ID: 1083397219

View in Genome Browser
Species Human (GRCh38)
Location 11:62400171-62400193
Sequence CAGGATATGAGGGGCTCCCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1083397207_1083397219 -9 Left 1083397207 11:62400157-62400179 CCCCCACTGCCCCCCAGGATATG No data
Right 1083397219 11:62400171-62400193 CAGGATATGAGGGGCTCCCCAGG No data
1083397203_1083397219 12 Left 1083397203 11:62400136-62400158 CCTCCTGGCTGTAGGCCGGGTCC No data
Right 1083397219 11:62400171-62400193 CAGGATATGAGGGGCTCCCCAGG No data
1083397198_1083397219 18 Left 1083397198 11:62400130-62400152 CCAGCCCCTCCTGGCTGTAGGCC No data
Right 1083397219 11:62400171-62400193 CAGGATATGAGGGGCTCCCCAGG No data
1083397195_1083397219 26 Left 1083397195 11:62400122-62400144 CCCATAGGCCAGCCCCTCCTGGC No data
Right 1083397219 11:62400171-62400193 CAGGATATGAGGGGCTCCCCAGG No data
1083397201_1083397219 14 Left 1083397201 11:62400134-62400156 CCCCTCCTGGCTGTAGGCCGGGT No data
Right 1083397219 11:62400171-62400193 CAGGATATGAGGGGCTCCCCAGG No data
1083397193_1083397219 27 Left 1083397193 11:62400121-62400143 CCCCATAGGCCAGCCCCTCCTGG No data
Right 1083397219 11:62400171-62400193 CAGGATATGAGGGGCTCCCCAGG No data
1083397196_1083397219 25 Left 1083397196 11:62400123-62400145 CCATAGGCCAGCCCCTCCTGGCT No data
Right 1083397219 11:62400171-62400193 CAGGATATGAGGGGCTCCCCAGG No data
1083397208_1083397219 -10 Left 1083397208 11:62400158-62400180 CCCCACTGCCCCCCAGGATATGA No data
Right 1083397219 11:62400171-62400193 CAGGATATGAGGGGCTCCCCAGG No data
1083397202_1083397219 13 Left 1083397202 11:62400135-62400157 CCCTCCTGGCTGTAGGCCGGGTC No data
Right 1083397219 11:62400171-62400193 CAGGATATGAGGGGCTCCCCAGG No data
1083397205_1083397219 -3 Left 1083397205 11:62400151-62400173 CCGGGTCCCCCACTGCCCCCCAG No data
Right 1083397219 11:62400171-62400193 CAGGATATGAGGGGCTCCCCAGG No data
1083397204_1083397219 9 Left 1083397204 11:62400139-62400161 CCTGGCTGTAGGCCGGGTCCCCC No data
Right 1083397219 11:62400171-62400193 CAGGATATGAGGGGCTCCCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1083397219 Original CRISPR CAGGATATGAGGGGCTCCCC AGG Intergenic
No off target data available for this crispr