741768 CCTTGCTACTGCAAGGCAGGGGG - Intronic
1080316605 11:30957069-30957091 CCGCTATAGTGGAGGGCAGGAGG - Intronic
1080606104 11:33866129-33866151 CCATTATACTTGGGGACAGGAGG + Intronic
1082834978 11:57645202-57645224 CCAGTCCCCTGGAGGGGAGGTGG - Exonic
1083157599 11:60834299-60834321 CCCCACTACTGGAGGGAAGGGGG + Intergenic
1083395262 11:62386857-62386879 CCATTCTACTGGAGGGCAGGTGG + Intronic
1083945875 11:65922271-65922293 CCAGTGTAGTGAAGGGCAGGTGG + Intergenic
1086474326 11:87154664-87154686 CCATTCTAATGGATGGGAAGTGG + Intronic
1097616126 12:61886477-61886499 GTATTCTTATGGAGGGCAGGAGG - Intronic
1099077470 12:78128763-78128785 TCATTCTACTGGAGGGCTTCAGG + Exonic
1099979764 12:89584996-89585018 ACATTGTCCTGGAGGGGAGGTGG - Intergenic
1100381004 12:94061843-94061865 CCATTCTAATGGATGCGAGGTGG - Intergenic
1101129602 12:101675127-101675149 CCATACTACTGGAAGGCAAAGGG + Intronic
1101693998 12:107107398-107107420 GCATTAGACTGGAAGGCAGGAGG + Intergenic
1103033744 12:117639892-117639914 CTATTCTACTGTCGGGGAGGTGG - Intronic
1104960863 12:132488237-132488259 CAATTCTTCTGGGGGGGAGGGGG + Intergenic
1108349942 13:49582744-49582766 CCATCCTAGTGGATGGGAGGTGG + Intronic
1110781071 13:79465361-79465383 ACAATCCAGTGGAGGGCAGGTGG + Intergenic
1112225747 13:97538228-97538250 CCATTGTAATGGAGGCCAAGAGG + Intergenic
1114141829 14:19920921-19920943 CCTTTTTACTGGAGGGGAGATGG + Exonic
1116379196 14:44244134-44244156 CCATTCTACTGAAGGACATTTGG - Intergenic
1119448835 14:74690132-74690154 CCAAGCTACTGGAGGCAAGGAGG + Intronic
1122075073 14:99230653-99230675 CCATTCTACAGATGGGCAGATGG - Intronic
1122083077 14:99280386-99280408 CCATTCTACTTCAAGGCAGCAGG - Intergenic
1122101069 14:99409964-99409986 CCATTCTAATGGGAGGCGGGGGG + Intronic
1122310224 14:100789563-100789585 CAATTCTCCTGGAGGGCTGCAGG - Intergenic
1122354867 14:101116845-101116867 CCCTGCTCCTGGAGGGCAGGTGG - Intergenic
1122976583 14:105173359-105173381 CCTGCCTACTGGAGGGCTGGAGG - Intronic
1124329534 15:28797795-28797817 CAGCTCTACTGGGGGGCAGGGGG - Intergenic
1128380900 15:67111682-67111704 CCATTCTAGTGGATGTGAGGTGG + Intronic
1129230440 15:74194191-74194213 CCTTTCCAGTGGGGGGCAGGAGG - Intronic
1129670589 15:77605753-77605775 CCTTTCTCCTGCAGGGCAGCTGG - Intergenic
1131807474 15:96137552-96137574 CTATTGTGCTGGAGTGCAGGAGG + Intergenic
1132060234 15:98686588-98686610 CCATTCTAATGGATGTGAGGTGG + Intronic
1132397477 15:101484865-101484887 CTATTCTACTTCAGGGAAGGTGG + Intronic
1134217571 16:12327860-12327882 TCATTCTACTGAGGGCCAGGTGG + Intronic
1134316181 16:13120868-13120890 CCATTTTACAGGTGGTCAGGGGG + Intronic
1138223852 16:55276016-55276038 CCATGTGACTGGCGGGCAGGCGG + Intergenic
1139958047 16:70702552-70702574 CCATCCTACTGCTGGGAAGGAGG + Intronic
1141625323 16:85258543-85258565 CCCTCCACCTGGAGGGCAGGCGG - Intergenic
1142237550 16:88929383-88929405 CCACTGTCCTGGTGGGCAGGGGG - Intronic
1143070997 17:4293142-4293164 CCCTACTGCTGGAGGGGAGGTGG - Intronic
1143205184 17:5136228-5136250 CCAGGCAGCTGGAGGGCAGGAGG - Intronic
1143514002 17:7410412-7410434 GCATTGTACTGGGGGGCACGTGG - Intronic
1145100456 17:20072452-20072474 CCACTCTCCTGGGGGGCAAGGGG - Intronic
1146480491 17:33201336-33201358 CCAGGCTACTGGAGGGCTGCCGG - Intronic
1146945617 17:36871033-36871055 CCATGCTAATGTAGGGAAGGTGG + Intergenic
1147208283 17:38854728-38854750 ACATTCTGCTGGGGTGCAGGTGG + Intergenic
1148819498 17:50352480-50352502 CCATTCCACTGCAGGGCAAATGG + Intronic
1150295524 17:64005415-64005437 CAGCTCCACTGGAGGGCAGGGGG - Intronic
1150790186 17:68196711-68196733 CCATTGGGCTGGAGGGCAGCAGG + Intergenic
1151376073 17:73689972-73689994 CCACTGTACTGTAGGGAAGGTGG + Intergenic
1152637184 17:81434982-81435004 CCCTTCTCCAGGTGGGCAGGAGG + Intronic
1156457979 18:37305368-37305390 CCAGTCTGCTGGAAGGGAGGAGG + Intronic
1157294117 18:46430004-46430026 CCATTCCACAGGGGAGCAGGAGG - Intronic
1160072356 18:75640012-75640034 CCATTTTACAGCAGAGCAGGAGG - Intergenic
1161250086 19:3275773-3275795 CCACTCTGCTGGAGGGAGGGAGG + Intronic
1165096093 19:33410664-33410686 CCATGCTGCTGGGGGGCAGAGGG + Intronic
1166672010 19:44716046-44716068 CCATTCTTCAGCAGGGCAGAGGG + Intergenic
926588643 2:14716632-14716654 CCATGGTCCTGGAGGGCAGCAGG + Intergenic
927862445 2:26568532-26568554 CCTTTCTTCTGGAGAGAAGGAGG - Intronic
927993662 2:27466403-27466425 CCATCCTGCTGGAGGGCCTGAGG - Intronic
929568760 2:43006691-43006713 CCATACTCCTTGAGGGCAGCAGG - Intergenic
930139950 2:47941568-47941590 CCATAATACTGGAGGGGAAGTGG + Intergenic
931140139 2:59448513-59448535 ACATTCTAGTGGAGAGCAGGTGG + Intergenic
934757134 2:96832198-96832220 CCATCCTTCTGGAAGACAGGAGG + Intronic
935844442 2:107149507-107149529 CCCTCCTACTGGAGTGCAGTAGG + Intergenic
937321663 2:120964563-120964585 CCATTGTGGTGGAGGGGAGGAGG + Intronic
938670226 2:133579515-133579537 CCCTTCTTTTGCAGGGCAGGAGG + Intergenic
942104460 2:172619148-172619170 CCAGTGCAGTGGAGGGCAGGGGG - Intergenic
942765979 2:179457570-179457592 CCATTCTAGTGGAGGTGTGGTGG + Intronic
944490396 2:200252927-200252949 CCATGCAACTTGAAGGCAGGGGG - Intergenic
946184261 2:217969732-217969754 CCATTCTAGTGGATGTCAAGTGG - Intronic
1168810508 20:701633-701655 ACCTGCTACTGGAGGTCAGGAGG - Intergenic
1170188296 20:13617549-13617571 CAGCTCTACTGGGGGGCAGGGGG + Intronic
1170586933 20:17741711-17741733 CCATTCTACAGTTGGGCAGCTGG - Intergenic
1170856238 20:20058191-20058213 CAATTTTACTAGAGGGCAGTAGG + Intronic
1170950820 20:20934323-20934345 TCATTCTATTGGTGGGCATGTGG - Intergenic
1171014444 20:21527306-21527328 CCATTCTACTGGTGGCAATGAGG + Intergenic
1172794713 20:37528594-37528616 CCAGTCTAATGGCGGGTAGGCGG + Intergenic
1173278482 20:41605334-41605356 CCATTCTAATGGAAGGGAGTTGG - Intronic
1174597824 20:51698589-51698611 CAATTCCAGTGGAGGGGAGGAGG + Intronic
1179218062 21:39384064-39384086 CCATTCTAATGGACGTAAGGTGG + Intronic
1179899813 21:44384435-44384457 CCCTTCCACTGGAAGGCAGAAGG + Intronic
1180021221 21:45128787-45128809 ACATGCCACTGGAGGGCAGCAGG - Intronic
1180021227 21:45128816-45128838 ACATGCCACTGGAGGGCAGCAGG - Intronic
949557556 3:5169586-5169608 CCATCCTACTGGATGTTAGGTGG + Intronic
949948301 3:9207774-9207796 CAATTCTCCAAGAGGGCAGGCGG + Intronic
950967936 3:17159300-17159322 CCATTTTCTTGGAGGGCAGGTGG + Intronic
952072924 3:29660868-29660890 TCATTCAGCTGGAGGGAAGGGGG + Intronic
952823573 3:37506180-37506202 ACATTCTACTGGGTGGCTGGTGG + Intronic
953356563 3:42261118-42261140 CAATTCTATTGGAGGGCAGTGGG - Intronic
956084252 3:65592925-65592947 ACAAGCTACAGGAGGGCAGGGGG + Intronic
959749634 3:109818346-109818368 CAATTCTACTGGATGCCATGAGG - Intergenic
962689501 3:137879815-137879837 CCATTCTAATTGAGGTGAGGTGG - Intergenic
966922901 3:184625930-184625952 CCACACTACAGGTGGGCAGGTGG - Intronic
968894889 4:3393707-3393729 CTATTCTACTGTCTGGCAGGAGG + Intronic
969107724 4:4820475-4820497 CAACTCTGCTGGAGGGCGGGAGG + Intergenic
972017167 4:34261974-34261996 CCCTACCACTGGAGGGCATGAGG - Intergenic
980225036 4:129971932-129971954 GCATTCTACCCTAGGGCAGGTGG + Intergenic
983413320 4:167424835-167424857 CCATTCTGCTGGAGCGCTGATGG - Intergenic
984609643 4:181823430-181823452 CCATTCTTTTGGATGGGAGGAGG - Intergenic
988994769 5:36704265-36704287 CCATCCTCCTGGAGGGCTGTTGG + Intergenic
989635139 5:43523957-43523979 GCATTCCACAAGAGGGCAGGGGG + Intergenic
990594548 5:57299878-57299900 CCTATCACCTGGAGGGCAGGAGG - Intergenic
991711110 5:69409347-69409369 CCTTCCTACTGGAGTGCAGCAGG - Intronic
992804456 5:80323346-80323368 CCACTCTACTGGAGGGGTTGGGG - Intergenic
996760827 5:126984336-126984358 CCCTTCTACAGCAGGACAGGGGG + Intronic
998107678 5:139478634-139478656 TCATTGTACAGGAGGCCAGGAGG + Intronic
999267403 5:150275914-150275936 CCATTCTCAGGGAGGGGAGGGGG - Intronic
1000980265 5:167809428-167809450 CCATGCTGCAGGAGAGCAGGAGG + Intronic
1001256377 5:170186563-170186585 TCATTTTACTGAAGGGCAGATGG - Intergenic
1002071660 5:176682154-176682176 CGGATCTACTGTAGGGCAGGAGG - Intergenic
1004522702 6:16377325-16377347 CCATTCAACTGGAGTGAATGTGG + Intronic
1006920132 6:37622362-37622384 CATTTCAACTGGAGGGAAGGAGG - Intergenic
1008876381 6:56334201-56334223 CCATGTTTCTGGAGGGCAGATGG - Intronic
1009452466 6:63817792-63817814 CCAACCAACTGCAGGGCAGGCGG - Intronic
1011203240 6:84861710-84861732 CTAATCTGCTAGAGGGCAGGGGG - Intergenic
1012704538 6:102504558-102504580 ACATTCTACTGAAGTGCACGTGG - Intergenic
1014761521 6:125362683-125362705 CCCCTGGACTGGAGGGCAGGAGG + Intergenic
1015351902 6:132229571-132229593 CCAATCTACTGTAGGGCAAAAGG + Intergenic
1020624475 7:10560594-10560616 CAACTCTACAGGAAGGCAGGAGG + Intergenic
1021360533 7:19707453-19707475 CCATTGGAGAGGAGGGCAGGGGG - Intronic
1021706525 7:23373461-23373483 CCATTCTAATGGAGGTGAAGTGG - Intronic
1021785887 7:24152189-24152211 CCATTCTACTTGACCTCAGGAGG - Intergenic
1023789326 7:43739549-43739571 CCATTCTACTGGAAGCAAAGTGG + Intergenic
1030315580 7:108110745-108110767 CCATTCATCAGGAGGACAGGTGG + Intronic
1032439055 7:131928053-131928075 CCATTCCACAGGAGGGAAGGAGG - Intergenic
1032457954 7:132087845-132087867 CCATGCTGCTGGAGATCAGGAGG - Intergenic
1034333307 7:150302704-150302726 CAATTCTACTGTAGTGAAGGGGG + Intronic
1034556203 7:151851940-151851962 CCTCTCAGCTGGAGGGCAGGGGG + Intronic
1034664736 7:152807189-152807211 CAATTCTACTGTAGTGAAGGGGG - Intronic
1034711546 7:153196488-153196510 CCATTCTAAGGAAGGGCAGAGGG + Intergenic
1035471017 7:159108775-159108797 CCATTCTCCTGGAGATCTGGAGG - Intronic
1038432534 8:27511635-27511657 CCACTCAACTGGAAGGCAGGAGG + Intronic
1043870903 8:85431343-85431365 CCATTGTAATGTAGGGCATGGGG + Intronic
1044213609 8:89580842-89580864 TCATTCTACTGGAGGTCACAAGG + Intergenic
1045288106 8:100809635-100809657 CCTTTTTACTGGAGGGGACGCGG - Intergenic
1048958720 8:139558036-139558058 GCATTGAACTGGAGGGCAGTAGG + Intergenic
1049203719 8:141353765-141353787 CCTTACAGCTGGAGGGCAGGGGG - Intergenic
1052067153 9:24036093-24036115 CAGTTCTACTGGAAGGCAGAAGG + Intergenic
1057352778 9:94314708-94314730 CTATTCTAATGAAGGGCAAGGGG + Intergenic
1057654969 9:96942882-96942904 CTATTCTAATGAAGGGCAAGGGG - Intronic
1058947309 9:109869853-109869875 CCTTGCTATTGCAGGGCAGGAGG + Intronic
1060211820 9:121715167-121715189 CCTTGCTCCTGCAGGGCAGGGGG + Intronic
1062268529 9:135698510-135698532 CCCTTCTCGGGGAGGGCAGGAGG - Intronic
1194097911 X:89666075-89666097 CCATGCTGCTGGAGGGAATGGGG + Intergenic
1197038181 X:121903554-121903576 CCATCCTCCTAGTGGGCAGGTGG - Intergenic
1197728549 X:129792378-129792400 CCTGTGTACTGGGGGGCAGGTGG - Exonic
1199814868 X:151388334-151388356 CCTTGTTCCTGGAGGGCAGGGGG + Intergenic
1200450933 Y:3327464-3327486 CCATGCTGCTGGAGGGAATGGGG + Intergenic